ID: 1172343759

View in Genome Browser
Species Human (GRCh38)
Location 20:34180298-34180320
Sequence GGGTTTGATCAGATAGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172343757_1172343759 -7 Left 1172343757 20:34180282-34180304 CCAGAGTGAAGCATTTGGGTTTG No data
Right 1172343759 20:34180298-34180320 GGGTTTGATCAGATAGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172343759 Original CRISPR GGGTTTGATCAGATAGATCA GGG Intergenic
No off target data available for this crispr