ID: 1172344854

View in Genome Browser
Species Human (GRCh38)
Location 20:34190065-34190087
Sequence ATGCTCTTCACCAATAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172344849_1172344854 6 Left 1172344849 20:34190036-34190058 CCTTTCTAACCCAGCGCCATGGA No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data
1172344845_1172344854 23 Left 1172344845 20:34190019-34190041 CCACTGTCCCGCAACAGCCTTTC No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data
1172344847_1172344854 15 Left 1172344847 20:34190027-34190049 CCGCAACAGCCTTTCTAACCCAG No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data
1172344851_1172344854 -4 Left 1172344851 20:34190046-34190068 CCAGCGCCATGGACCAGCTATGC No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data
1172344846_1172344854 16 Left 1172344846 20:34190026-34190048 CCCGCAACAGCCTTTCTAACCCA No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data
1172344850_1172344854 -3 Left 1172344850 20:34190045-34190067 CCCAGCGCCATGGACCAGCTATG No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data
1172344852_1172344854 -10 Left 1172344852 20:34190052-34190074 CCATGGACCAGCTATGCTCTTCA No data
Right 1172344854 20:34190065-34190087 ATGCTCTTCACCAATAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172344854 Original CRISPR ATGCTCTTCACCAATAGCCT AGG Intergenic
No off target data available for this crispr