ID: 1172331594

View in Genome Browser
Species Human (GRCh38)
Location 20:34079458-34079480
Sequence CTCAAACACTAGTGTTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172331589_1172331594 6 Left 1172331589 20:34079429-34079451 CCCTTGGGGTGGCTTGGGTGGAG 0: 1
1: 0
2: 0
3: 21
4: 217
Right 1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 162
1172331584_1172331594 12 Left 1172331584 20:34079423-34079445 CCCATTCCCTTGGGGTGGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 162
1172331586_1172331594 11 Left 1172331586 20:34079424-34079446 CCATTCCCTTGGGGTGGCTTGGG 0: 1
1: 0
2: 1
3: 23
4: 183
Right 1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 162
1172331590_1172331594 5 Left 1172331590 20:34079430-34079452 CCTTGGGGTGGCTTGGGTGGAGG 0: 1
1: 1
2: 1
3: 30
4: 328
Right 1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 162
1172331579_1172331594 27 Left 1172331579 20:34079408-34079430 CCTACTACTCTCTGACCCATTCC 0: 1
1: 0
2: 0
3: 21
4: 278
Right 1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172331594 Original CRISPR CTCAAACACTAGTGTTTCCA GGG Intronic
900775537 1:4582039-4582061 CTCAAAACCTAGTTTGTCCATGG - Intergenic
904813504 1:33179408-33179430 CTCAAAGACTAGTGTGTGGAGGG + Intronic
908546216 1:65164719-65164741 ATCAAAAACTTGTGCTTCCAAGG - Intronic
908878870 1:68708663-68708685 CTTAAATATTAGTGTTTCCCAGG + Intergenic
911594733 1:99787237-99787259 TGCAAATACTAGTGTGTCCAAGG + Intergenic
914442442 1:147719254-147719276 TTCAAACAATAGTGGCTCCAAGG - Intergenic
917019002 1:170566081-170566103 CTTAAACACTAGGGTTTGTACGG - Intergenic
918016286 1:180636178-180636200 CTGTAACACAAGTGTTCCCATGG - Intronic
918747309 1:188221229-188221251 TAGAAAGACTAGTGTTTCCATGG + Intergenic
919052957 1:192533871-192533893 CTGAAAAACTGGTGTTGCCATGG + Intergenic
919601717 1:199631441-199631463 CTTCATTACTAGTGTTTCCATGG + Intergenic
920566068 1:206974433-206974455 CTCTAACACTAGTGAGTGCAGGG + Intergenic
921661599 1:217809244-217809266 CAGAAACACTAGTAATTCCAAGG + Intronic
921681327 1:218035804-218035826 CTCAAAAAACAGTTTTTCCAAGG - Intergenic
923040513 1:230316984-230317006 CTCAGACTCTTGTGTTTGCAGGG + Intergenic
924042933 1:240001467-240001489 TTAAAACACTGGTGTCTCCATGG - Intergenic
924817254 1:247453310-247453332 CTCAAACTCCAGGGTTTCAATGG + Intergenic
1062916162 10:1242404-1242426 CTCAAAACGCAGTGTTTCCAAGG - Intronic
1064535540 10:16353950-16353972 CTAAATCACTAGTAATTCCAAGG + Intergenic
1068445710 10:57119801-57119823 CTCACACACTTCTGTTGCCATGG + Intergenic
1071587692 10:86841219-86841241 CTCAAAAAATAGTCTTTCTAGGG + Intronic
1074126939 10:110536094-110536116 CTGCAACACTGGTGTCTCCAGGG - Intergenic
1078671079 11:13366118-13366140 CTCACACACTGGTATTTGCATGG + Intronic
1078887358 11:15517163-15517185 CTCCAATTCTTGTGTTTCCAAGG + Intergenic
1079280767 11:19085085-19085107 TTCAAACTCCTGTGTTTCCAAGG + Intergenic
1082072690 11:47951647-47951669 CTCAAACAAGAGTGTTGCAATGG - Intergenic
1084469239 11:69345942-69345964 CTCAAACTGTAGTGTCTCCGTGG - Intronic
1087693560 11:101349865-101349887 CTTTAAAACTACTGTTTCCAGGG + Intergenic
1088188736 11:107203917-107203939 CTCAAACACCTGTGTGTGCAAGG - Intergenic
1092643835 12:10547631-10547653 CTCAAATAGAGGTGTTTCCAGGG - Intergenic
1093509116 12:19904754-19904776 CTCAATCTCTACTTTTTCCAGGG - Intergenic
1095921190 12:47532855-47532877 CTCATACACCAGTCTTCCCAGGG + Intergenic
1096751216 12:53760068-53760090 TTCAAACAGTAGGGCTTCCAAGG - Intergenic
1097424018 12:59419447-59419469 CTTAAAAACTAGTGTTTACTTGG + Intergenic
1098035837 12:66301495-66301517 ACAAAACACCAGTGTTTCCAAGG - Intergenic
1099588490 12:84553822-84553844 CTCAAATACAAGTATTTGCATGG + Intergenic
1100714054 12:97287608-97287630 TTCAACAACTATTGTTTCCATGG - Intergenic
1101829077 12:108243087-108243109 CTCAAACTCAAGTGTCTCCAGGG - Intronic
1103092781 12:118109266-118109288 CTCAAACACTTCTCTGTCCAGGG + Intronic
1106665658 13:31847569-31847591 CCCAAACACTAGTGTGTTCAAGG + Intergenic
1107919811 13:45193890-45193912 CTCAAACTTAAGAGTTTCCAAGG + Exonic
1108642796 13:52397986-52398008 CTCAAACTTTAGTGTTCCCTGGG + Exonic
1110233352 13:73190389-73190411 AACAAACACTAGTATTACCAAGG + Intergenic
1110548845 13:76789502-76789524 ATCAAACACTAGAATTTCTAAGG + Intergenic
1114622153 14:24102717-24102739 TACAAACACTATTATTTCCAAGG - Intronic
1116298469 14:43143384-43143406 TTAAATCACTATTGTTTCCACGG + Intergenic
1116762360 14:49030319-49030341 ATCAGACACTAGTTCTTCCAGGG + Intergenic
1125386853 15:39146929-39146951 GTTATACACTAGTATTTCCATGG + Intergenic
1126384761 15:48082853-48082875 CTCAAACAAAGGTGTCTCCAAGG - Intergenic
1129290597 15:74564108-74564130 TTATAACTCTAGTGTTTCCAAGG + Intronic
1129866278 15:78911147-78911169 CTCAAACACTGGTGTTTTCTTGG - Intergenic
1130399751 15:83539008-83539030 CAACAACACAAGTGTTTCCAAGG - Intronic
1134012158 16:10862528-10862550 CTGAAATACTACAGTTTCCAGGG - Intergenic
1134389645 16:13807716-13807738 CGCAAACACTAGTCCATCCAAGG + Intergenic
1136616244 16:31400280-31400302 CTCAACCACTGGTGCTTCAAGGG - Intronic
1137679689 16:50329615-50329637 CAAATACACTAGTGTTTTCAGGG - Intronic
1139642437 16:68302214-68302236 CCCAAAGACCAGTGTTTCCCAGG - Intronic
1141714903 16:85721254-85721276 GTCACACACGAGTGTTTCCGTGG - Intronic
1143421476 17:6796510-6796532 CTCAGACACTAGTGTTGCAAAGG - Intronic
1144962426 17:19052524-19052546 CTCACACACTATTTCTTCCAAGG + Intergenic
1144972735 17:19121996-19122018 CTCACACACTATTTCTTCCAAGG - Intergenic
1146686695 17:34845926-34845948 CCCAAACCCTAGTGCCTCCAGGG + Intergenic
1147528578 17:41251496-41251518 ATGAAAAACTTGTGTTTCCAGGG + Intronic
1149322574 17:55496578-55496600 CTCAATCACTAGTGTCTTCAGGG + Intergenic
1149335282 17:55629281-55629303 ATCAAACAATAGTGCTTCTAAGG + Intergenic
1154053333 18:10984614-10984636 CTTAAACACCAGTGTTTATATGG - Intronic
1155383519 18:25250747-25250769 CTCAAACACAATAATTTCCATGG + Intronic
1156076593 18:33286341-33286363 ATGAAACACTACTGTTTTCATGG + Intronic
1161010572 19:1957751-1957773 CACACACCCCAGTGTTTCCAGGG - Intronic
1161791652 19:6363567-6363589 CACAAACACAAATGCTTCCAGGG - Intronic
1164879709 19:31721619-31721641 CTCAGACATTGGTGGTTCCAAGG + Intergenic
1165326360 19:35116614-35116636 CTGAAAGACTAGTGTCTGCATGG + Intronic
1165666291 19:37631397-37631419 ATCAAGCACTAGTGTTTCCTGGG + Exonic
925529762 2:4846158-4846180 CTGAAACTCTAGTCTTTGCAGGG + Intergenic
925842170 2:8002642-8002664 CTCAAACACTTTTGTTTGCTGGG + Intergenic
926336965 2:11870985-11871007 CTCAAAAACTAGTGTTTGATGGG + Intergenic
927482534 2:23465625-23465647 CTCATACCCTAGTGCTTCCTTGG + Intronic
928256459 2:29727150-29727172 CTCAGCCACGACTGTTTCCATGG + Intronic
928739351 2:34331810-34331832 TGCAAACACTAATGTTTTCAAGG + Intergenic
933001763 2:76933818-76933840 CTCTAAAGCTGGTGTTTCCAGGG - Intronic
933271766 2:80240387-80240409 CTCAATCTTTAATGTTTCCACGG + Intronic
937042089 2:118830458-118830480 CTCAATGACTAGGGTTCCCAAGG + Intergenic
937583333 2:123515715-123515737 CTCAAATAAAAGTGTTGCCAGGG - Intergenic
939277251 2:140014196-140014218 CCTTAACATTAGTGTTTCCAAGG - Intergenic
939313455 2:140515309-140515331 AACAAACCCAAGTGTTTCCAAGG - Intronic
940491851 2:154371800-154371822 CTCCAAGACTAATGTTTCTATGG - Intronic
941802310 2:169673353-169673375 CTCAAACACAAGTGATTCACTGG + Intronic
943737051 2:191367480-191367502 CTCAAACTCAAATGTTTCCAGGG - Intronic
945505418 2:210634508-210634530 CACAAACTTTGGTGTTTCCAAGG + Intronic
946094593 2:217262329-217262351 CTCAAACACTCAAGTTCCCATGG - Intergenic
948719181 2:239886702-239886724 TTAAAACAATAGTGTTTCTAGGG + Intergenic
1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG + Intronic
1173373704 20:42462954-42462976 CTCAAACTCTTCTATTTCCAAGG + Intronic
1174211715 20:48884680-48884702 ATTAAACACTTGTGTTTCAAAGG + Intergenic
1176256821 20:64157283-64157305 CTCAAACCCTAATGCATCCACGG + Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178230766 21:30781717-30781739 CTCAATTAATAGAGTTTCCACGG + Intergenic
1179679188 21:43005912-43005934 TTCATACCCGAGTGTTTCCAAGG + Intronic
1182588595 22:31361855-31361877 CTCAAACTCAGGTGTTTCTAAGG + Intergenic
949176022 3:1063459-1063481 CTCCAACCCTTGTGTTTCCCAGG + Intergenic
951666041 3:25124590-25124612 CTGAAATACTGCTGTTTCCAAGG - Intergenic
952538333 3:34337812-34337834 ATGAAACATTAGTGTTTTCAGGG + Intergenic
952872197 3:37910914-37910936 CCCAAGCTCTAGTGGTTCCAAGG + Intronic
953061630 3:39432983-39433005 CTCCAGCCCTACTGTTTCCAGGG + Intergenic
956816330 3:72911603-72911625 CTCACACACAAGTGTTGGCAAGG - Intronic
957885726 3:86284697-86284719 CTCAATTTCTAGTGTTTTCATGG + Intergenic
957981376 3:87515752-87515774 CACAAACACTACTATTTCCCAGG + Intergenic
959180542 3:102974314-102974336 CTAAAATTTTAGTGTTTCCAGGG + Intergenic
960807787 3:121600624-121600646 ATCAAACACCTGTGTCTCCATGG + Intronic
963279363 3:143366991-143367013 CTAAAACACTAAAGTTTCTATGG - Intronic
963609749 3:147452410-147452432 CTCAACCACCTGTGTCTCCAGGG - Intronic
963745281 3:149118982-149119004 CACAAACACTACTATTTCCAGGG + Intergenic
964205992 3:154176034-154176056 CTCAAACAGTATTGTTACCGTGG + Intronic
964852870 3:161113761-161113783 TTCAAAAATTAGTGTTACCATGG - Intronic
965389000 3:168081558-168081580 CTCACACAATCCTGTTTCCAAGG - Intronic
965441444 3:168720220-168720242 CTCTAAAACTAGTTTTGCCAAGG + Intergenic
974123488 4:57667368-57667390 CTTAAACATTATGGTTTCCAAGG - Intergenic
976780273 4:88750695-88750717 TTAAAACACAAGTGTTTCCCAGG + Intronic
978060502 4:104331193-104331215 TTCAAACATTAGAGTGTCCAGGG + Intergenic
978713372 4:111812221-111812243 CTCAGAAACTAGTTTTTCAATGG + Intergenic
980437516 4:132797777-132797799 TTAAAACACTAGAGTTTACATGG - Intergenic
981015510 4:139969847-139969869 CTCACAAAAAAGTGTTTCCAAGG + Intronic
982846963 4:160266006-160266028 CTCAAAAACTAGTGTTTTGAAGG + Intergenic
983064923 4:163197487-163197509 ATCCAGAACTAGTGTTTCCAAGG - Intergenic
985106682 4:186506490-186506512 CTGAAATACTAGCTTTTCCATGG - Intronic
986153848 5:5154010-5154032 CTCAATGACTAGAATTTCCAGGG - Intronic
988296176 5:29365594-29365616 ATAAAACAGTAGTGTTACCAGGG - Intergenic
989147219 5:38260802-38260824 ATCAAAAACTAGTCTTTCCAAGG - Intronic
989252189 5:39330305-39330327 CTGAAACACATGTGTTTCCAGGG + Intronic
991055496 5:62315385-62315407 GTCACACATTAGTGATTCCAGGG + Intronic
994119121 5:96093916-96093938 CTCAAACTCTAATCTTTGCAGGG - Intergenic
994312259 5:98287269-98287291 CTCCAACACTAGTGTCTCTAGGG + Intergenic
997373572 5:133381060-133381082 CTCACACACTGTTGTTTCCAAGG + Intronic
1001545242 5:172567049-172567071 CTCCTGCAATAGTGTTTCCATGG + Intergenic
1001584719 5:172826116-172826138 CTCAAACACAAGGGCTTACAGGG - Intergenic
1002347782 5:178560007-178560029 CTCTAACACTGGTGTTTTCAGGG - Intronic
1003037593 6:2658610-2658632 GTCAAACAATAGGGCTTCCAAGG + Intergenic
1003407715 6:5837484-5837506 CTCTAGCTCTAGAGTTTCCAAGG - Intergenic
1003611967 6:7621932-7621954 CTCAAACACTGGTCCATCCATGG - Intergenic
1007534138 6:42569587-42569609 CTTAAACACTATTGTTTTTATGG + Intronic
1009466514 6:63977395-63977417 ATCAAACACTAGAGCTTACATGG + Intronic
1016692068 6:146949530-146949552 CAGAAACACTAGTGGTGCCAAGG - Intergenic
1017263361 6:152413912-152413934 CTTAAACACTATTATTTACATGG - Intronic
1020437646 7:8182918-8182940 CTCCATCACTAGTGTCTGCAGGG + Intronic
1022049146 7:26648164-26648186 CTCAAAGACCAGTGTTTTTAGGG + Intergenic
1026322733 7:69281820-69281842 AGCAAACACTGGTTTTTCCAGGG - Intergenic
1030165559 7:106551703-106551725 CACAAACACTGGTCTTTGCAAGG + Intergenic
1031793426 7:126139542-126139564 CTCAAACACTAGTTCTCCAATGG + Intergenic
1034074841 7:148221762-148221784 ATCAGACACTTGTGTTCCCAAGG + Intronic
1034513576 7:151555453-151555475 CACAACCACTATTGTTTCTATGG + Intergenic
1036721460 8:11179558-11179580 CTGAAACTCTAGTGTTTTGAGGG - Intronic
1037748972 8:21667666-21667688 CTCCAACATTATTGTTGCCATGG + Intergenic
1038064822 8:23952608-23952630 CTCAAACACTAGACTTTCAGAGG - Intergenic
1038537295 8:28362463-28362485 ATAAAACACCAGGGTTTCCAGGG + Intronic
1039626221 8:39057604-39057626 CTGAAACACTAGCTCTTCCATGG - Intronic
1040283038 8:46077772-46077794 CTACAAAACTAGTGCTTCCAAGG - Intergenic
1042336761 8:67638156-67638178 CTCAAACTCTAGGGCATCCAAGG - Intronic
1047544949 8:125806733-125806755 CTCTAACACAGGTATTTCCAAGG - Intergenic
1047774438 8:128057906-128057928 TCCAAACACTAGTCTTACCATGG + Intergenic
1048533409 8:135271265-135271287 ATCACACACTAGTGATACCAAGG + Intergenic
1051145861 9:14026715-14026737 CTCAAATACTAGTTGTGCCATGG + Intergenic
1052395708 9:27935542-27935564 CTCAAACATTACTCTTTCAAAGG - Intergenic
1055163728 9:73164892-73164914 TTCAGACTCTAGTGTTTACAAGG + Intronic
1055354324 9:75422003-75422025 CTCAAATACTAGAGTTTAAAAGG - Intergenic
1056398818 9:86207267-86207289 TTCAAACATTAGTTTTCCCATGG + Intergenic
1057709812 9:97429405-97429427 CTCATACACTATGGTTTCCTGGG + Intronic
1057958990 9:99436941-99436963 CTCAAACAATAATGATTCCTCGG - Intergenic
1060509338 9:124220781-124220803 CTCAAACCCTGGTGACTCCAGGG - Intergenic
1062569971 9:137180526-137180548 CCCAGACACTCGTCTTTCCAGGG - Exonic
1186124170 X:6394929-6394951 CTGAAACTCTAGTGTGGCCAGGG + Intergenic
1186438453 X:9564380-9564402 CTCAAACAAAGGTGTTTTCAGGG + Intronic
1187723161 X:22172998-22173020 CACACACACTAGTGTTTCACTGG - Intronic
1187821389 X:23291858-23291880 TTCTAATAATAGTGTTTCCAGGG - Intergenic
1197020482 X:121681858-121681880 CTGAAATAAAAGTGTTTCCAGGG + Intergenic
1198115891 X:133544427-133544449 TTCTAACACAAATGTTTCCAGGG + Intronic
1198494070 X:137173070-137173092 CTCAAGAACAAGAGTTTCCAAGG - Intergenic
1199383747 X:147200477-147200499 CCCAAACCCTTGTGTTTCCCGGG - Intergenic