ID: 1172344846

View in Genome Browser
Species Human (GRCh38)
Location 20:34190026-34190048
Sequence TGGGTTAGAAAGGCTGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172344846_1172344854 16 Left 1172344846 20:34190026-34190048 CCCGCAACAGCCTTTCTAACCCA No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172344846 Original CRISPR TGGGTTAGAAAGGCTGTTGC GGG (reversed) Intergenic
No off target data available for this crispr