ID: 1172328296

View in Genome Browser
Species Human (GRCh38)
Location 20:34054701-34054723
Sequence CTGGCATCCCAGCTACTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13920
Summary {0: 1, 1: 19, 2: 1176, 3: 4634, 4: 8090}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172328290_1172328296 -3 Left 1172328290 20:34054681-34054703 CCAGGCGTGATGGTGTATGCCTG 0: 5
1: 324
2: 5933
3: 28793
4: 75361
Right 1172328296 20:34054701-34054723 CTGGCATCCCAGCTACTTGGGGG 0: 1
1: 19
2: 1176
3: 4634
4: 8090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172328296 Original CRISPR CTGGCATCCCAGCTACTTGG GGG Intronic
Too many off-targets to display for this crispr