ID: 1172326815

View in Genome Browser
Species Human (GRCh38)
Location 20:34042221-34042243
Sequence GACGATCCCCGCTCCCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172326809_1172326815 0 Left 1172326809 20:34042198-34042220 CCCCACTACCCTTACCAAACAAA 0: 1
1: 0
2: 0
3: 13
4: 226
Right 1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1172326810_1172326815 -1 Left 1172326810 20:34042199-34042221 CCCACTACCCTTACCAAACAAAG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1172326808_1172326815 3 Left 1172326808 20:34042195-34042217 CCTCCCCACTACCCTTACCAAAC 0: 1
1: 1
2: 19
3: 121
4: 812
Right 1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1172326807_1172326815 16 Left 1172326807 20:34042182-34042204 CCTAGTAGCTCAGCCTCCCCACT 0: 1
1: 0
2: 5
3: 32
4: 517
Right 1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1172326813_1172326815 -9 Left 1172326813 20:34042207-34042229 CCTTACCAAACAAAGACGATCCC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1172326811_1172326815 -2 Left 1172326811 20:34042200-34042222 CCACTACCCTTACCAAACAAAGA 0: 1
1: 0
2: 2
3: 20
4: 386
Right 1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1172326812_1172326815 -8 Left 1172326812 20:34042206-34042228 CCCTTACCAAACAAAGACGATCC 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172326815 Original CRISPR GACGATCCCCGCTCCCGCCG AGG Intronic
902518452 1:17002323-17002345 GACGTCCACCGCTCCCGCCATGG - Exonic
906640327 1:47437632-47437654 CTCGAGCCCAGCTCCCGCCGCGG + Exonic
906650392 1:47508615-47508637 TTCGCTCCCCGCCCCCGCCGGGG + Intergenic
907011562 1:50968484-50968506 GCCGAACCCCGCTCCAGCTGGGG + Exonic
917854604 1:179090279-179090301 GAGGTTCCCCCCTCCAGCCGAGG + Intronic
1070309337 10:75261957-75261979 GAGGCTCCCCGCTGCCTCCGTGG - Intergenic
1077178049 11:1199499-1199521 CAGGATCCCCGCTCCAGCCAAGG + Intronic
1078216185 11:9314182-9314204 CACGGTCTCTGCTCCCGCCGCGG + Intronic
1084028460 11:66467072-66467094 CACGCCCCCCGCGCCCGCCGGGG - Intronic
1088764320 11:112961823-112961845 GCCGAACCCCGCTCCCTCCAGGG + Intronic
1090013133 11:123062449-123062471 GACGCTCCCCTCCCCCGCCCGGG - Intronic
1115422665 14:33215213-33215235 GATGCTGCTCGCTCCCGCCGGGG + Exonic
1202921987 14_KI270723v1_random:35335-35357 GGCGATCCCCTCTGCCGGCGCGG - Intergenic
1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG + Intronic
1125202340 15:37111021-37111043 AACGCTCCCCGCTGCTGCCGCGG + Intergenic
1129666452 15:77582144-77582166 GACCACCCCCGCCCCCGCCATGG + Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1133053918 16:3135290-3135312 TACGATCGCCGCTCGCCCCGCGG + Exonic
1133076344 16:3283673-3283695 GAGGAGCCCCGCTCCAGCCCAGG - Exonic
1142226759 16:88881336-88881358 GAAGGGCCCCGCTCCCGCCGCGG - Exonic
1150388899 17:64779926-64779948 CACAAGCCCCGCTCCCGCCCCGG + Intergenic
1150790547 17:68197995-68198017 CACAAGCCCCGCTCCCGCCCCGG - Intergenic
1151585001 17:75003532-75003554 GACGATCCCCAGCCCGGCCGCGG + Exonic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1160861276 19:1238097-1238119 GCCGCCCCCCGCACCCGCCGCGG + Intergenic
1160966661 19:1749708-1749730 ATCGATCCCCGCGCCCGCCCGGG - Intergenic
1162809671 19:13156163-13156185 GCCGACCCCCGCCCCCGCCCGGG + Intergenic
1162951373 19:14073641-14073663 GCCGTCCCCCGCCCCCGCCGAGG - Exonic
1165805061 19:38575424-38575446 GGTGATCCCCCCTCCCGCCTTGG - Intronic
1165808554 19:38596635-38596657 CACGACCCCCGTTCCCGCGGAGG - Intronic
1166218461 19:41351486-41351508 AGCGATCCCCGCCTCCGCCGGGG + Intronic
1166367380 19:42284425-42284447 GACGGCCCCCGCGCGCGCCGGGG + Intronic
1166853385 19:45770854-45770876 GAAGATCCGCCCTCCTGCCGTGG + Intronic
925585173 2:5458120-5458142 GTCGTTCCCCCCACCCGCCGGGG - Intergenic
935692620 2:105744889-105744911 GACGATCCCCGCGGCAGCGGCGG - Exonic
945102506 2:206274954-206274976 GCCGCGCCCCGCCCCCGCCGCGG - Intronic
948988717 2:241541264-241541286 GACAGGCCCCGCCCCCGCCGCGG - Intergenic
1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG + Intronic
1172773126 20:37393024-37393046 GCCCCTCCCCGCTCCCGCCCAGG + Intronic
1173488224 20:43457290-43457312 GACGTTCCCCTCTCCCTCCATGG - Intergenic
1180338070 22:11597732-11597754 GAGGAGCCCGGCTCCAGCCGGGG + Intergenic
1180636276 22:17265145-17265167 GCCGCTCCCGGCTCCAGCCGTGG + Intergenic
953399542 3:42600827-42600849 GACGAGGCCCCCTCCCGCCCCGG - Intronic
961694942 3:128698230-128698252 GCCCTTCCCCGCTCCCGCCTCGG + Intergenic
975118520 4:70705023-70705045 GCCGCGCCGCGCTCCCGCCGGGG + Intronic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
988941454 5:36151934-36151956 GACCAGTCCCGCTCCCGCGGGGG + Exonic
1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG + Intergenic
1005940299 6:30555664-30555686 GCCGCTCCCGGCTCCCGCTGCGG + Exonic
1006694713 6:35921099-35921121 GGCGACTCCCGCTCCCGCCGCGG + Exonic
1011624571 6:89272636-89272658 GACAATGCCCTCTCCCGCTGAGG - Intronic
1019343820 7:520263-520285 GCCGGTCCCCGCCCCCGCCCCGG + Intronic
1021106468 7:16645052-16645074 GCCGATCCCCGCCCCCGCTTGGG - Intronic
1024919387 7:54542215-54542237 GACGAGCCCTGCGCCCTCCGCGG + Intergenic
1028417435 7:90595880-90595902 GACGCTGCCCGCTCCCACCCCGG + Intronic
1034338945 7:150340400-150340422 GACCCTCCCCGCTCCTGCCCGGG + Intronic
1036656555 8:10680907-10680929 GAGGACCCCCGCTCCTGCCTGGG - Intronic
1046207595 8:111021908-111021930 GACGGTCCCCCCTCCAGCCTGGG + Intergenic
1047526795 8:125640921-125640943 CACCACCCCCTCTCCCGCCGAGG + Intergenic
1049300385 8:141866603-141866625 GACGATCCCCCTTCCCGCTCAGG - Intergenic
1052940118 9:34126369-34126391 GTCGCTCCCAGCTCCCGGCGAGG + Exonic
1061485611 9:130919122-130919144 GCCCAGCCCCGCGCCCGCCGTGG - Intronic
1197774461 X:130110519-130110541 GTCGGTCCCCGCGGCCGCCGGGG + Intronic
1199329572 X:146543094-146543116 GACCATCCCAGCTCCAGCCATGG - Intergenic