ID: 1172333051

View in Genome Browser
Species Human (GRCh38)
Location 20:34089327-34089349
Sequence TCAGTTTCTCAGTCAGAGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172333047_1172333051 1 Left 1172333047 20:34089303-34089325 CCCAGATGAAGCGCCTGCCATTG 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1172333051 20:34089327-34089349 TCAGTTTCTCAGTCAGAGCCCGG 0: 1
1: 0
2: 1
3: 20
4: 184
1172333048_1172333051 0 Left 1172333048 20:34089304-34089326 CCAGATGAAGCGCCTGCCATTGT 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1172333051 20:34089327-34089349 TCAGTTTCTCAGTCAGAGCCCGG 0: 1
1: 0
2: 1
3: 20
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172333051 Original CRISPR TCAGTTTCTCAGTCAGAGCC CGG Exonic
900591842 1:3463615-3463637 TGGGTTCCTCAGCCAGAGCCTGG - Exonic
901182798 1:7352994-7353016 TGAGTGTCTCATGCAGAGCCTGG - Intronic
901530797 1:9851308-9851330 TATCTGTCTCAGTCAGAGCCAGG - Intronic
901614119 1:10524394-10524416 TCTGTTTCTCAGACAGAGCTGGG + Intronic
903187848 1:21639355-21639377 TCACCTTCTCAGTGACAGCCTGG + Intronic
903887031 1:26546570-26546592 TCTGGGTCTCAGCCAGAGCCTGG + Intronic
904710517 1:32426651-32426673 TCAGCTTGTCATTCAGATCCTGG + Intergenic
904936763 1:34136114-34136136 TGAGTTTCTCAGGCAGGGCCTGG - Intronic
905804501 1:40866010-40866032 TCAGTTTCTGAATCAGAAACTGG + Intergenic
907618186 1:55946589-55946611 CCAGTGTCTAAGTCAGAGCCTGG + Intergenic
908450366 1:64248287-64248309 TCAGGTTCTCTGTCTGAGCAGGG + Intronic
920180871 1:204131116-204131138 TCACTTTCTGGGCCAGAGCCAGG + Exonic
920875765 1:209833915-209833937 CCAGTTTCTCAGCCAGTGTCTGG + Intronic
922757451 1:228104392-228104414 TCTGTTTCTCAGTCAGCACTGGG - Intronic
923681904 1:236125154-236125176 TCAGGTTCTCACCAAGAGCCTGG + Intergenic
1063288023 10:4711814-4711836 TCAATTTCTCAATCAGATCAAGG - Intergenic
1069663508 10:70139485-70139507 TCTGCCTCTCAGTCAGAGTCAGG - Exonic
1069780420 10:70951946-70951968 TCAGTTTGTCAGACACAGTCAGG - Intergenic
1070904193 10:80057273-80057295 TCACTTTATCATTCAGAACCTGG - Intergenic
1072384996 10:94915548-94915570 TCAGTTTCTTCATTAGAGCCAGG + Intergenic
1072704954 10:97674462-97674484 TCTGTTTCTCAAGCAGAGGCAGG + Exonic
1073933477 10:108602178-108602200 TCAGATTCTTAGTCAGTGGCTGG + Intergenic
1074737146 10:116447166-116447188 TCAGTCTCTCAGGCAGCCCCTGG - Intronic
1076540241 10:131209307-131209329 TCGGCTTCTTTGTCAGAGCCAGG - Intronic
1077167700 11:1151244-1151266 TCAGTTTCCCAGTCCCACCCAGG + Intergenic
1078490571 11:11764212-11764234 TAAGCTTCACACTCAGAGCCTGG + Intergenic
1079154777 11:17935735-17935757 TCAGTTCTTCAGTCACTGCCTGG - Intronic
1079361343 11:19772931-19772953 TTAGTTTATCAGACAGAGGCTGG + Intronic
1083250999 11:61467140-61467162 TCAGTTTCTCAGTTAAAGTGGGG - Intronic
1083555170 11:63620423-63620445 GCAGTTTCTCAGTAAGTCCCGGG - Intergenic
1085464782 11:76716214-76716236 TCAGTTTCTCAGTCTGTAACAGG + Intergenic
1089163071 11:116454446-116454468 TCACTTTCTCTGCCAAAGCCTGG - Intergenic
1089655412 11:119943630-119943652 TCAGTTTCTCTGTCTGGGCAAGG + Intergenic
1089661013 11:119985263-119985285 TCAGTTTCCCACTCAGAGCCAGG - Intergenic
1089682697 11:120128222-120128244 TCCCCTTCTCAGTCTGAGCCAGG - Intronic
1090810643 11:130238635-130238657 TCAGTTTAAAAATCAGAGCCTGG - Intronic
1090896739 11:130984080-130984102 TCACTTTCACAGTCTGTGCCTGG + Intergenic
1092971527 12:13700208-13700230 TCAGTTTCTCTTTCAAATCCTGG - Intronic
1106883024 13:34152468-34152490 TCAGAGTCTGTGTCAGAGCCTGG - Intergenic
1106956969 13:34950128-34950150 TCAGTTTCTCTGTCTGGTCCAGG - Intronic
1113481831 13:110626857-110626879 GCAGTTTCTCATTCAGAACAGGG - Intronic
1113904737 13:113813934-113813956 TCAGCTTCTTACTCGGAGCCAGG - Exonic
1115534035 14:34355832-34355854 GCTGTTTCTCAGCCACAGCCTGG + Intronic
1116806540 14:49499471-49499493 TCAGTGTCTGAATCAGTGCCTGG - Intergenic
1118240764 14:64056129-64056151 CCAGTTTCTCAGTGAGGTCCTGG - Exonic
1118775866 14:68973708-68973730 TCCTTGTCTCAGTCAGAGCCAGG + Intronic
1119435381 14:74594878-74594900 TCGGGTCCTCAGTCAGGGCCTGG - Intronic
1119715390 14:76855324-76855346 TCAGTTTCTCAGACTGTCCCTGG - Intronic
1120954432 14:90068921-90068943 TCATCTTCTCAGCCTGAGCCCGG - Intronic
1121538381 14:94706935-94706957 TCAGTTTCCCAGTCTGAAACAGG + Intergenic
1125089563 15:35774637-35774659 GCAATTTCTCAGTCAGACACGGG + Intergenic
1126508741 15:49440715-49440737 TCAGTTTGACAGTCAGAGACTGG + Intronic
1127487836 15:59436050-59436072 TGAATTTCTCAGTAAGAACCGGG - Intronic
1128082389 15:64864444-64864466 CCAGTTGGTCAGTCAGAGACAGG - Intronic
1131320437 15:91384705-91384727 TCACTTTCTCAGTCACAAACTGG - Intergenic
1131797723 15:96036786-96036808 TTAGCTTGTCAGTCAGGGCCTGG + Intergenic
1133485243 16:6213784-6213806 TCAGTCTCTCACTCTAAGCCAGG + Intronic
1135586829 16:23678273-23678295 TCAGTTTCTTGGTCAGAGGGAGG - Intronic
1136243613 16:28959991-28960013 TCAGATTCTCAGACGGAACCAGG - Intronic
1143008566 17:3853090-3853112 TTAGTGTCTAACTCAGAGCCTGG + Intergenic
1143540222 17:7563988-7564010 GCAGTTTCCCAGGCAGAGCTAGG + Intronic
1144041839 17:11418936-11418958 TTAGTTTCTCAGTTAGCGCCAGG - Intronic
1145115337 17:20204790-20204812 TCAGTTTCTCCTTCAGGACCCGG - Exonic
1146548642 17:33761439-33761461 CCTGGTGCTCAGTCAGAGCCTGG - Intronic
1146812829 17:35917595-35917617 TCAGCTTATCATTCAGATCCTGG + Intergenic
1146977981 17:37132034-37132056 TCAGTGTATCAGTCAGAGAGAGG - Intronic
1149361650 17:55901693-55901715 TCTGTTTCCCAGCCAGAGTCAGG + Intergenic
1152072676 17:78141728-78141750 TCAGCCCCTCAGTCAGGGCCAGG - Exonic
1153882622 18:9434330-9434352 TGAGTTGCTCAGACAGAGGCAGG + Intergenic
1155069854 18:22305419-22305441 TCATTTGCTCTGACAGAGCCAGG + Intergenic
1155787821 18:29923865-29923887 TCAGTTACTGAGTAGGAGCCAGG - Intergenic
1156231009 18:35153901-35153923 TCAGCTTCCCATCCAGAGCCTGG - Intergenic
1156795630 18:41042621-41042643 TCAATTTATCATTCAGAGTCAGG + Intergenic
1156928002 18:42606349-42606371 TTAGTTTCTCAGGCATAGCCAGG + Intergenic
1157305925 18:46517623-46517645 TCAGTGCCTGAGTCAGTGCCTGG + Intronic
1157477383 18:48031964-48031986 TCAGTGTTTCCATCAGAGCCTGG - Intronic
1157571280 18:48713955-48713977 TCCGTTACTCACTCACAGCCTGG + Intronic
1162765861 19:12919056-12919078 TCAGTGCGTCAGTCAGGGCCGGG + Intronic
1163589876 19:18186863-18186885 TCTGTTTTTGAGACAGAGCCTGG + Intergenic
1163769162 19:19180312-19180334 ACAGTCTCTCAGGCAGAGCCCGG - Intronic
1164722167 19:30440294-30440316 TCAGCTTCTCAGTGGTAGCCAGG + Intronic
1165229045 19:34374978-34375000 TCAGTTTCCCAGTAAGTGCTGGG + Intronic
1167104391 19:47421599-47421621 ACAGATTCTCAGAGAGAGCCTGG - Intergenic
1167747045 19:51358013-51358035 TCAGTACATCAGCCAGAGCCGGG + Intronic
925389835 2:3487158-3487180 GCAGTTTCCCATTCACAGCCTGG - Intergenic
926212964 2:10884890-10884912 TCTGTATCTCAGTCTGATCCTGG + Intergenic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
930421735 2:51162434-51162456 TCAGTTTTTAAGACAGAGCAAGG - Intergenic
933274830 2:80272517-80272539 TCAGATTAGCAGTCAGACCCAGG + Intronic
933565403 2:83944334-83944356 ATAGTATCTCAGTAAGAGCCTGG + Intergenic
936658786 2:114518893-114518915 TCAGTTTATTACTCAGAGGCTGG + Intronic
937872771 2:126797899-126797921 TCAGGTTCTGGGACAGAGCCTGG + Intergenic
937965451 2:127504950-127504972 TCAGTTTCTGAGTCACTGGCAGG + Exonic
939792665 2:146599117-146599139 TCTGTTTCTTGGTCAGAACCTGG - Intergenic
939887362 2:147695558-147695580 TCAGTTTCTCACTGAGACGCAGG + Intergenic
941021459 2:160411181-160411203 TCATTTTTTCAGTCCCAGCCAGG - Intronic
944726424 2:202475733-202475755 TGAGTTTATCAGTAAAAGCCAGG - Intronic
945332201 2:208552717-208552739 TCAGTTCCTCAGACAGCTCCTGG + Intronic
947581650 2:231323345-231323367 CCACTTTCTCAATCAGTGCCAGG - Intronic
1169097371 20:2914560-2914582 CCAGTTTCTCTGTCAGAGAAGGG - Intronic
1169482740 20:6000104-6000126 TCAGTTACTCAGGCTGAGACAGG - Intergenic
1170989145 20:21286213-21286235 GCAGTTTCTCTTTCAGTGCCTGG - Intergenic
1171817774 20:29803641-29803663 TCACTTCCTCTGTGAGAGCCAGG + Intergenic
1172333051 20:34089327-34089349 TCAGTTTCTCAGTCAGAGCCCGG + Exonic
1173452269 20:43175540-43175562 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452278 20:43175590-43175612 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452285 20:43175640-43175662 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452294 20:43175690-43175712 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1177201961 21:17967469-17967491 TCAGTTTCTCCCTAAGAGCTTGG + Intronic
1178186938 21:30233184-30233206 TCAGGTTCTCAGTCACTGCATGG + Intergenic
1180098646 21:45574135-45574157 TCAGTTTCTCAGCCTCTGCCGGG + Intergenic
1180839060 22:18950290-18950312 CCAGTGGCACAGTCAGAGCCGGG + Intergenic
1180977132 22:19854648-19854670 TCAGTTTCTCGGTCCGCGCCGGG - Exonic
1181426883 22:22849388-22849410 TTAGTTTCTCAGTCAGGTCTGGG + Intronic
1184679181 22:46061349-46061371 TCAGTTTCCCCGGCAGAGCGGGG + Intronic
1185035050 22:48470351-48470373 TGAATTTCTCAGTCAGGCCCAGG - Intergenic
952535577 3:34305592-34305614 GGAGTTTGTCAGACAGAGCCAGG - Intergenic
953351059 3:42216344-42216366 CCAGTTTTTCAGTCAGTCCCAGG + Intronic
953773135 3:45794022-45794044 TCAGTTTCTCTGTCTCCGCCCGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
956007845 3:64799513-64799535 TCAGCTTCTCACTCAGCGCATGG - Intergenic
958113316 3:89179904-89179926 TCAGTGTCTCACTGAGAGCAGGG + Intronic
959437072 3:106328899-106328921 TTAATTTCCCAGTCAGAGCCAGG + Intergenic
959628414 3:108480376-108480398 TCAGTTTCTCACTCACTCCCTGG - Intronic
960619659 3:119625972-119625994 TCACTGTCTCAGTGAGAGTCCGG + Intronic
960712743 3:120547141-120547163 TCACTTTCTCTCTCAGAGCTGGG + Intergenic
961537352 3:127578095-127578117 CCAGTTTCTCAGTCAAAAACTGG + Intronic
962261508 3:133911850-133911872 TCAGTTTCTCACTCAGATGAGGG - Intergenic
962410384 3:135136257-135136279 ACAGTTTTTCACTCAGAGACAGG + Intronic
962817632 3:139016768-139016790 TCAGCTACTCAGTCAGAGATTGG - Intronic
963734264 3:149002349-149002371 TCAGTTTCTCAGTCTAAGGCAGG - Intronic
965603992 3:170481810-170481832 TCACTTTTTCACGCAGAGCCTGG - Intronic
967344122 3:188434751-188434773 TCCTTTTCTCACTCTGAGCCTGG + Intronic
967893442 3:194379416-194379438 TCATTTTCTCATTCAAAGCTCGG + Intergenic
969365001 4:6689277-6689299 TCAGTTTCTCAGGGACAGGCTGG - Intergenic
970366250 4:15361379-15361401 TCAGTTTTTCATTCTGAGCCTGG - Intronic
971172295 4:24246294-24246316 GCTGTTTCTCATTCAGATCCTGG + Intergenic
971462396 4:26914926-26914948 TCAGCTTCTCAGCCAGGTCCTGG + Intronic
975091201 4:70406277-70406299 TTAGTATCTTAGTCAGTGCCTGG - Intronic
976692928 4:87888154-87888176 TAAGTTTCTCAGCCAGTACCTGG + Intergenic
981356342 4:143793417-143793439 AGGGTTTCTCAGTCAGTGCCAGG + Intergenic
981377666 4:144034323-144034345 AGGGTTTCTCAGTCAGTGCCAGG + Intergenic
981533497 4:145775674-145775696 CCCTTTTCTCAGTCATAGCCTGG - Intronic
983914327 4:173275348-173275370 TCAGTTCCCCACTCAGAGCTCGG - Intronic
984518410 4:180770554-180770576 TTGGTGTCTCACTCAGAGCCTGG - Intergenic
984815717 4:183834192-183834214 TTTGTTTCTCTGTCACAGCCTGG + Intergenic
985355121 4:189110173-189110195 TTAGTTTCTGAGTCACAGCAAGG - Intergenic
990894358 5:60681903-60681925 TAAATTTCTCATTCAGAGCTGGG - Intronic
992491433 5:77248121-77248143 TCTGTTTCAGAGTCAGAGCTGGG - Intronic
994316028 5:98334323-98334345 TGACTTTCTCAGTAAGGGCCAGG - Intergenic
994610889 5:102037854-102037876 TCATTTTTTCAGTCAGTGTCTGG + Intergenic
997893231 5:137693736-137693758 TCAGTCACTCTCTCAGAGCCAGG - Intronic
998087455 5:139338158-139338180 TCACCTTCTCATTCAGAGCAGGG + Intergenic
1001091893 5:168747929-168747951 GCAGTCTCTCAGTCTGATCCCGG - Intronic
1002436791 5:179236389-179236411 TTAGTGCCTCAGTCAGGGCCTGG - Intronic
1002766986 6:249730-249752 AAAGTTTGTCAGTCAGTGCCTGG + Intergenic
1002944010 6:1743578-1743600 TCACTTTCTCAGTAGGAGCCAGG + Intronic
1004721179 6:18268543-18268565 TAAGTTTCTCAGTAAAATCCGGG + Intergenic
1005664171 6:28033960-28033982 TGGGTTTCTCAGGCAGACCCAGG + Intergenic
1006013417 6:31061431-31061453 TCAGTCTCTCAGTCAGCTGCGGG + Intergenic
1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG + Intergenic
1007391877 6:41554038-41554060 ACAGTTCCTCAGTCAGGGCCTGG - Intronic
1010539428 6:77072815-77072837 CCAGTTTCTGATTCAGAGACTGG - Intergenic
1011890604 6:92154520-92154542 TCAGTTTCCTAGTAAAAGCCTGG - Intergenic
1012299730 6:97571052-97571074 TCAGTTTGTCTGTCAGACCCTGG + Intergenic
1012772065 6:103450847-103450869 TCAGTTTCTAGATCAGTGCCTGG + Intergenic
1012989660 6:105912030-105912052 TCAGTTTCTCAAGCAGACCCAGG + Intergenic
1014944514 6:127481039-127481061 TCAGTTTCTCAGTGAGGTCAGGG - Intronic
1015023044 6:128500123-128500145 TCAGTTTCTGATGCAGAGGCAGG + Intronic
1015226273 6:130860827-130860849 TCAATTTGGCAGTAAGAGCCGGG - Intronic
1018869091 6:167767944-167767966 TCAGTTCCTCATTCAGAATCAGG + Intergenic
1018908768 6:168090015-168090037 TCAGTCTCTCAGTCTCAGCTTGG + Intergenic
1019363143 7:616229-616251 TCGTTTTGTCAGTGAGAGCCAGG - Intronic
1023185575 7:37529744-37529766 TCAGTGACACAGGCAGAGCCAGG + Intergenic
1024249510 7:47495655-47495677 GCAGTCTCCCAGCCAGAGCCAGG + Intronic
1026249675 7:68658759-68658781 TAAATTTCTCAGTCAGGGCAGGG + Intergenic
1029628659 7:101736449-101736471 TCAGTTTCTCAGCCAGAAGGTGG - Intergenic
1029629790 7:101743240-101743262 TCAGTTTCTCAGTCTGTCCGAGG - Intergenic
1034880397 7:154758223-154758245 TCGGTGTGTCAGTCAGGGCCGGG + Intronic
1035105001 7:156434879-156434901 TCAGTGTCTCAGAAAGAGCCAGG + Intergenic
1035363573 7:158329865-158329887 GCATTTTCTCAGTCAGACGCTGG - Intronic
1036464855 8:8987377-8987399 ACAGTCTCTAAGTCACAGCCTGG + Intergenic
1037291068 8:17349867-17349889 GAAGTTGCTCAGTCAGAGCCAGG - Intronic
1037723113 8:21461332-21461354 TCAGTTTCTAACTCTGAGCCAGG - Intergenic
1038850867 8:31275016-31275038 TCAATTTCTCAGTCAGATGCTGG + Intergenic
1039562236 8:38521944-38521966 TCTGATTCTAAGTCAGAGTCAGG - Intronic
1042620789 8:70701451-70701473 TCTGTTTCTCTCTTAGAGCCAGG + Intronic
1046039082 8:108880392-108880414 TCAGTTGCTATGTCAGAGACTGG + Intergenic
1046217347 8:111165311-111165333 TCATGTTCTCAGTGAGACCCTGG - Intergenic
1049488745 8:142879905-142879927 TCGGTCTCTCAGGCAGATCCAGG - Intronic
1051880046 9:21830692-21830714 TAAGTGACTCAGTGAGAGCCAGG - Intronic
1053108879 9:35439336-35439358 CCAGTTTCTCTTTCAAAGCCAGG - Intergenic
1053456241 9:38235040-38235062 TCTATGTCTCAGTTAGAGCCTGG - Intergenic
1053867243 9:42452844-42452866 TCAGTTTCTGAGTGTCAGCCAGG + Intergenic
1054971423 9:71092111-71092133 TAAGTATCTCTGTCAGAGGCTGG - Intronic
1056004111 9:82248984-82249006 TAAGAATCTCAGTCAGGGCCGGG + Intergenic
1061003011 9:127913129-127913151 CCAGTTTCTAAGTAAGAGCAGGG + Intronic
1189155168 X:38749692-38749714 CCAATTCCTCAGTCAGAGCTTGG + Intergenic
1190503593 X:51103188-51103210 CCTGATTCTCAGTCAGAGGCTGG + Intergenic
1190937934 X:55013417-55013439 TCAGCTTCTCTTTCAGATCCTGG + Intronic
1194362221 X:92965993-92966015 TCAGTTTCTGAGTCAAACACTGG + Intergenic
1196811667 X:119633876-119633898 TCAGTTTCAGAGCCAGGGCCTGG - Intronic
1198059234 X:133027434-133027456 CCATTTTCTCAGTGAGAGCTTGG + Exonic
1198936273 X:141904578-141904600 ACATTTTCTCAGACAGGGCCAGG - Intronic
1199967472 X:152831876-152831898 TAAGTTTCTCAGACAGAGAAAGG + Intronic
1200147182 X:153932386-153932408 TCAGTTTCTGAGCCAGACCGAGG + Exonic