ID: 1172323236

View in Genome Browser
Species Human (GRCh38)
Location 20:34013681-34013703
Sequence CAGCAGTCCTAGAAGTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172323236_1172323240 27 Left 1172323236 20:34013681-34013703 CCCTTTGACTTCTAGGACTGCTG 0: 1
1: 0
2: 1
3: 10
4: 158
Right 1172323240 20:34013731-34013753 CCAAATCCTCTCTCATTCATTGG 0: 1
1: 0
2: 0
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172323236 Original CRISPR CAGCAGTCCTAGAAGTCAAA GGG (reversed) Intronic
901499764 1:9644745-9644767 CAGCAATCCTAGAAGAAAAATGG + Intergenic
902868187 1:19294937-19294959 CACAAGTCTTGGAAGTCAAAAGG - Intergenic
907282363 1:53359542-53359564 CAGCAGGCCCAGAAGCCCAAGGG - Intergenic
907857545 1:58318576-58318598 AAACTGTCCTAGAAGCCAAAAGG + Intronic
910028820 1:82690429-82690451 CACCAGTCTTAGAAGACAAGGGG + Intergenic
911123519 1:94319325-94319347 TGACAGTCCTACAAGTCAAAGGG + Intergenic
911269743 1:95786514-95786536 CAGCACCCCTAGAAGGCAATGGG - Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
913483108 1:119308398-119308420 CAGCAGTCAGAGAAGTCTTAAGG - Intergenic
917411298 1:174762509-174762531 TAGATGTCCTAGAAGACAAAGGG - Intronic
920983065 1:210856423-210856445 AAGCTGTCCTAGAAGTCAGTGGG - Intronic
921081567 1:211742810-211742832 CAGGAGTGCTGGAAGACAAAAGG - Intergenic
921818961 1:219594744-219594766 CAGCAGGCCAGGAAGTCAACAGG + Intergenic
924711084 1:246530592-246530614 CACAAGTCTAAGAAGTCAAAGGG + Intergenic
1063255712 10:4325107-4325129 AAGCTGTCCTAGAAATCACATGG - Intergenic
1064705434 10:18068254-18068276 CAGCATTCGTAGAATTTAAATGG + Intergenic
1070682585 10:78459207-78459229 CAGCAGTCCATGAAGTCATTTGG + Intergenic
1072571529 10:96662136-96662158 CATCATTCCTAATAGTCAAAAGG + Intronic
1074039683 10:109776031-109776053 AAGCAGCGCTAGAAGTAAAATGG - Intergenic
1074698285 10:116070796-116070818 CAGCAATCCCAGATGTCAATAGG - Intronic
1074940349 10:118230456-118230478 AAGCAGTCATAGAAGCCATATGG - Intergenic
1075261035 10:120963962-120963984 CACCTGTCCAAGAAGACAAAGGG + Intergenic
1075728356 10:124622192-124622214 CAGCAGTCCTCAAGGACAAACGG + Exonic
1078132489 11:8624358-8624380 CAGCAGTACCAGAACCCAAAAGG - Exonic
1081399284 11:42624207-42624229 CAGCAGTTCTAGAACCTAAATGG + Intergenic
1086283903 11:85223024-85223046 CAGCAGTCCAGGAAGGCAAGAGG + Intronic
1086863792 11:91955498-91955520 CATCATTCCTAGAAGATAAATGG - Intergenic
1087654553 11:100906656-100906678 CAGCAGTTCTATTAGTCAGATGG + Intronic
1089811740 11:121137822-121137844 CAGCTGGTCTGGAAGTCAAAGGG - Exonic
1095321155 12:40828853-40828875 CAGCACAGGTAGAAGTCAAATGG - Intronic
1097347908 12:58515323-58515345 GAGAAGTCCTAGAAGTAAGAAGG - Intergenic
1099260675 12:80377668-80377690 CATCAGTCACATAAGTCAAAGGG - Intronic
1101927688 12:108986245-108986267 CTGAGGTCCTAGAAGTCACATGG + Intronic
1103011628 12:117462655-117462677 CAGCAGTCCTAGGAGCCTCACGG + Exonic
1105331100 13:19416055-19416077 CATTATTCCTAGAAGACAAAAGG - Intergenic
1105919139 13:24944361-24944383 CATTATTCCTAGAAGACAAAAGG - Intergenic
1107727488 13:43313960-43313982 CAGCAGCTCTAGAACTTAAAGGG + Intronic
1108820546 13:54344542-54344564 CAGCAGGCCTAGAAAGCAATTGG - Intergenic
1110543410 13:76730412-76730434 CAACAGTCCTAGAAGTCCTTAGG + Intergenic
1110621612 13:77602243-77602265 CATCAGACCTAGTAGGCAAAAGG + Intronic
1111056261 13:82954456-82954478 CAGAAACCCTACAAGTCAAAGGG + Intergenic
1111179555 13:84645348-84645370 GAGAAGTCCTAGAACTGAAATGG - Intergenic
1111467757 13:88639457-88639479 CAGCAGCAATAGAAGTCTAATGG + Intergenic
1113881914 13:113631764-113631786 AAGCAGTCCTACAACTCTAAGGG - Intronic
1118877801 14:69799089-69799111 CATGAGGCCTTGAAGTCAAAGGG + Intergenic
1119634527 14:76263217-76263239 CAGCTCTCCCAGAACTCAAATGG - Intergenic
1120440890 14:84537887-84537909 CAGCATTCCTATATGTAAAATGG - Intergenic
1123177703 14:106437287-106437309 CAGCAATTCTTGAAGTTAAAGGG - Intergenic
1125322867 15:38507462-38507484 AAACAGTCCTAGAAGTCTGAAGG + Intronic
1126221700 15:46221722-46221744 GAGCAGTGCTAGAAGTGAATGGG - Intergenic
1127040259 15:54967479-54967501 CATCAGTCCTAAAATTCATAGGG + Intergenic
1127067114 15:55252130-55252152 CAGCATTCCAAGAATTCAAGAGG + Intronic
1130036712 15:80367774-80367796 CAGAAGTCTAGGAAGTCAAAGGG + Intronic
1131500067 15:92953840-92953862 AAGCAATCTTAGAAGTAAAAAGG - Intronic
1131863746 15:96683793-96683815 CAGCAGTCGTAGAATAGAAAAGG + Intergenic
1133503500 16:6387815-6387837 AAGCTCTCCTGGAAGTCAAAAGG - Intronic
1135251743 16:20906248-20906270 CAGAAGTGATGGAAGTCAAAAGG + Intronic
1137064050 16:35818288-35818310 CAACAGTCTTATAAATCAAAGGG + Intergenic
1137672540 16:50287733-50287755 GTGCAGTCCTAGAAGACACAGGG + Intronic
1138221039 16:55250672-55250694 CAGCAGTGCTGGAAGGCCAATGG + Intergenic
1141383288 16:83595731-83595753 CAGGCGTCCTTGCAGTCAAATGG - Intronic
1144361301 17:14496814-14496836 CAGTAGCCCTAGAAGACACAGGG - Intergenic
1147749050 17:42716621-42716643 CAGCATTTATATAAGTCAAAAGG - Intronic
1149144307 17:53471523-53471545 CATCAGGCCTAGAAATTAAAAGG + Intergenic
1151267529 17:72968215-72968237 CATCAGTTCTAGAATTTAAAAGG + Intronic
1151952405 17:77362408-77362430 CAGCAGTCCTGCAAGCCAGATGG - Intronic
1153811878 18:8759386-8759408 CAGCAGTCTTTGAAATCAACAGG - Intronic
1154194014 18:12253241-12253263 CAACAGTCCTGCAAGTCACAAGG + Intergenic
1154370092 18:13752731-13752753 CAGCAGTCCAGGAATTTAAATGG + Intronic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1159383880 18:67696874-67696896 CATCAGTCATAGAAGTCATCAGG - Intergenic
1163818570 19:19483028-19483050 CAACAGCCCCTGAAGTCAAAGGG - Intronic
1166931543 19:46304267-46304289 CAGCAGGCCAGGAACTCAAAGGG - Intronic
1167410642 19:49341781-49341803 CAGCAGTCCAAAAAGTTAAAGGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933720874 2:85396787-85396809 CAGCAGGGATAGAAGTGAAAGGG - Intronic
936141222 2:109943326-109943348 AAGCAATCCTAAAATTCAAATGG + Intergenic
936177910 2:110241275-110241297 AAGCAATCCTAAAATTCAAATGG + Intergenic
936203471 2:110428156-110428178 AAGCAATCCTAAAATTCAAATGG - Intronic
937773922 2:125753366-125753388 CAGTAGTGCTAGAAGAAAAAGGG - Intergenic
938992763 2:136646268-136646290 CAGCAGTCCTAGTAGTCATCTGG + Intergenic
939702213 2:145407154-145407176 ATGCAGTCCTAGAAGCCATATGG - Intergenic
940771587 2:157844698-157844720 CAGCAGCTCTTGAGGTCAAAAGG - Intronic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
945187968 2:207158789-207158811 CAGTAGTCTTAAAAGTAAAAAGG + Intronic
947593587 2:231397855-231397877 CAGAAGGCCCAGAAGCCAAATGG + Exonic
948735242 2:239999416-239999438 CAGCTGTGCTTGAAGTCAGAGGG - Intronic
1168870009 20:1119660-1119682 CAGCAGTCCTAGAACTCTGTGGG - Intronic
1169494190 20:6098121-6098143 CAGCAGCCCTGGAAGTAAAATGG - Intronic
1169982663 20:11404015-11404037 CAGCAGTGCTAGAAGATAAGAGG - Intergenic
1170883929 20:20321902-20321924 AGCCAGTCCTAGAAGTCACATGG - Intronic
1171077244 20:22140779-22140801 TAGCAATCCTAGAAATAAAAAGG - Intergenic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1173855167 20:46245696-46245718 CAGAAATCCTAGAAGACAACTGG - Intronic
1175391230 20:58628647-58628669 CAGCTTGCCTAGAAGTCAGAGGG - Intergenic
1176741902 21:10612569-10612591 CATTATTCCTAGAAGACAAAAGG + Intergenic
1178441989 21:32605763-32605785 CATCAGACCTAAAAGTTAAAGGG - Intronic
1180563782 22:16645806-16645828 CATTATTCCTAGAAGACAAAAGG + Intergenic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1183708505 22:39489182-39489204 CAGCAGTCTTGGCAGTCATAAGG - Exonic
1184345476 22:43910159-43910181 CAGGTTTTCTAGAAGTCAAAGGG - Intergenic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
951292676 3:20892793-20892815 CAAATGTTCTAGAAGTCAAATGG + Intergenic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
954053895 3:48006032-48006054 CGGTATTCCTAGAAGTGAAACGG + Intronic
954755152 3:52835217-52835239 CAGCTGTCCCAGAGGGCAAAGGG - Exonic
954863743 3:53711765-53711787 CAGAAGGCCTAAAAGTGAAAAGG + Intronic
955029793 3:55205064-55205086 CACTAATCCTATAAGTCAAATGG + Intergenic
955082256 3:55668631-55668653 CACCAGTCCCAGAGGTCAAGAGG - Intronic
955215051 3:56978231-56978253 CAGAAGTCTTTAAAGTCAAATGG + Intronic
958895872 3:99828869-99828891 CAGCAGTCCCAGCAGGCAAGTGG - Intronic
962264628 3:133936081-133936103 CAGAAGGCTTAGAAGACAAAAGG + Intronic
963359142 3:144248317-144248339 CAGCATTCCTGGGAGTCAAATGG - Intergenic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
970926428 4:21457763-21457785 CAGCAGTCCTATATATCACATGG - Intronic
973044711 4:45521444-45521466 CAGCAGCCCGAGAAGACAGATGG - Intergenic
974289367 4:59911088-59911110 CAGTGTTCCTAGAAGTGAAATGG + Intergenic
974624506 4:64405337-64405359 CAGGAGTGCTAGAAGTAGAAGGG + Intronic
976533290 4:86181322-86181344 AAGCAGCACTAGAAGTAAAAGGG - Intronic
977467158 4:97397129-97397151 CAGCACTCCTAGAATTCATATGG - Intronic
978816076 4:112907292-112907314 AAACACTCCTAAAAGTCAAATGG - Intronic
981008179 4:139897030-139897052 CAGCACTGCTAAAAGTCTAATGG - Intronic
982135874 4:152273520-152273542 CAGCAGTCCAAGAAGTCTGTGGG + Intergenic
984886331 4:184452972-184452994 AAGCATTCCTAGAAGTGACATGG - Intronic
986048783 5:4067337-4067359 CAGCAGCCCCAGAAGAAAAATGG + Intergenic
996297736 5:121942786-121942808 CAGAAGTCCTAGAATACACATGG - Intergenic
996861294 5:128069290-128069312 CAGGCGTCCTAAAAGTCAATAGG - Intergenic
1001105923 5:168854432-168854454 CAGTGATCCTAAAAGTCAAATGG - Intronic
1001198933 5:169698490-169698512 CAGCAGCCCTTGATGACAAAGGG - Intronic
1004176351 6:13343646-13343668 CAGCAATCCTAGAATAGAAATGG - Intergenic
1006350034 6:33514249-33514271 CAGCAGCCCTAGGAGACCAATGG + Intergenic
1006977573 6:38117696-38117718 CGGCTGTCCCAGAAGTGAAAGGG - Intronic
1007429695 6:41769632-41769654 CTGGAGTCCTAGAAGCCAAAAGG - Intergenic
1008960204 6:57258754-57258776 CAATAGTCCTAGAACTCAGAAGG + Intergenic
1009566710 6:65319869-65319891 CAGCAGGCCAGGAAGTCAATAGG - Intronic
1011047884 6:83106856-83106878 AAGCAGTCCTGAAAGTCAAAAGG + Intronic
1011227646 6:85125702-85125724 GAGAAGTCCCAGAAGACAAATGG + Intergenic
1012601891 6:101109167-101109189 CTGCAATCCTAGAGCTCAAATGG - Intergenic
1017186321 6:151604310-151604332 AAGCAGTCCCAGAAATCCAATGG - Intronic
1018555851 6:165050056-165050078 CAAAAGTCCAGGAAGTCAAAGGG + Intergenic
1021109264 7:16675581-16675603 CAGAAGGCCTAGTAGTCAATGGG - Intronic
1022569768 7:31440867-31440889 CAGCAGTCATAGATGTGACATGG + Intergenic
1022776800 7:33535048-33535070 CAGCATTCCTAGAAGTGAAAAGG + Intronic
1022819206 7:33942475-33942497 CAGCAGGCCTGGAAGCCTAATGG - Intronic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1028832582 7:95343521-95343543 CAGCAGCCCTTGGATTCAAAAGG - Intergenic
1031383111 7:121112641-121112663 CAGAAGTCCTAAAAAGCAAAAGG + Intronic
1032367491 7:131314176-131314198 CAGTACTCCTAAAAGTCAAAGGG + Intronic
1033793051 7:144815594-144815616 CAACAAACATAGAAGTCAAAAGG + Intronic
1035566478 8:644464-644486 CAGCAGTCTTAGCTGACAAATGG - Intronic
1035770338 8:2142360-2142382 CAGCAGCTCTAAAAGTTAAAGGG - Exonic
1036102668 8:5803886-5803908 CAAAAGTCAAAGAAGTCAAAAGG + Intergenic
1036446685 8:8827583-8827605 AAGAAGTCTTAGAAGTCAATAGG - Intronic
1037243094 8:16800128-16800150 CAGCAATCCTACAATTTAAAGGG + Intergenic
1043451937 8:80376512-80376534 CAGCAGTGCTAGTACACAAAGGG + Intergenic
1048603711 8:135946044-135946066 CAGAAGTCATAGCAATCAAATGG - Intergenic
1051398389 9:16652766-16652788 CAACATTCCTAAAAGTGAAAGGG + Intronic
1053432447 9:38052006-38052028 CAGCAGTGCAAGAAGGGAAAGGG - Intronic
1057540119 9:95959823-95959845 AAGGAGTCCTAAAAGACAAAAGG + Intronic
1058469919 9:105267209-105267231 CAGCGACCCTAGAAGTCAGAAGG - Intronic
1059047370 9:110883833-110883855 AAGCAGGCCTAGAAATCAATGGG - Intronic
1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG + Intergenic
1185908828 X:3963656-3963678 CAGCAGTCCCAACAGTAAAATGG - Intergenic
1186719360 X:12286467-12286489 CAGAAATCATAGAATTCAAAGGG - Intronic
1188107119 X:26159297-26159319 CAGCAGACAGAGAAGTCCAAGGG + Intergenic
1190447071 X:50536800-50536822 CAGCAGTACTTGAAACCAAAAGG + Intergenic
1192100768 X:68262075-68262097 AAGCAGTACAAGAAGTAAAATGG + Intronic
1193045804 X:77052433-77052455 AAGCAATCCTAAAATTCAAATGG + Intergenic
1197315742 X:124963810-124963832 AAGCAGTCCTGGAAGAGAAAGGG + Exonic
1202600226 Y:26586759-26586781 CATTATTCCTAGAAGACAAAAGG + Intergenic