ID: 1172335240

View in Genome Browser
Species Human (GRCh38)
Location 20:34110654-34110676
Sequence CCTCCAAGTCACTACGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172335234_1172335240 -5 Left 1172335234 20:34110636-34110658 CCCACTGATCCCTCTAGCCCTCC 0: 1
1: 0
2: 1
3: 15
4: 263
Right 1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG 0: 1
1: 0
2: 0
3: 9
4: 98
1172335232_1172335240 16 Left 1172335232 20:34110615-34110637 CCACTTCTTTCAAAGCCTAATCC 0: 1
1: 0
2: 2
3: 24
4: 241
Right 1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG 0: 1
1: 0
2: 0
3: 9
4: 98
1172335235_1172335240 -6 Left 1172335235 20:34110637-34110659 CCACTGATCCCTCTAGCCCTCCA 0: 1
1: 0
2: 1
3: 33
4: 368
Right 1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG 0: 1
1: 0
2: 0
3: 9
4: 98
1172335233_1172335240 1 Left 1172335233 20:34110630-34110652 CCTAATCCCACTGATCCCTCTAG 0: 1
1: 0
2: 0
3: 18
4: 146
Right 1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172335240 Original CRISPR CCTCCAAGTCACTACGTTGA TGG Intronic
910436952 1:87215121-87215143 GCCCCAAGTCACTACCTTGCTGG + Intergenic
911760194 1:101605243-101605265 CCTCCAAGTCAAAAGGTTTATGG + Intergenic
917474659 1:175358676-175358698 CCTCCAAGTCTCTAGGCTTAGGG - Intronic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
918875735 1:190040460-190040482 CTCCCAAGTGACTAAGTTGAAGG + Intergenic
918991282 1:191699991-191700013 CCCCCAAATCACTAAGTTGAAGG - Intergenic
919098134 1:193060780-193060802 CCTCCTAGTCTCCAAGTTGAGGG - Intronic
922154471 1:223030265-223030287 CCCCCAAGTCACTAAGCTAAAGG - Intergenic
1066191662 10:33061501-33061523 GCTTAAAGTCACTACGTTGGGGG + Intergenic
1069613379 10:69790342-69790364 CCTCCAAGTCACCACAGTTATGG - Intergenic
1075243833 10:120802312-120802334 CCCCCAAATCACTAAGTTGAAGG - Intergenic
1078507124 11:11960593-11960615 CCTCCCTGACACTCCGTTGAGGG - Intergenic
1078589586 11:12627706-12627728 CCTCCAAGTCATGCCTTTGAAGG + Intergenic
1079198695 11:18355626-18355648 CCTCCAAGTAACTAAGTAGCTGG + Intronic
1081262165 11:40973946-40973968 TCTCTAAGTCACTACCTGGAGGG + Intronic
1084093300 11:66893686-66893708 CCTCCAAGTGCCTGTGTTGATGG - Intronic
1095561391 12:43570174-43570196 ACTCAAAGTCAATACGTTGGAGG - Intergenic
1097252074 12:57640702-57640724 CCCCCAAATCACTAAGTTAAAGG + Intergenic
1098315273 12:69186004-69186026 TCTCCAAATCACTAAGTTAAAGG + Intergenic
1105055442 12:133094690-133094712 CCTGCAGTTCACTACGGTGAAGG - Intronic
1109423149 13:62139378-62139400 CCCCCAAATCACTACGCTAATGG + Intergenic
1110143911 13:72166325-72166347 ACTCCAAGTCAATACATTTATGG - Intergenic
1113417030 13:110136631-110136653 CCCCCAAGTCACTAAGCTAATGG - Intergenic
1115243429 14:31271591-31271613 CCTCAAAATCACTAAGTTAAAGG + Intergenic
1118611592 14:67545188-67545210 CCTCCGAGTCACTAACTTAAAGG - Intronic
1120479293 14:85028697-85028719 CCTCCCAGTGACTACATTTATGG + Intergenic
1132628013 16:901528-901550 CCATCAAGTCACAGCGTTGAAGG - Intronic
1134061802 16:11203783-11203805 CCTCCAAATCACTATTTTAATGG - Intergenic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1136480073 16:30535631-30535653 CCCCCAAATCACTACGCTAAAGG - Intronic
1136546826 16:30959165-30959187 CCTCCCAGTCCCTAAGTTTAAGG + Exonic
1141429301 16:83962904-83962926 CCCCCAAATCACTAAGTTAAAGG - Intronic
1146352527 17:32106907-32106929 CCTAGAAGTCACTACGTTGCTGG - Intergenic
1150757522 17:67928892-67928914 CCTAGAAGTCACTACGTTGCTGG + Intronic
1152819513 17:82429596-82429618 CCTCCAGGTCACTAAGTCCAGGG + Intronic
1153150903 18:2091957-2091979 CCCCCAAATCACTAAGCTGAAGG + Intergenic
1154038238 18:10827994-10828016 CCCCCAGGTCACTAGGTTGATGG + Intronic
1157912932 18:51636344-51636366 CCTCCAACTCACTAAGCTAAAGG + Intergenic
1164983718 19:32632822-32632844 CCTCCAAGTCAAAACTTAGAGGG - Intronic
1165500260 19:36183632-36183654 CCTCCAGGTCACTGCATTTAAGG + Exonic
925164078 2:1704857-1704879 CCCCCAAATCACTAAGTTAAAGG - Intronic
932391034 2:71390842-71390864 CCTCCAAATCACAACGTTAGGGG - Intronic
932619139 2:73255657-73255679 CCTCTAAGGCGCTAAGTTGAAGG - Exonic
934791553 2:97066678-97066700 CCTCAAAGTCACTAAGCTAAAGG - Intergenic
934814885 2:97315865-97315887 CCTCAAAGTCACTAAGCTAAAGG + Intergenic
934822810 2:97392618-97392640 CCTCAAAGTCACTAAGCTAAAGG - Intergenic
936081431 2:109435188-109435210 CCCCCAGGTCAGTATGTTGAAGG + Intronic
936477146 2:112849132-112849154 CCTCCAAATCACTAAGCTAAAGG + Intergenic
938945829 2:136211216-136211238 CCCCCAAGTCAAGATGTTGAGGG - Intergenic
939739300 2:145886120-145886142 CCTCCAAGTCACCAGGTAAAAGG + Intergenic
942315445 2:174693013-174693035 CCCCCCAGTCACCACGTTGCAGG + Intergenic
942867980 2:180699166-180699188 CCCCCAACTCACCACATTGAGGG - Intergenic
944278914 2:197871896-197871918 CCTCCAAGTCCCTTTGTAGAGGG - Intronic
944512182 2:200475643-200475665 CCCCCAAATCACTAAGCTGAAGG - Intronic
945129530 2:206554667-206554689 CCTTCTAGTCTCTAGGTTGAGGG - Intronic
946284692 2:218694137-218694159 CCTCCAAGGCACAAAGTTGATGG - Intronic
1169771884 20:9210060-9210082 GCTTCAAGTCACTACGTTTGTGG + Intronic
1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG + Intronic
1179648975 21:42794402-42794424 CCCCCAAATCACTACGCTAAAGG - Intergenic
1181903443 22:26173962-26173984 CCCCTAAATCAATACGTTGATGG - Intronic
1184917881 22:47585436-47585458 CCCCCAAATCACTAAGCTGATGG + Intergenic
949899398 3:8797352-8797374 TTTCCAAGTCACTTGGTTGATGG - Intronic
955034210 3:55250572-55250594 CCTGCAAGTCACCATGTTGAAGG - Intergenic
962345159 3:134613330-134613352 CCTCCACTTCACTCCCTTGAGGG - Intronic
962423220 3:135246315-135246337 CTTCCAAGTAACTAGATTGAGGG - Intronic
963077249 3:141358648-141358670 CCTAAAAGTGACTATGTTGATGG - Intronic
964448327 3:156784423-156784445 CCTCCAAATCATTAAGTTAAAGG - Intergenic
968379241 4:74874-74896 CCTCCAAATCACTAAGCTAAAGG - Intronic
968838266 4:2981232-2981254 CCCCCAACTCACCACGTTGTGGG - Intronic
972187977 4:36555325-36555347 CCCCCAAATCACTAAGCTGAAGG + Intergenic
976244814 4:82996241-82996263 CCTCATCGTCACTATGTTGAAGG + Intronic
980269660 4:130567688-130567710 CCCCCAAATCACTAAGTTAAAGG - Intergenic
982509370 4:156262226-156262248 CCCCCAAGTCACTAAGCTAACGG + Intergenic
983952635 4:173660868-173660890 CCTCCAGGTCCCTCCCTTGATGG - Intergenic
993349525 5:86831238-86831260 CCTCAAAGTCACACCCTTGAGGG + Intergenic
1003145379 6:3505846-3505868 CCTGCCAGCCACTACGTTGTGGG - Intergenic
1003755363 6:9113479-9113501 CCTCCAAGTCATTAGGTTAATGG + Intergenic
1012960509 6:105616848-105616870 CTTCCAAATTACTATGTTGAAGG + Intergenic
1014884698 6:126765309-126765331 CCAACAAGTCACTACTCTGAAGG - Intergenic
1015236141 6:130973547-130973569 CCCCCAAGTCACTAAGCTAAAGG + Intronic
1016527964 6:145024019-145024041 CCTCCAGGTGACTACGCTAATGG - Intergenic
1017348980 6:153417741-153417763 CCCCCAAGTCACTAAGCTAAAGG + Intergenic
1026614518 7:71889555-71889577 CCTCCAAATCATGACCTTGAAGG + Intronic
1032591479 7:133196088-133196110 CCTCAAACTCACTAAGATGAAGG - Intergenic
1035495714 7:159324057-159324079 CCCCCAAGTCACTAAGCTAAAGG + Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1039351725 8:36770796-36770818 CCCCCAAATCACTAAGTTAAAGG - Intergenic
1040944437 8:52868906-52868928 CCTCAAAATCACTAAGTTAAAGG - Intergenic
1041408589 8:57528564-57528586 CCCCCAAATCACTAAGCTGAAGG + Intergenic
1041521716 8:58764210-58764232 CCTCCAAGTGACTGCATTCAAGG - Intergenic
1045517347 8:102871747-102871769 CTTCCAAGTCACTCAGATGAGGG - Intronic
1045520460 8:102898644-102898666 CCTCCCAGTCACCAGGTTGTAGG - Intronic
1047168036 8:122462411-122462433 CTTCCAAGTCTCTTCGTTTATGG - Intergenic
1049112570 8:140657002-140657024 CCTCCAGGCCACTAAGTTCATGG + Intergenic
1050021758 9:1291900-1291922 CCTCCAAGTTTCCATGTTGATGG - Intergenic
1185773129 X:2780975-2780997 CCCCCAAGTCACTAAGCTAAAGG - Intronic
1185812267 X:3121604-3121626 TCTCCAAGTCACTAAGCTAAAGG - Intergenic
1186007892 X:5094556-5094578 CCTCCAAATCACTAAGCTAAAGG - Intergenic
1187550160 X:20294516-20294538 CCTCCAAGGTACTACCTTGCTGG + Intergenic
1187757941 X:22546925-22546947 CCTCCAGGGCACTACCTTGAAGG - Intergenic
1188094517 X:26005089-26005111 CCCCCAAATCACTAAGTTAAAGG + Intergenic
1199951899 X:152714356-152714378 CATCCAAGTCAGGACCTTGAGGG + Intergenic
1199954544 X:152733534-152733556 CATCCAAGTCAGGACCTTGAGGG + Intronic
1199957784 X:152754092-152754114 CATCCAAGTCAGGACCTTGAGGG - Intergenic
1200389134 X:155925839-155925861 CCTCCAAATCACTAAGCTAAAGG - Intronic
1201297565 Y:12477396-12477418 CCCCCAAGTCAGTAAGTTAAAGG + Intergenic
1202341340 Y:23872089-23872111 ACACAAAGTCACTACCTTGATGG + Intergenic
1202529426 Y:25797997-25798019 ACACAAAGTCACTACCTTGATGG - Intergenic