ID: 1172346845

View in Genome Browser
Species Human (GRCh38)
Location 20:34208737-34208759
Sequence TCCAATCTATGAACATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 2, 2: 9, 3: 31, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172346845 Original CRISPR TCCAATCTATGAACATGAGA TGG Intronic
904989591 1:34581029-34581051 GTCAATCCATGAACAGGAGAAGG - Intergenic
905002492 1:34683966-34683988 TCCAATCTTTGATCAAGAGCTGG - Intergenic
905759956 1:40547463-40547485 TTCACTTTATGAATATGAGAAGG + Exonic
905896614 1:41550491-41550513 TCCTATCCATGAGCATGAAATGG + Intronic
906084633 1:43120703-43120725 TCCAATCTATGAACATGGATTGG + Intergenic
907153723 1:52312839-52312861 TTCAATATATGAACTTTAGAGGG - Intronic
907485403 1:54774559-54774581 TCCAACCTATGAATTTCAGAGGG + Intergenic
908537824 1:65094672-65094694 TCCAATCCATAAGCATGGGATGG + Intergenic
909845802 1:80393457-80393479 TTCAATATATGGATATGAGAAGG - Intergenic
910422695 1:87084444-87084466 GCCAATTTATGAACACTAGAGGG - Intronic
910513433 1:88032726-88032748 TCCAATTCATGATCATAAGATGG - Intergenic
915991810 1:160525278-160525300 TCCTATCTATGAGCATGGAATGG + Intergenic
918235122 1:182572759-182572781 TTCAATGTATGAACTTGGGAGGG + Intergenic
918272690 1:182918526-182918548 TCCAATCCATGAACATGGGATGG - Intronic
919040709 1:192384454-192384476 TCTAATCCATGAACATGAAATGG - Intergenic
920025944 1:202996553-202996575 TCCAATCAATGAACATAGGATGG - Intergenic
920892129 1:209998321-209998343 TCCAATCCATGAGCACGGGATGG - Intronic
921042255 1:211444525-211444547 TCCAATCCATGAACATGGGGTGG - Intergenic
921467969 1:215513832-215513854 TCTGATCCATGAGCATGAGATGG - Intergenic
922159642 1:223069508-223069530 TCCAATCCATCAGCATGTGAAGG + Intergenic
924192906 1:241573887-241573909 TCCAATCCATGAACTTGGAATGG + Intronic
1062933849 10:1370823-1370845 TCCAATCCATGAGCATGGGATGG - Intronic
1063508274 10:6621756-6621778 TCCAGTCTATCAATAGGAGATGG + Intergenic
1063625272 10:7683483-7683505 TCCAATCCATGAGCATGGAATGG - Intergenic
1063997982 10:11639261-11639283 TTTAACCTATGAATATGAGAGGG - Intergenic
1064316850 10:14265663-14265685 GCCCATGTATCAACATGAGAAGG + Intronic
1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG + Intronic
1065075599 10:22075947-22075969 TCCTATCTATGAGCATGGAATGG + Intergenic
1065405805 10:25362567-25362589 TTCAATCCATGAACATGGGATGG + Intronic
1068105834 10:52614757-52614779 TAAAATCTATTAACATGGGAGGG - Intergenic
1068270943 10:54722915-54722937 TCCAATCCATGAGCATAGGATGG - Intronic
1068329397 10:55541982-55542004 TACAATATATAAACCTGAGAGGG + Intronic
1070444640 10:76484427-76484449 TTCATTCCATGAACATGATATGG + Intronic
1070574198 10:77665217-77665239 TCCATTCCATGAAAGTGAGATGG + Intergenic
1073921332 10:108463276-108463298 TTCAACCTATGAATCTGAGAGGG - Intergenic
1079494510 11:21026544-21026566 TCCAGTTTATGAACAATAGATGG + Intronic
1079549707 11:21679321-21679343 TTCAATCCATGAACTTGGGATGG + Intergenic
1079900510 11:26177545-26177567 TCCAATCTATGGGCATGGGATGG - Intergenic
1080915346 11:36652172-36652194 TCCTATCCATGAACATGGAATGG + Intronic
1082247439 11:49941185-49941207 TTCCATCTATGAACAGTAGATGG - Intergenic
1082563186 11:54643407-54643429 TTCCATCTATGAACAGTAGATGG + Intergenic
1082985436 11:59165744-59165766 TCCAATCCATAAACACGATATGG - Intergenic
1083287986 11:61672982-61673004 TCCAATGTATGAACTTTGGAGGG + Intergenic
1084435855 11:69139095-69139117 TCCAATTTAGGAACATTAGACGG + Intergenic
1086649014 11:89263863-89263885 TCCAATCTGTGAACAAGGGGGGG - Intronic
1088139485 11:106598228-106598250 TTCAATCCATGACCATGATATGG + Intergenic
1088824674 11:113483693-113483715 ACCTATCTCTGAAAATGAGAAGG - Intergenic
1089267245 11:117273502-117273524 CCTAATCTCTGAACATAAGAAGG - Intronic
1089900751 11:121981329-121981351 TCCAATGCATGAACATGGCATGG - Intergenic
1090893931 11:130952433-130952455 TCCACTCACTGAACGTGAGAGGG - Intergenic
1092708546 12:11309722-11309744 TGCAATATATTAACAGGAGATGG - Intronic
1092890562 12:12965672-12965694 TGAAATGAATGAACATGAGAGGG + Intergenic
1094525972 12:31231442-31231464 AGCAATCAATAAACATGAGAAGG - Intergenic
1094780503 12:33787139-33787161 TGCAATCTATGCATCTGAGAAGG - Intergenic
1095042782 12:37461957-37461979 TTCAATTCATGAAAATGAGATGG + Intergenic
1095218955 12:39585140-39585162 TCCTATCCATGAACATGGGATGG + Intronic
1095336824 12:41038595-41038617 TTCGATATATGAACTTGAGAGGG + Intronic
1095366068 12:41406953-41406975 TTCAAACTATGAACATGGGTTGG - Intronic
1095542621 12:43328715-43328737 TCCTATCCATGAGCATGGGATGG + Intergenic
1095780560 12:46054482-46054504 TCCAATCCATGAACATGGAAAGG - Intergenic
1097755991 12:63407251-63407273 TCCAAACTTTGAACAGGAGGAGG + Intergenic
1098051944 12:66463457-66463479 TTCTATCTATAAACATGAGTGGG + Intronic
1098624657 12:72648919-72648941 TCCAATCCATGAACATCAGATGG - Intronic
1098808719 12:75055741-75055763 TCCAATCAGTGACCATGAGTTGG + Intronic
1099394381 12:82120371-82120393 TCCAATCCGTGAGCATGAAATGG - Intergenic
1100931786 12:99618311-99618333 TTCAATCCATGAACATGGAATGG - Intronic
1101868291 12:108540500-108540522 TCCAATCTATGAACATATATAGG - Intronic
1103022210 12:117543661-117543683 TCCAATCCATGAACATGGTATGG + Intronic
1105653970 13:22414246-22414268 TCTGATCCATGAACATGGGATGG + Intergenic
1106278741 13:28242777-28242799 TCCAATCTGTGAACATGGATGGG + Intronic
1107116229 13:36748852-36748874 TCCTATCCATGAACATGGAATGG + Intergenic
1108015647 13:46072750-46072772 TTCTATCACTGAACATGAGAAGG - Intronic
1108194414 13:47978037-47978059 TCCTATCTATGAGCATGGAATGG - Intronic
1108422707 13:50266990-50267012 TACTATCTATGAACATCACAGGG - Intronic
1111287012 13:86107505-86107527 TCCAATCTATAGACATAAAATGG - Intergenic
1112021518 13:95375371-95375393 TACAATCCATGATCATGGGATGG - Intergenic
1114988225 14:28255923-28255945 TACAATTCATGAACATGGGATGG - Intergenic
1121810126 14:96878934-96878956 TCCATTTTATGAACAGGAGGGGG - Intronic
1123453468 15:20390789-20390811 TCCAATCAATGAAAATGGAATGG + Intergenic
1124592772 15:31068029-31068051 GCCAATCTTTCACCATGAGATGG + Exonic
1130852180 15:87805458-87805480 TCCTTTCTATGGATATGAGAGGG + Intergenic
1131886506 15:96920774-96920796 TCCAATGCATAAACATGGGATGG + Intergenic
1133501917 16:6374821-6374843 CTTAATCTGTGAACATGAGATGG + Intronic
1135962411 16:27007945-27007967 TCCAATCCATGAATAAGATATGG - Intergenic
1142736919 17:1906962-1906984 TCCATTCCATCAACAAGAGAGGG - Intergenic
1144645175 17:16968244-16968266 TTCAATCCATGAGCATGGGATGG - Intronic
1144714638 17:17425356-17425378 TCCAGGCTAGGAACATGAGCCGG + Intergenic
1149167775 17:53774244-53774266 TCCAAACTATGAACATAGAAGGG + Intergenic
1154376371 18:13813437-13813459 TGCCATCTATGATCAGGAGAGGG + Intergenic
1155053486 18:22167025-22167047 TACAATCTGTGACCATGAAAAGG + Intergenic
1155894570 18:31308747-31308769 TTGAATCCATGAACATGAAATGG - Intergenic
1156224540 18:35091083-35091105 TCCAATCCATAAACATGGCATGG - Intronic
1156757861 18:40550523-40550545 TCCAATTTATGAAGCTGAGTGGG - Intergenic
1157398188 18:47361422-47361444 TCCTATCCATGAACATGACATGG + Intergenic
1158229557 18:55238739-55238761 TCCAATCTGTCATCATGAGAGGG - Intronic
1158860398 18:61586208-61586230 TGCCATCTATGAACCAGAGAGGG - Intergenic
1164421573 19:28098236-28098258 TTCTATCTATGAGCATGAAAAGG - Intergenic
1164874526 19:31674239-31674261 TCCCACCTTTAAACATGAGAGGG + Intergenic
1165056472 19:33179698-33179720 TCTAATCCATGAACATGGAATGG + Intronic
925404280 2:3595868-3595890 TTCCAGCTATGCACATGAGATGG - Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
926691860 2:15741764-15741786 TCCAATCTATGAACATGGTATGG + Intronic
927006693 2:18857934-18857956 TCCTATTTATGAACATGGAATGG + Intergenic
927893836 2:26768955-26768977 TCCATTCCATGGAGATGAGAGGG + Intronic
928362208 2:30673951-30673973 TCCAACCTAAGAACAAGAAAAGG + Intergenic
929725246 2:44418860-44418882 TCCAATCTATAAACCTGATATGG + Intronic
930549401 2:52813500-52813522 TCCAATCAATGAGCATTAAATGG + Intergenic
930958804 2:57233905-57233927 TGCAAACTAAAAACATGAGAAGG - Intergenic
931265090 2:60653501-60653523 TGCTATCTACGACCATGAGAGGG - Intergenic
931646657 2:64428301-64428323 TCCAGTCCATGAACATGATATGG + Intergenic
935060154 2:99600391-99600413 GCCACTCTGTGAACCTGAGATGG + Intronic
935454757 2:103254336-103254358 TCCCAGCAAAGAACATGAGAAGG + Intergenic
936748355 2:115609010-115609032 AACAATCTATGAACAATAGATGG + Intronic
937184333 2:120025658-120025680 TCAAATTCATGAACATGGGATGG - Intronic
942386876 2:175452036-175452058 TCCAATATATGAATTTTAGAGGG - Intergenic
943451679 2:188050183-188050205 TTCAATATATGAGCATGAGGGGG - Intergenic
943964499 2:194315681-194315703 TCCAATCTATGAACCTGGGATGG + Intergenic
944324116 2:198383357-198383379 TCTAATCACTGAACAGGAGAAGG - Intronic
945758370 2:213879265-213879287 TCCAATTCATGCGCATGAGATGG + Intronic
945823390 2:214691503-214691525 TCCAATTTATGAACATAGGATGG - Intergenic
946115374 2:217457313-217457335 TGGAAGCTATGAACAGGAGATGG - Intronic
946956088 2:224931365-224931387 TCCAATCTTTCAACTTGAGGGGG + Intronic
1169903086 20:10572442-10572464 TCTATTCTCTGATCATGAGATGG + Intronic
1171536258 20:25893959-25893981 TCATAACTATTAACATGAGAAGG + Intergenic
1171537211 20:25904719-25904741 TTCAATTCATGAAAATGAGATGG + Intergenic
1172346845 20:34208737-34208759 TCCAATCTATGAACATGAGATGG + Intronic
1174554650 20:51385139-51385161 CCCAATGTATGAACATGAAGAGG + Intergenic
1175020354 20:55840880-55840902 TCCAATCCATGAACATGAGATGG - Intergenic
1177101722 21:16906178-16906200 TCCAATCCATAAACATAGGAAGG - Intergenic
1177690992 21:24507247-24507269 TCCTATCTATGAGCATGGAATGG + Intergenic
1177951166 21:27539623-27539645 TATAATCTATGAGCATGGGATGG - Intergenic
1178112218 21:29379754-29379776 TGCAATCAAGGCACATGAGAAGG + Intronic
1178388030 21:32171866-32171888 TCTGATCCATGAACATGGGATGG - Intergenic
1180395172 22:12325221-12325243 TCCTATCCATGAGCATGAGGTGG + Intergenic
1180404568 22:12539530-12539552 TCCTATCCATGAGCATGAGGTGG - Intergenic
1184710927 22:46249068-46249090 ACCCAACCATGAACATGAGAAGG - Intronic
950598491 3:14008449-14008471 TCCAATCCAGGAATATGACAAGG + Intronic
953330788 3:42051435-42051457 TCCATTCTATGCCCAAGAGAGGG + Intronic
953685476 3:45074842-45074864 CCCAATCTCTAAACATCAGAGGG - Intergenic
955031023 3:55218383-55218405 TCCAATCCATGACCATAGGATGG + Intergenic
955664516 3:61336154-61336176 CCCAAACAATGAACATAAGAGGG + Intergenic
956868269 3:73390707-73390729 TCCACTCAATGAACACGAGTTGG + Intronic
956882505 3:73525501-73525523 TCAAATTTATGAACATGAAAGGG - Intronic
956984333 3:74679775-74679797 TTCAATATATGAACTTGGGAGGG - Intergenic
957006111 3:74948717-74948739 TCCAAACTATGAATCTGAGAAGG - Intergenic
957395460 3:79630995-79631017 TCCAATCAGTAAACATGGGATGG - Intronic
958003331 3:87779544-87779566 TCCAATCCTTGAACATGGAATGG - Intergenic
959016560 3:101140934-101140956 TGCAAACTATGTACTTGAGAAGG - Intergenic
959216925 3:103462839-103462861 TCTAATCCACAAACATGAGATGG + Intergenic
959654606 3:108787995-108788017 TCCAATCTATGAGCATGAAGTGG - Intergenic
962611425 3:137080077-137080099 TTCAAACTATGAACATGATAGGG + Intergenic
963260394 3:143186381-143186403 TCCAAGCTAGGGACATGAGAGGG + Intergenic
964877259 3:161381858-161381880 TCTGATCCATGAACATGGGAGGG + Intergenic
964926973 3:161971018-161971040 TCAAATATAAGAGCATGAGAAGG - Intergenic
965077639 3:163999880-163999902 TCCTATGTAAGAACATAAGAGGG - Intergenic
965233630 3:166086649-166086671 TCCATTCTATGATCAGTAGAAGG - Intergenic
965533004 3:169794166-169794188 TCCAATTTATGAACATCTGTGGG - Intronic
966699185 3:182826522-182826544 TTCAATGTATACACATGAGATGG - Intronic
968537248 4:1141347-1141369 TGCAATCCATGAACCCGAGATGG - Intergenic
969387414 4:6863794-6863816 TCAAATATATCAACTTGAGAAGG - Exonic
972951324 4:44326781-44326803 TCCAATATATAAACATTTGAAGG + Intronic
973006669 4:45016276-45016298 TCCAATCCATGAGCATGGAATGG + Intergenic
973781947 4:54296429-54296451 TTGAATCTATGAACCTGAAAAGG + Exonic
976157532 4:82163043-82163065 ACCCATCCATGAGCATGAGATGG - Intergenic
977684186 4:99829169-99829191 TCCAATACATGAAAATAAGAAGG + Intronic
978765811 4:112403843-112403865 TCCAATCTATTAAGAGTAGAAGG + Intronic
979782433 4:124669927-124669949 TCCATTGTGTGAACAGGAGATGG + Exonic
980749225 4:137067252-137067274 ACCAATCTATGAGCATGAGATGG + Intergenic
980900782 4:138902939-138902961 TTCAACATATGAACATGGGAGGG + Intergenic
981556195 4:145997662-145997684 TCCAATCCATGAACATGAGATGG + Intergenic
985475945 5:79174-79196 TCCAAATAATGAAGATGAGATGG + Intergenic
986753943 5:10816462-10816484 TCCCATCTATGTGCATGAAATGG - Intergenic
988198711 5:28043559-28043581 TTCCATCTATGAGCATGAGATGG + Intergenic
990841902 5:60091054-60091076 TCCAATTCATGAGCATGGGATGG - Intronic
991380727 5:66022548-66022570 TGCAATCAATGATCATGTGATGG - Intronic
991539732 5:67714116-67714138 CTGAATCTATGAACATTAGAAGG + Intergenic
991598689 5:68330970-68330992 TTCAAACTATGAACTTGTGAGGG + Intergenic
992087867 5:73294300-73294322 TCCAGTATGTGAACATGAGGAGG - Intergenic
992365860 5:76088630-76088652 TCCAACATATGAATTTGAGAGGG + Intronic
994872797 5:105375142-105375164 TCTGACCTATGAACATGGGATGG + Intergenic
995437158 5:112149582-112149604 TCCAGTTTAAGAACATTAGAAGG - Intronic
995612008 5:113920843-113920865 GCCAATTAATGAATATGAGAAGG + Intergenic
997310079 5:132872532-132872554 CCCAACCTGTGAAGATGAGACGG + Exonic
1000663697 5:163968347-163968369 TGCAATCTAAGAACATAAGGAGG - Intergenic
1000748854 5:165069946-165069968 TCCTATCCATGAGCATGAAATGG + Intergenic
1004442790 6:15670002-15670024 TCCCAGCCATGAACCTGAGATGG + Intergenic
1005205384 6:23397166-23397188 TCCAAGGAATCAACATGAGAAGG - Intergenic
1006274517 6:32991814-32991836 TCCAATCTATGAGCATGGCATGG + Intergenic
1006643513 6:35500639-35500661 TCTAATCCATGAACGTGAGCAGG - Intronic
1007920335 6:45603609-45603631 TCTAATCTATGAACATGAAATGG - Intronic
1008608407 6:53163421-53163443 TCCAATCCATGAACATGGAATGG - Intergenic
1008642527 6:53479306-53479328 TCCAATCCATTAACACAAGACGG + Intergenic
1009382437 6:63049180-63049202 TCCAATCTGTGCACATGGGATGG + Intergenic
1010903927 6:81462278-81462300 ACCCATCCATGAACATGGGATGG + Intergenic
1011958447 6:93054634-93054656 TCAAATCCATGAGCATGTGATGG + Intergenic
1012352754 6:98273248-98273270 TCCAAACTGTGAACATGGGATGG + Intergenic
1014297267 6:119635064-119635086 TCCAATCCATGAATATGGTAAGG - Intergenic
1017372692 6:153732056-153732078 TCCTATCCATGAACATGAAATGG - Intergenic
1018760362 6:166889331-166889353 TCCTATCTATGAGCATGGAATGG - Intronic
1021051882 7:15995396-15995418 TCCCATCCATGAACATGGAATGG + Intergenic
1021557595 7:21937164-21937186 TCCAATCCATGAACATGGGATGG - Intronic
1022475845 7:30709035-30709057 GCCCATCCATGAAGATGAGATGG + Intronic
1024197833 7:47076960-47076982 TCCAATCCATGAACATGGTATGG - Intergenic
1030089528 7:105845415-105845437 TCCAACGCATGAACATGGGAAGG - Intronic
1030410086 7:109165686-109165708 TCCAAACAATTAACAAGAGAAGG - Intergenic
1032850676 7:135792470-135792492 TCTCATCTATGAACCTGAAAGGG - Intergenic
1037154254 8:15680204-15680226 TCCAATCCATGAGCATGGGTTGG + Intronic
1038228122 8:25675358-25675380 TCGAATATATGAATATGAAAAGG - Intergenic
1038562585 8:28593385-28593407 TCCAATCCATGAGCATGGAATGG + Intergenic
1038609813 8:29049973-29049995 ACTAATCTGTGAACATCAGAAGG + Intronic
1041326019 8:56665274-56665296 GCCAATCTATGCACAAGAGGGGG + Intergenic
1043231584 8:77808845-77808867 TCCAATCCATGAGCATGGAATGG - Intergenic
1043290930 8:78599702-78599724 TCCAATTTCATAACATGAGATGG + Intronic
1044001028 8:86881539-86881561 TCCTATCTATGAGCATGGAATGG - Intronic
1044614076 8:94121228-94121250 TTCAATCCATGATCATGTGAGGG + Intergenic
1044623041 8:94209388-94209410 GCCAAGAAATGAACATGAGAAGG - Intronic
1047551185 8:125873830-125873852 ACCATTCTATGGACATGATATGG - Intergenic
1048050885 8:130814948-130814970 TCCAATATATGAATTTGAGAGGG - Intronic
1049565641 8:143337096-143337118 TCCAGTCCGTGAACATGGGATGG - Intronic
1050375943 9:4973085-4973107 TCCAAACTCTGAACATTGGATGG + Intergenic
1050957203 9:11679777-11679799 TCCTATCTATGAGCATGTGCGGG - Intergenic
1052601029 9:30631058-30631080 TCAAATCACTGAACATGATATGG + Intergenic
1054121268 9:61210218-61210240 TCCAATCTATGAACTTTTGGAGG - Intergenic
1054586472 9:66972290-66972312 TCCAATCTATGAACTTTTGGAGG + Intergenic
1058536020 9:105961044-105961066 TTCAATATATGAATTTGAGAGGG - Intergenic
1060313400 9:122485384-122485406 TACAATCTATGAAGATGTGGGGG - Intergenic
1203410225 Un_KI270581v1:1441-1463 TCCTATCCATGAGCATGAGGTGG - Intergenic
1187451855 X:19404372-19404394 TCCAATCCATGAACACAAGATGG - Intronic
1188348020 X:29092087-29092109 TCAAATTGATGAAAATGAGAAGG - Intronic
1192943586 X:75939715-75939737 TCCAATTCATGAGCATGGGACGG + Intergenic
1193617008 X:83701384-83701406 TTCTCTCCATGAACATGAGATGG + Intergenic
1193623894 X:83793288-83793310 TGCAATCTATTAATATGACAAGG + Intergenic
1194383249 X:93221717-93221739 TCCAATCTCAGAAGATGAGGTGG - Intergenic
1194861951 X:99010446-99010468 TTCAATCTGTGAATAAGAGAGGG - Intergenic
1195415259 X:104612797-104612819 TCCAATCAATGAGCATGGAATGG + Intronic
1195921352 X:109987013-109987035 TCCTATCTATGAGCATGGAATGG + Intergenic
1196581850 X:117389765-117389787 TCAACTCTAGGAACTTGAGATGG - Intergenic
1197402721 X:126011463-126011485 TCCTATCTATGAGCATAAAATGG - Intergenic
1198619608 X:138491593-138491615 TCCAATAAATGAACATGACAAGG + Intergenic
1198758638 X:140007698-140007720 TCTAATCTATGAAAATGCTAAGG + Intergenic
1198780118 X:140225915-140225937 TCTAATCTATGAAAATGCTAAGG - Intergenic
1199619847 X:149689478-149689500 TCCAATTTATGAACATTAGAAGG + Intronic
1199893292 X:152109529-152109551 TCCAATGTCTGGACATGGGAAGG - Intergenic
1200309966 X:155068138-155068160 ACCTATCTATGAAATTGAGATGG - Intronic
1201542233 Y:15118165-15118187 TCCTATCTATGAGCATGGAATGG - Intergenic
1202246547 Y:22826112-22826134 CCCAAGCTATGCACATGAAAAGG + Intergenic
1202399535 Y:24459860-24459882 CCCAAGCTATGCACATGAAAAGG + Intergenic
1202471245 Y:25210226-25210248 CCCAAACTATGCACATGAAAAGG - Intergenic
1202585022 Y:26414174-26414196 TTGAATCTTTGAGCATGAGATGG + Intergenic