ID: 1172336827

View in Genome Browser
Species Human (GRCh38)
Location 20:34123263-34123285
Sequence CTGTAGCCACAGCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 21, 2: 18, 3: 56, 4: 508}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172336827 Original CRISPR CTGTAGCCACAGCTGGAGCC TGG (reversed) Intergenic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900531647 1:3156742-3156764 CTGTGGCCACTGCTTGAGCCGGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900726211 1:4218012-4218034 CTGCAGCCACAGGCGGAACCAGG - Intergenic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900970797 1:5991754-5991776 CCGGAGCCGGAGCTGGAGCCGGG + Intronic
901145639 1:7062773-7062795 CTGGAGCCCCAGCGGAAGCCTGG - Intronic
901533574 1:9868253-9868275 CTGGAGCTGAAGCTGGAGCCAGG - Intronic
901556404 1:10034706-10034728 CTGTAGCTAAAACTGGAGCATGG - Intronic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
903424702 1:23245156-23245178 CTGAAGCTGCAGCTGTAGCCTGG - Intergenic
903813173 1:26046051-26046073 CTGCAGCCGCAGCGGGAGCCGGG - Exonic
904039582 1:27576048-27576070 CTGGAGCCACTGCCCGAGCCAGG - Intronic
904679862 1:32221897-32221919 CTGTAGCAACTGCTGGGCCCAGG + Exonic
904684126 1:32248494-32248516 CTGGAGCTGGAGCTGGAGCCCGG + Exonic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905307840 1:37031828-37031850 CTTGAACCCCAGCTGGAGCCAGG - Intronic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905506783 1:38486146-38486168 CTCTAGCCTCAGCTCCAGCCTGG + Intergenic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906180048 1:43810361-43810383 CTCCTGCCACAGCTGAAGCCTGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
907468247 1:54653830-54653852 CTGATACCATAGCTGGAGCCAGG - Exonic
907549226 1:55289880-55289902 CTGCTGCCACTGCTGGACCCTGG - Intergenic
911205186 1:95085529-95085551 CCTTAGCCACAGCTGGAGTTTGG - Intergenic
911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG + Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
914830106 1:151165119-151165141 CTGGAGCATCAGTTGGAGCCCGG - Exonic
915500268 1:156311122-156311144 CTGGACCCTCAGCTGGTGCCAGG - Exonic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916209147 1:162344672-162344694 CTGTAGCCCAAGCTGGAGTGCGG - Intronic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
916850278 1:168696228-168696250 CTGGAGCACCAGCTGCAGCCTGG - Exonic
917792097 1:178505559-178505581 CTGAATCCACTGCAGGAGCCAGG - Intergenic
918057338 1:181033366-181033388 GTGTAGCCACAGCTTGATCTTGG + Intergenic
918268090 1:182866504-182866526 CTGTAGCCACAGCTTTTTCCAGG - Exonic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
920450775 1:206059646-206059668 CTGTAGCCAGGACTGGAGTCAGG - Intronic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
922856996 1:228783881-228783903 CTGAGGCCACATGTGGAGCCTGG - Intergenic
922899120 1:229122771-229122793 CTGCAGTCAAAGCAGGAGCCAGG + Intergenic
923365219 1:233253365-233253387 CTGTTGCCAAGGCTGGAGGCTGG + Intronic
923966133 1:239140983-239141005 CGGAAGCCACAGGTGGAGGCAGG - Intergenic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
924944648 1:248838238-248838260 CTCCGGCCCCAGCTGGAGCCGGG - Intronic
1062854848 10:774841-774863 GTGCAGCCACACCTGGAGACGGG + Intergenic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1065089595 10:22218655-22218677 CAGTAGCCTCAGCTGGCTCCAGG - Intergenic
1065629233 10:27660403-27660425 CTGTCGCCCCAGCTGGAGGGCGG - Intergenic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1067521386 10:47009323-47009345 CAGGAGCCACACCTGCAGCCAGG + Intergenic
1068986682 10:63114111-63114133 GTCTAGCCAAAGCTGAAGCCTGG + Intergenic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1071879340 10:89878070-89878092 CTCTTGCCACAGCTGGACCCTGG - Intergenic
1072247017 10:93552777-93552799 CTTTAGGCACATCTGGATCCAGG - Intergenic
1072328733 10:94324624-94324646 CTGTAGCCAGATCTGGAAGCTGG + Intronic
1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG + Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077238879 11:1500308-1500330 CTGAAGCCACAGCCACAGCCAGG - Intronic
1077258867 11:1604783-1604805 CTGTAGCCCCAGATGGCTCCTGG - Intergenic
1077491600 11:2863237-2863259 CTCCAGCCCCAGCAGGAGCCTGG + Intergenic
1078665182 11:13318720-13318742 CTGTGGCCACATCTGGAGGGTGG + Intronic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1079904688 11:26230927-26230949 CTGTTGCCCCAGCTGGATCTCGG + Intergenic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1081994455 11:47354729-47354751 CTGTACCCAATGCTGGACCCTGG - Intergenic
1082768520 11:57187435-57187457 CTGCTGCCACCGCTGGAGCAAGG + Exonic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083688380 11:64391420-64391442 CAGTAGCCACCTGTGGAGCCTGG + Intergenic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1083973489 11:66098138-66098160 CTGTAGCCCAAGCTGGAGTGTGG - Intronic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1085269156 11:75259975-75259997 CTGTGGCCCCAGCTCCAGCCTGG - Intergenic
1085322991 11:75586147-75586169 CTGTCGCCCAGGCTGGAGCCAGG + Intergenic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085769679 11:79313722-79313744 CTGTTGTCACTGCTGGAGCTCGG - Intronic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1087071566 11:94086593-94086615 ATGTAGCCATAACTGCAGCCTGG + Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089002860 11:115066900-115066922 ATGCTGCAACAGCTGGAGCCAGG + Intergenic
1089487392 11:118857533-118857555 CTGTAGTCCCAGCTTAAGCCTGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1089733144 11:120532095-120532117 AGACAGCCACAGCTGGAGCCGGG + Intronic
1089746597 11:120621935-120621957 CTGTCGCCCAAGCTGGAGTCCGG + Intronic
1089751433 11:120654154-120654176 CTGTAGTCAAAGCAGGGGCCTGG + Intronic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1091587294 12:1823479-1823501 CTGTAGCCACCCCAGGAGACTGG - Intronic
1092087233 12:5773132-5773154 CTGTAGCCGGAGCTGGTGCATGG - Intronic
1094024050 12:25943374-25943396 GTGTGGCCCCAGCTGGAGACTGG - Intergenic
1094817720 12:34204092-34204114 CTGCAGCCCCACCAGGAGCCTGG + Intergenic
1096239987 12:49954668-49954690 CAGTGACGACAGCTGGAGCCAGG - Exonic
1096333671 12:50736595-50736617 CTCTAGCACCAGCTGGAGTCTGG + Intronic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1100199674 12:92284828-92284850 ATTTATCAACAGCTGGAGCCTGG + Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101811012 12:108107714-108107736 CTGTAGCCACAACTGGCTCATGG - Intergenic
1102532901 12:113559847-113559869 CTGTAGTCCCAGCTCCAGCCTGG - Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1103434480 12:120914326-120914348 CTGTAGCCCAGGCTGGACCCAGG - Intergenic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1105274172 13:18905163-18905185 CACTTGCCACAGCTGGAGGCTGG - Intergenic
1105545499 13:21347927-21347949 CCCAAGCCACAGCTGCAGCCCGG + Intergenic
1105948104 13:25206918-25206940 ATGTAGCCACAGCTTCAACCAGG - Intergenic
1106396402 13:29385100-29385122 TTGTACCAACAACTGGAGCCTGG - Intronic
1108380858 13:49852995-49853017 CTGTTGCCCAGGCTGGAGCCTGG + Intergenic
1108531381 13:51330364-51330386 CTTTAGTCAAAGCTAGAGCCTGG - Intergenic
1110401054 13:75092621-75092643 CTGAAGCCAGAGCAGGAGCACGG + Intergenic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114180535 14:20363512-20363534 CTGTTGCCCAAGCTGGAGCGTGG - Intergenic
1114588694 14:23839358-23839380 CTGTATCCAGAGCTAGAGTCAGG + Intergenic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1115997801 14:39211896-39211918 CTGTGGCGACAGCTGCTGCCAGG + Intergenic
1116326851 14:43540989-43541011 CCAGAGCCAAAGCTGGAGCCCGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117122215 14:52580397-52580419 CTGTAGCCCAAGCTGGAGTTCGG + Intronic
1117543314 14:56769679-56769701 CTGTAGCCAGAGATGAGGCCAGG - Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1119264519 14:73256070-73256092 CTGGTGCCTCAGCTGGGGCCTGG + Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1119669217 14:76506101-76506123 CTGAAGCCACAGGTGCTGCCTGG - Intergenic
1121310102 14:92931322-92931344 GTGAAGCCACAGACGGAGCCAGG + Exonic
1121587023 14:95069391-95069413 CTGAAGCCACATCTCCAGCCTGG - Intergenic
1121904118 14:97724060-97724082 ATGTAGCCACAGCTCGAGGAAGG - Intergenic
1121907250 14:97757714-97757736 CTGTAACCACAGCTGCTTCCCGG + Intronic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122591541 14:102855757-102855779 CTGTAGCCCAAGCTGGAGTGCGG - Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1202851638 14_GL000225v1_random:23770-23792 CTGTAGCCAGATCTGAATCCTGG - Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124629262 15:31327603-31327625 CTGGAGCCCGAGCGGGAGCCGGG + Exonic
1124648852 15:31460256-31460278 CTGTAGTCCCAGCTGGTGGCGGG - Intergenic
1125492113 15:40155924-40155946 CTATAGCCCCAGCAGGAGCCTGG - Intergenic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1126489936 15:49225712-49225734 CTGTAGCCAGTGCTAGAGCAGGG - Intronic
1126621379 15:50643365-50643387 CTGCAGTTACAACTGGAGCCTGG - Exonic
1126851140 15:52798055-52798077 CGGTCTCCCCAGCTGGAGCCGGG - Intergenic
1128084053 15:64873836-64873858 CTGTGGCCCAGGCTGGAGCCAGG + Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128483390 15:68059667-68059689 CTGTAGCCCAGGCTGGAGTCCGG - Intronic
1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG + Intergenic
1128834281 15:70796685-70796707 CTGAAGCCGGAGCTGCAGCCTGG + Intergenic
1129781585 15:78275542-78275564 CAGGAGCCTGAGCTGGAGCCTGG + Exonic
1130214797 15:81958107-81958129 CTGTAGCCAAAGTTGGATTCAGG - Intergenic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1131889646 15:96958819-96958841 TTGTAGCTGGAGCTGGAGCCAGG + Intergenic
1132768276 16:1546203-1546225 CTGCAGCCACAGCATGACCCTGG + Intronic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1133210507 16:4260924-4260946 CTGATGCCACAGCTCCAGCCTGG + Intronic
1133216759 16:4297241-4297263 CTGCAGCCCCAGCTGGGACCAGG + Intergenic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1135392240 16:22103672-22103694 CCCCAGCCACAGCTGGATCCAGG + Intronic
1135739510 16:24961565-24961587 CTGTAGCCCAGGCTGGAGTCTGG + Intronic
1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG + Intronic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136141655 16:28292593-28292615 CTGGAGCCGCAGCCGGAGCCCGG + Exonic
1136522403 16:30805617-30805639 CCGGAGCCAAAGCTGGACCCAGG - Intergenic
1136909177 16:34132815-34132837 CTGCAGCCCCACCAGGAGCCCGG + Intergenic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1138346128 16:56321315-56321337 CTGCAGGCGCAGCTGGATCCAGG + Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1138600738 16:58052400-58052422 CTTTAGGCACGGCTGGATCCAGG - Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140503820 16:75457196-75457218 CTCAAGGCACTGCTGGAGCCTGG + Intronic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1142680709 17:1546608-1546630 CTGTACCCACACATGGAGGCTGG + Intronic
1142743565 17:1943741-1943763 CTGCAGCCCCGCCTGGAGCCTGG + Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1143732541 17:8889148-8889170 CTACACCTACAGCTGGAGCCAGG - Exonic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1144495882 17:15744501-15744523 CAGTGGCCAGAGCTGCAGCCTGG - Intronic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1145209001 17:20999463-20999485 CAGTGGCCAGAGCTGCAGCCTGG - Intergenic
1145736035 17:27232277-27232299 CTGTAGCCACAGCGTGACCTTGG - Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146576935 17:34002385-34002407 CTGTAGCATCAGTTGGATCCAGG + Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147599016 17:41734392-41734414 CTGGAGCCAAGGCAGGAGCCCGG - Exonic
1148103878 17:45109069-45109091 CTGGAGCCTAGGCTGGAGCCAGG + Exonic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1148858033 17:50589781-50589803 CTGGAGCCTCAGCCTGAGCCCGG - Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151348202 17:73516201-73516223 TGGTAGAGACAGCTGGAGCCTGG + Intronic
1151386004 17:73755820-73755842 CTGGAGCCTCAGCTGAGGCCTGG - Intergenic
1151771622 17:76166383-76166405 CTGGGGCCACAGCTGCTGCCAGG + Intronic
1152388322 17:79988349-79988371 AATCAGCCACAGCTGGAGCCAGG - Intronic
1152448841 17:80363670-80363692 CTGTAGCCACGCCTGGGGACTGG - Exonic
1152570052 17:81117743-81117765 CCGTGGCCACAGCGGGACCCAGG + Exonic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1152976717 18:228180-228202 CTGTGGCCACAGCTAGACCTGGG + Intronic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1154069230 18:11138330-11138352 CTGTAGCCCAAGCTGGAGTACGG + Intronic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154465876 18:14642415-14642437 CACTTGCCACAGCTGGAGGCTGG - Intergenic
1155221335 18:23689054-23689076 CTGCAGCCACAGGCTGAGCCAGG - Intergenic
1155391511 18:25342456-25342478 CTGTCGCCCAGGCTGGAGCCCGG + Intronic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1156802107 18:41128494-41128516 CTGTAGCCCAACCTGGATCCTGG - Intergenic
1157222882 18:45839910-45839932 TTGTGGCCACAGCAGCAGCCAGG - Intronic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1158640475 18:59199248-59199270 CTCTAGCCTGAGCTGAAGCCAGG + Intergenic
1159593633 18:70361612-70361634 CTGTCGCCCAAGCTGGAGCGTGG + Intergenic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1160987701 19:1847038-1847060 CTGTAGGCACAGCTGTCGGCAGG + Intronic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161654853 19:5507897-5507919 CAGTTGCCTCTGCTGGAGCCAGG - Intergenic
1161704636 19:5813642-5813664 CTGTTGCCCAAGCTGGAGGCTGG - Intergenic
1161909796 19:7184569-7184591 CTGTTGCCACAGCGAGTGCCTGG - Exonic
1162244209 19:9385745-9385767 GTGTAGCAACAGCTGGTGCTGGG + Intergenic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162958385 19:14112411-14112433 CTGCAGCCACAGCTGGAAGGTGG + Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163621060 19:18360548-18360570 CTGTCGCCCAGGCTGGAGCCAGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165356731 19:35309149-35309171 CTCTAGCCTCAGCTTCAGCCTGG - Intronic
1165509649 19:36258600-36258622 ATGTAGCCACAGCTCGACACAGG + Intergenic
1165511715 19:36270087-36270109 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165512264 19:36272588-36272610 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165512811 19:36275129-36275151 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165513367 19:36277684-36277706 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165513916 19:36280218-36280240 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165514469 19:36282755-36282777 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165515020 19:36285288-36285310 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165515571 19:36287824-36287846 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165516122 19:36290361-36290383 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165516672 19:36292887-36292909 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165517225 19:36295410-36295432 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165517777 19:36297945-36297967 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165518330 19:36300480-36300502 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165518880 19:36303012-36303034 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165519429 19:36305527-36305549 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165519977 19:36308055-36308077 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165624090 19:37270526-37270548 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165624636 19:37273067-37273089 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165625179 19:37275594-37275616 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165625713 19:37278132-37278154 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165626254 19:37280660-37280682 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165626792 19:37283187-37283209 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165627334 19:37285705-37285727 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165627875 19:37288233-37288255 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165628412 19:37290757-37290779 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165628949 19:37293285-37293307 ATGTAGCCACAGCTAGACGCAGG - Intergenic
1165629495 19:37295808-37295830 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165630036 19:37298333-37298355 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165630579 19:37300861-37300883 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165631113 19:37303402-37303424 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1166076568 19:40417276-40417298 CGGTGGCCACAGCCGGAACCAGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166355424 19:42224689-42224711 CTGGAGCCGGAGCTGGTGCCGGG + Exonic
1166697857 19:44864222-44864244 CTGTAGTCCCAGCTTGAACCTGG + Intronic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
926130765 2:10302356-10302378 AGGTAACCAGAGCTGGAGCCAGG + Intergenic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
927871782 2:26628665-26628687 CTGCAGCCACTCCTGGAGCTGGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928914908 2:36460134-36460156 ATGTAACCACAGCTGCAGCCAGG - Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
933974976 2:87502115-87502137 AAGTAGCCACAGCAGTAGCCTGG - Intergenic
934080489 2:88463691-88463713 CTATACCTACAGCTAGAGCCAGG - Intergenic
936318850 2:111448698-111448720 AAGTAGCCACAGCAGTAGCCTGG + Intergenic
936953848 2:118004742-118004764 CTGTGGGCAAAGCTGGAGACGGG - Intronic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
937749421 2:125456741-125456763 CTGTGACCATAGCTGCAGCCTGG - Intergenic
938237450 2:129717628-129717650 CAGTAGCCACAGCTCCTGCCAGG + Intergenic
938856048 2:135312233-135312255 CTGTTGCCAAAGCTGGAGTGCGG + Intronic
941495788 2:166200670-166200692 CTGTCGCCAAAGCTGGAGTGCGG + Intronic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
942195958 2:173520330-173520352 GTGTAGCCTCAGAAGGAGCCAGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
946488022 2:220119663-220119685 TTGTTGTCACAGCTGGAGACAGG + Intergenic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948266771 2:236640836-236640858 CTGTGGCCCCAGCTGGAATCAGG + Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948466825 2:238156266-238156288 CTTGAGCCATAGCTGCAGCCAGG + Intergenic
948525534 2:238568599-238568621 CTATAGCCCCAGCTGGTTCCAGG - Intergenic
948678038 2:239610634-239610656 CTGCATCCACACCTGCAGCCTGG - Intergenic
948736322 2:240008725-240008747 CTGAAGCCCCACCAGGAGCCAGG + Intronic
948797679 2:240413081-240413103 CTCCAGCCTCAGCGGGAGCCAGG - Intergenic
948981526 2:241497149-241497171 CAGGAGCCCCACCTGGAGCCTGG - Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1171771873 20:29327909-29327931 CTGCAGCCCCACCAGGAGCCCGG - Intergenic
1171813821 20:29765121-29765143 CTGCAGCCCCACCAGGAGCCCGG - Intergenic
1171963048 20:31509071-31509093 TTGCAGCCCCTGCTGGAGCCTGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172846236 20:37931364-37931386 CTGGAGCCACACCAGCAGCCGGG - Intronic
1173167226 20:40693865-40693887 CTGTTGCCCAGGCTGGAGCCTGG + Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1174398777 20:50264640-50264662 CTGGATCTTCAGCTGGAGCCAGG - Intergenic
1174427750 20:50444806-50444828 CTGTAGCCCAGGCTGGAGCTCGG - Intergenic
1174429220 20:50455923-50455945 CTGCTCCCACAGCTGGAGACAGG - Intergenic
1174558352 20:51412561-51412583 CTGTAACCACAGCAGGAGGGAGG + Intronic
1174613882 20:51820937-51820959 CTGTAGCCTGGGCTGGATCCAGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175794051 20:61760351-61760373 CTGTGGGCAAAGCCGGAGCCTGG - Intronic
1175925780 20:62470719-62470741 CTGAAGCCTCGGCTGAAGCCTGG - Intronic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176808710 21:13516179-13516201 CACTTGCCACAGCTGGAGGCTGG + Intergenic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1179133549 21:38660473-38660495 CTGTAGCCAGCGTGGGAGCCGGG + Intronic
1180002454 21:45001545-45001567 CTGCTGCCACGGCTGGATCCAGG - Intergenic
1180317270 22:11285744-11285766 CTGCAGCCCCACCAGGAGCCCGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181409785 22:22710841-22710863 CTGAAGCAACACCTGGACCCAGG + Intergenic
1181544233 22:23592014-23592036 GCGTAGCCACAGAAGGAGCCTGG - Intergenic
1181981375 22:26769232-26769254 TTGTACCCACAGCCAGAGCCGGG + Intergenic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183063202 22:35347795-35347817 CTGAAGCCTCACCTGCAGCCTGG - Exonic
1183410238 22:37650657-37650679 CTGGAGCCGGAGCCGGAGCCGGG - Exonic
1183452904 22:37906386-37906408 CCGAAGCCAGAGCCGGAGCCGGG + Exonic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949518838 3:4831316-4831338 CTGAAGCCACAGCCGGAAGCAGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950719853 3:14875175-14875197 CTGAAGTCACATCTGGAGACGGG - Intronic
950767931 3:15287537-15287559 CAGTAGCCACACGTGGAGGCTGG - Intronic
952611492 3:35215817-35215839 CCAGAGCCAAAGCTGGAGCCTGG + Intergenic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954108956 3:48423762-48423784 ACGTGGCCACAGCTGCAGCCTGG + Exonic
954317672 3:49810129-49810151 CTGAAGCCACTGCTGGAGGCAGG - Exonic
954420390 3:50416023-50416045 CTGTAACCACAGCTGTTGACAGG - Intronic
954796711 3:53165162-53165184 TTGTAGCAGCAGCGGGAGCCAGG + Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
955195632 3:56802294-56802316 CTGTAGTGACACCTGGAGGCAGG + Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
961141457 3:124559907-124559929 CTGTATCTAAAGCTTGAGCCCGG + Intronic
961185679 3:124913065-124913087 GTCTTGCCACAGCTGGAGCTAGG - Intronic
961311850 3:126007383-126007405 CTCTAGCCACTGCTTGAGCTCGG - Intronic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961392034 3:126557959-126557981 CTGCAGCCACAGCCTGGGCCAGG + Intronic
961487634 3:127227741-127227763 CTGTGGCTGCAGCTGGGGCCAGG + Intergenic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961749111 3:129085311-129085333 CCGTAGCCAGAGCTGTAGACAGG + Intergenic
961756286 3:129128974-129128996 CCGTGGCCACAGCTGTAGACAGG - Intronic
962742309 3:138370613-138370635 CCGGGGCCACAGCTGGAACCTGG + Intronic
963038414 3:141051527-141051549 CGGTAGCAGCAGCTGGGGCCCGG - Exonic
964523714 3:157594846-157594868 TTGTAACCACAGTTGGAGGCAGG + Intronic
966309129 3:178574331-178574353 CTGAAGCCCCAGGAGGAGCCAGG - Intronic
966679990 3:182631662-182631684 CTGTAGCCAGGGCTCTAGCCAGG + Intergenic
966822864 3:183938801-183938823 CTGTTGCCACAGCAGCAGCTGGG + Intronic
967288506 3:187896855-187896877 CTCTAGCCCCCTCTGGAGCCGGG + Intergenic
967564183 3:190954297-190954319 CTGTCGCCCCAGCTGGAGTGCGG - Intergenic
968062094 3:195733362-195733384 CTGTTGCCACATCTGGGGTCAGG - Exonic
968533120 4:1105914-1105936 CTGCAGCCCCTGCAGGAGCCAGG - Intronic
968856402 4:3127448-3127470 CTTGAGCCACAGCTCCAGCCAGG + Exonic
968931411 4:3581483-3581505 CTCGAGCCCCATCTGGAGCCAGG - Intronic
968962113 4:3750918-3750940 ATCCAGTCACAGCTGGAGCCAGG + Intergenic
968963456 4:3757538-3757560 CTTTGGCCACAGCTGGGGACAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG + Intronic
971971815 4:33630825-33630847 CTGTGTCCTCATCTGGAGCCTGG + Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972487388 4:39555267-39555289 CTGTAGCCCAAGCTGGAGTGTGG + Intronic
972644782 4:40956973-40956995 CTGTAGCCACACCAACAGCCTGG + Intronic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973296100 4:48522317-48522339 GTGTAACCATAGCTGGTGCCTGG + Intronic
973317976 4:48780794-48780816 ATGTATCCAGAGCTGGCGCCCGG + Intergenic
974433494 4:61828749-61828771 CATCAGCAACAGCTGGAGCCTGG + Intronic
974878501 4:67725348-67725370 CTGCAGTCATAGCTGAAGCCTGG - Intergenic
975096509 4:70463413-70463435 CTATAGCCACAACTAGAGCATGG - Intronic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
975856200 4:78627268-78627290 CTTTAGGCACAGCTGGATTCAGG + Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
981035609 4:140165424-140165446 CTTTAGGCTCAGCTGGATCCAGG - Intergenic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
984154536 4:176178516-176178538 CTGTAGCCAAACCTGCATCCAGG + Intronic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987812002 5:22849088-22849110 CTACAGCCACAGCTGGAACATGG - Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993599441 5:89902612-89902634 CTGTAGCCCAGGCTGGAGCTAGG + Intergenic
994291763 5:98034890-98034912 CAGTAGCTGCAGCTGAAGCCAGG + Intergenic
994419294 5:99512953-99512975 CTGTCGCCTCAGCTGGAGTGCGG + Intergenic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
996142743 5:119932715-119932737 CAGCAGCCTTAGCTGGAGCCAGG - Intergenic
996442912 5:123512271-123512293 CTGTCGCCACCGATGCAGCCCGG - Intronic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998096994 5:139401636-139401658 CTGTATCCTCAGCTGGGGACAGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000083354 5:157867925-157867947 CTGTGGCCACTGCTGGTGTCAGG + Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001700424 5:173702686-173702708 CGGTAGCCACATCTGGAGAGTGG + Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002418724 5:179134722-179134744 CTGGAGCTGGAGCTGGAGCCGGG - Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002470377 5:179431436-179431458 CTGGAGCCACAGCATCAGCCAGG - Intergenic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002572914 5:180154187-180154209 CTGGAGCCTCAGCTGGCCCCGGG + Intronic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003545450 6:7054197-7054219 CTGTTGCCTCAGCTGGAGTGCGG - Intergenic
1005488320 6:26322444-26322466 CTGTAGCCCCGGCTGGAGTCTGG + Intergenic
1006009770 6:31032527-31032549 CAGCAGCCACAACTGCAGCCAGG - Exonic
1006028026 6:31159599-31159621 CTGCGGCCCCAGCAGGAGCCTGG + Exonic
1006145848 6:31959169-31959191 CTGGAGCCACAGCAGCTGCCTGG - Exonic
1006355113 6:33551305-33551327 CTGTCGCCCCGGCTGGAGTCTGG - Intergenic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1007759089 6:44121815-44121837 CTGTAGTCCCAGCTACAGCCCGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1008899187 6:56591831-56591853 CTGTAGTCCCAGCTGGTGGCGGG + Intronic
1010732423 6:79404981-79405003 CTCTCGCAACAGGTGGAGCCTGG + Intergenic
1011044563 6:83067582-83067604 CTGTGGCAACAGCTAGCGCCGGG + Intergenic
1011127698 6:84024356-84024378 CTGTGGCCTCAGGTGGAGGCAGG - Intergenic
1012252592 6:96995517-96995539 GTGAAGCCACTCCTGGAGCCTGG - Intronic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013779000 6:113709834-113709856 CTGTAGTCTCAGCTGGAGTGGGG + Intergenic
1013904152 6:115195492-115195514 CTGCTTCCACAGCAGGAGCCTGG - Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017117953 6:150996625-150996647 CTGTAGGCTCAGCAGGAACCAGG - Intronic
1018039740 6:159911369-159911391 CTGTTGCCCCAGCTGGAGTGCGG + Exonic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019107163 6:169677789-169677811 CTGAGGCCAGAGCTGGAGACGGG - Intronic
1019504717 7:1385218-1385240 CTGTAGCCACACCTGTGTCCAGG - Intergenic
1019652589 7:2168500-2168522 CTGTGGCCCCAGCTGGTCCCTGG + Intronic
1019927256 7:4201615-4201637 CTCTAGCCACAGCAGATGCCTGG + Intronic
1020376437 7:7492546-7492568 CTGTTGCCAAAGCTGGAGTGTGG - Intronic
1020430651 7:8113391-8113413 CTGTCCCCACAGCAGGTGCCTGG - Exonic
1020535324 7:9389460-9389482 CTGTAGCCACTACCGTAGCCAGG - Intergenic
1020586637 7:10078485-10078507 GGGTAGCCACAGCTGTAGCTGGG - Intergenic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1025245452 7:57313268-57313290 CTGCTCCCACAGCTGGAGACGGG + Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026374785 7:69739413-69739435 GTGTACCCACATCAGGAGCCTGG - Intronic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1028541855 7:91951359-91951381 CTGTTGCCCCAGCTGGAGTGTGG + Intronic
1029540603 7:101180046-101180068 CCGGAGCCGGAGCTGGAGCCAGG + Exonic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030957756 7:115876552-115876574 ATGCAGTCACTGCTGGAGCCTGG - Intergenic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032085056 7:128879510-128879532 CTGGAGCCGCACCTGGAGCCCGG + Exonic
1032200070 7:129814565-129814587 CTGTCACCCCAGCTGGAGGCTGG + Intergenic
1032274827 7:130445256-130445278 CTCTAGCCTAAGCTGGAGGCAGG - Intergenic
1032488565 7:132306701-132306723 GAGTTGCCACAGCTGGAACCAGG + Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034257029 7:149730260-149730282 CTGAAGCTCGAGCTGGAGCCGGG - Exonic
1034263114 7:149769292-149769314 CTGTGGGCCCTGCTGGAGCCAGG - Intronic
1034270643 7:149802077-149802099 CTGCAGCCGCAGCTGTGGCCTGG + Intergenic
1034964914 7:155384881-155384903 CCGTAGACAGAGCAGGAGCCAGG - Intronic
1036137611 8:6176160-6176182 TTGCAGCCTCTGCTGGAGCCGGG - Intergenic
1036598209 8:10233186-10233208 TTGTAGCCACTGCTGCAGCAGGG + Intronic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1037015892 8:13905755-13905777 CTGTTGCCCAGGCTGGAGCCAGG + Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037749876 8:21674511-21674533 CTCTGGCCACAGCTGGAGTGGGG - Intergenic
1038679936 8:29657487-29657509 CTCTAGCCACAGCACAAGCCAGG - Intergenic
1039048576 8:33472751-33472773 CCGGAGCCTCTGCTGGAGCCCGG - Intronic
1041362363 8:57066844-57066866 CTGTGGCCACAGCAGGTGGCAGG - Intergenic
1041532372 8:58884060-58884082 TTGAAGCCTCAGCTGGACCCTGG - Intronic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1045694208 8:104789336-104789358 CTTTAGCCACTGCTAGACCCGGG - Intronic
1045713283 8:105011493-105011515 CTGTAGCTGGAGCTGCAGCCTGG - Intronic
1047289660 8:123518766-123518788 CAGTAGCAAATGCTGGAGCCAGG + Intronic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1049017941 8:139934658-139934680 CTGTGGCCACATGTGCAGCCTGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049542454 8:143214729-143214751 CTGTGACCACGGCAGGAGCCTGG + Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049641608 8:143718509-143718531 CTGTGGTCAGAGCAGGAGCCTGG - Intronic
1050210938 9:3255417-3255439 GTGTAGCCACAGCTACAGTCAGG + Intronic
1050243086 9:3658788-3658810 CTGCAGTCACTGCTGTAGCCAGG - Intergenic
1050376194 9:4975897-4975919 CAGTAATCACAGCTGCAGCCAGG - Intergenic
1051315548 9:15826734-15826756 CTGGAGCCTCAGCTGAAGGCTGG - Intronic
1051535644 9:18154414-18154436 CCGTAGGCACAGCTAGAGGCTGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1054458716 9:65450446-65450468 CTCGAGCCCCATCTGGAGCCAGG + Intergenic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1055363571 9:75521229-75521251 CTGTAGCCACAGCTACACTCAGG + Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056230501 9:84538525-84538547 CTCTAGACCCACCTGGAGCCAGG - Intergenic
1056630130 9:88286657-88286679 CTGTAATCACAGCAGGAGACGGG + Intergenic
1056816114 9:89802436-89802458 CTGTCCCCAGAGCTGCAGCCGGG - Intergenic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060219585 9:121757256-121757278 CTGTGGCCTCAGCAGGGGCCAGG + Intronic
1060408261 9:123383335-123383357 CTGCAGCCCCTGCTGGAACCGGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061086167 9:128400037-128400059 CTGTCGCCACAGCTGTTCCCTGG - Intergenic
1061153252 9:128841489-128841511 CTGTCGCCCCGGCTGGAGTCTGG - Intronic
1061393673 9:130331796-130331818 CGGGAGCCACAGCCAGAGCCAGG - Intronic
1061725311 9:132579317-132579339 CTGTTCCCACAGCAGGAGGCAGG - Intergenic
1061753831 9:132799024-132799046 CTGAAGCCAGACCTGCAGCCCGG - Intronic
1061868150 9:133506058-133506080 CTAGAGCCCCGGCTGGAGCCAGG - Intergenic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1062546914 9:137067977-137067999 CTGTACCCACTTCTGTAGCCTGG - Intronic
1203365511 Un_KI270442v1:251459-251481 CTGCAGCCCCACCAGGAGCCCGG - Intergenic
1185468752 X:370400-370422 CTGCAGCCACGGCTGCAGCGAGG + Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1190060256 X:47206280-47206302 CGGAAGCCACTGCTGGAGTCAGG + Exonic
1190928448 X:54928957-54928979 CTGAAGCCACCACTGGAGCTGGG - Exonic
1192151992 X:68718306-68718328 CTGGAGCCTGAGCCGGAGCCAGG - Exonic
1193583608 X:83294251-83294273 CTCTAGCCACAGGTGAGGCCTGG + Intergenic
1196193255 X:112815539-112815561 CAGCAGCCACAGCAGCAGCCAGG - Exonic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196981095 X:121214320-121214342 CTGTAGTCCCAGCTTGAACCCGG - Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1200167258 X:154045350-154045372 CTGTGGCAGCAGCTGGAGTCAGG - Intronic
1200281185 X:154778343-154778365 CTGTAGCCATATCATGAGCCAGG + Intergenic
1201073190 Y:10168770-10168792 CTGCAGCCCCACCAGGAGCCGGG + Intergenic