ID: 1172335916

View in Genome Browser
Species Human (GRCh38)
Location 20:34115253-34115275
Sequence CCTGTTTTGCTGGCTGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172335916_1172335923 17 Left 1172335916 20:34115253-34115275 CCATATACAGCCAGCAAAACAGG No data
Right 1172335923 20:34115293-34115315 TCCAGACAATCTGATGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172335916 Original CRISPR CCTGTTTTGCTGGCTGTATA TGG (reversed) Intergenic
No off target data available for this crispr