ID: 1172351613

View in Genome Browser
Species Human (GRCh38)
Location 20:34247233-34247255
Sequence ACATGGTCCTCAATTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172351610_1172351613 26 Left 1172351610 20:34247184-34247206 CCTAAATAGCTATTTTTAGAAAA 0: 1
1: 1
2: 5
3: 122
4: 933
Right 1172351613 20:34247233-34247255 ACATGGTCCTCAATTGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172351613 Original CRISPR ACATGGTCCTCAATTGAAAC AGG Intronic
900729740 1:4248395-4248417 ACATGGTCCTCAACTTACAATGG - Intergenic
905445637 1:38027036-38027058 GCATGGTCCTCACTAGAAACAGG - Intergenic
907932725 1:59015538-59015560 ACATGGGCCTCTCTTGAAACAGG - Intergenic
908165830 1:61457301-61457323 ACATGCTCCTCTATTGAAAGGGG + Intronic
908310933 1:62882517-62882539 GCAGGATCCTCAATTGAAACTGG - Intergenic
908608296 1:65825231-65825253 ACAATGTCCACAATTGAAAAAGG - Intronic
913553594 1:119940732-119940754 ACATGTGCCACCATTGAAACAGG + Exonic
915066471 1:153229171-153229193 ACATGCTCGTCAGTTGAGACAGG - Intergenic
916649773 1:166823861-166823883 ACATGGTCCTCCATAGAATGAGG - Intergenic
916705206 1:167342136-167342158 CCATGGTCCTAAATGGGAACAGG - Intronic
917038373 1:170774603-170774625 ACAAGGTCATCAACTGAAAGTGG + Intergenic
917422093 1:174874427-174874449 AGATGGTCCTCAGTTCAAGCAGG - Intronic
917588964 1:176457609-176457631 CCGTGGTCCTAAATGGAAACAGG - Intergenic
919309147 1:195884743-195884765 ACATGGAGCTCATTTGTAACTGG + Intergenic
922033367 1:221825470-221825492 CCATGGCCCTAAATAGAAACAGG + Intergenic
1064611197 10:17104495-17104517 ACAAGTTCCTCCATTCAAACAGG + Exonic
1068213844 10:53957001-53957023 CCAAGGTCATAAATTGAAACAGG - Intronic
1069624383 10:69858700-69858722 ACATGGTCCTCAAAGGAACTTGG + Intronic
1069725145 10:70572698-70572720 ACAATGTCCTCAATTGTAAGTGG + Intergenic
1074913669 10:117935738-117935760 ACATGATCCTCCATTCAAAAAGG - Intergenic
1079137615 11:17784861-17784883 ACTTCGTGATCAATTGAAACTGG - Intergenic
1084997938 11:73001127-73001149 ACATGCTCCTAAATTCAAAGAGG + Exonic
1088291793 11:108246649-108246671 ACTTGGTCCTCATATGAAAGAGG + Intronic
1093586373 12:20841976-20841998 ACTTGAACCTCACTTGAAACTGG - Intronic
1097814575 12:64058152-64058174 AGATGGTCCTCAACTTACACTGG + Intronic
1099481607 12:83173847-83173869 CCCTGGTCCTCCATTCAAACAGG - Intergenic
1101216824 12:102593967-102593989 AGATGTTCCTCAACTGAAGCAGG + Intergenic
1101572070 12:105962855-105962877 CCATGGTCCTCACTTTGAACTGG + Intergenic
1102303137 12:111785325-111785347 ACATGGTCCTCAAATGTCTCCGG + Exonic
1106456288 13:29930200-29930222 TCATGGTCCACAATTGCCACTGG - Intergenic
1109371650 13:61428500-61428522 ACATGGGGATCAATTGCAACAGG + Intergenic
1109549049 13:63868494-63868516 ACATGTTCATCAATAGAAAACGG + Intergenic
1111722111 13:91958761-91958783 ACATGCTCCTGAATTACAACTGG + Intronic
1114671153 14:24411767-24411789 ACATGAGCCTCAACCGAAACGGG - Intronic
1115785790 14:36824400-36824422 ATTGGGTCCTCATTTGAAACTGG - Intronic
1116801385 14:49447682-49447704 GAATGGTCCTCACTTGAAGCTGG - Intergenic
1117011254 14:51472884-51472906 ACATTATCCTCAATTAAATCTGG - Intergenic
1120249613 14:82046827-82046849 AAAAGCTCATCAATTGAAACTGG - Intergenic
1125136651 15:36351545-36351567 ATATGGTGATCAATTCAAACAGG + Intergenic
1127277356 15:57458971-57458993 ACATGCACCTCCATTGAACCAGG - Intronic
1134855734 16:17517446-17517468 ACATGGTTCTCTATTAAACCAGG + Intergenic
1135884713 16:26295534-26295556 ACATGGTCCCCAGTTGAAGGAGG + Intergenic
1143265091 17:5630632-5630654 GCATGGTCCTGAATTGAGGCTGG + Intergenic
1146985163 17:37209204-37209226 ACATGGTGCTCACTAGAAACTGG + Intronic
1148290399 17:46443043-46443065 ACATGGTCCCCGACTTAAACTGG - Intergenic
1148312567 17:46660616-46660638 ACATGGTCCCCGACTTAAACTGG - Intronic
1156640392 18:39088460-39088482 ACATTCTCCACAATTGAAAGGGG + Intergenic
1157847897 18:51020473-51020495 ACATGATCCTGAATTGAATCTGG - Intronic
1158834821 18:61320043-61320065 ACAAGGACCTTAATTGAAATAGG + Intergenic
1161663557 19:5561427-5561449 CCCTGGTCCTGGATTGAAACGGG - Intergenic
1163239706 19:16053120-16053142 ACATGGTCCTCATTTCCATCTGG + Intergenic
931182481 2:59916614-59916636 ACATGGCCCTGAATGGAAAAAGG + Intergenic
932865766 2:75340133-75340155 ACATGGTCCTGACATGAGACAGG - Intergenic
933314297 2:80697682-80697704 ACAAGGTCTTCAAATAAAACAGG - Intergenic
936887301 2:117327713-117327735 ACATGGTAGTCATTTGAAACTGG - Intergenic
938164251 2:129012109-129012131 ACTTCGTCCCCAGTTGAAACTGG - Intergenic
940330656 2:152470872-152470894 ATATGGTTCTCATTTGAAAGTGG + Intronic
940429218 2:153568470-153568492 ACATGGCCATCAAGTGATACTGG + Intergenic
943711062 2:191095495-191095517 ACATGCTCCTGAATGGACACTGG + Intronic
944522085 2:200581989-200582011 ACATGGTCCCAAATTTAAAAAGG - Intronic
946363327 2:219232811-219232833 ACATAGTCTTGAATTGAAACTGG + Intronic
948495679 2:238347212-238347234 AAATGGTACTAAATAGAAACAGG - Intronic
1171292424 20:23989957-23989979 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1171292626 20:23990884-23990906 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1172351613 20:34247233-34247255 ACATGGTCCTCAATTGAAACAGG + Intronic
1173229868 20:41185730-41185752 AAATGGTCCTTAATTGCAGCTGG + Intronic
1175473725 20:59253803-59253825 ACGTGGTCCTCAATGAAAACAGG - Intronic
1175752150 20:61506399-61506421 ACCTGGTTCTCAATTGTAGCTGG + Intronic
1180823493 22:18847718-18847740 ACTTTGTCCTCACTTGCAACAGG + Exonic
1180850590 22:19018116-19018138 ACTTTGTCCTCACTTGCAACAGG - Intergenic
1181123918 22:20690817-20690839 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1181189046 22:21125898-21125920 ACTTTGTCCTCACTTGCAACAGG - Exonic
1181189250 22:21126828-21126850 ACTTTGTCCTCACTTGCAACAGG - Exonic
1181209950 22:21283667-21283689 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1181210154 22:21284597-21284619 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1181399369 22:22642348-22642370 ACTTTGTCCTCACTTGCAACAGG - Intergenic
1181399567 22:22643277-22643299 ACTTTGTCCTCACTTGCAACAGG - Intergenic
1181649852 22:24252791-24252813 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1181650049 22:24253720-24253742 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1181707325 22:24657026-24657048 ACTTTGTCCTCACTTGCAACAGG - Intergenic
1181707523 22:24657955-24657977 ACTTTGTCCTCACTTGCAACAGG - Intergenic
1181962455 22:26632552-26632574 ACTTAGTCTTCAAGTGAAACAGG - Intergenic
1203216795 22_KI270731v1_random:10836-10858 ACTTTGTCCTCACTTGCAACAGG - Intergenic
1203216996 22_KI270731v1_random:11766-11788 ACTTTGTCCTCACTTGCAACAGG - Intergenic
1203273634 22_KI270734v1_random:73624-73646 ACTTTGTCCTCACTTGCAACAGG + Intergenic
1203273834 22_KI270734v1_random:74554-74576 ACTTTGTCCTCACTTGCAACAGG + Intergenic
957322622 3:78651893-78651915 ACTTGGTCCTCAGGTGACACAGG + Exonic
958887760 3:99746783-99746805 ACATGGTCATCAATTCAGGCAGG + Intronic
969830222 4:9790028-9790050 CCATTGTCCTCATTTGAAAAAGG + Intronic
970211943 4:13718976-13718998 ACATTGTCAACAATTGAAACAGG - Intergenic
972716069 4:41647417-41647439 ACTTGGTCCTCAAATGAGACAGG + Intronic
974888713 4:67852270-67852292 ACAGGGTCCTCTATGGAAACCGG - Intronic
975374275 4:73624867-73624889 ATATGTTCCTCAATTGAAACAGG - Intergenic
977076759 4:92462857-92462879 ACATGGCCCTCCATAGAAAAGGG - Intronic
977675151 4:99739432-99739454 ACATGTTCACAAATTGAAACTGG + Intergenic
978252932 4:106655013-106655035 ACAGGATCCTCTAATGAAACAGG - Intergenic
978731793 4:112036405-112036427 ACAGAGTCCACAATTGAAAGTGG + Intergenic
982162928 4:152587829-152587851 AGATGGTCCTCAATTTACAGTGG + Intergenic
982444984 4:155479892-155479914 ACATGGTGCTAAGTTTAAACTGG + Intergenic
984304588 4:177972139-177972161 TCATGGTCCTCAAGTGAAGCAGG - Intronic
985839326 5:2294178-2294200 AGATGGTCCCACATTGAAACTGG + Intergenic
986718292 5:10539674-10539696 ACATGGTCAGCAGGTGAAACAGG + Intergenic
987708198 5:21481703-21481725 ACTTTGTCCTCACTTGCAACGGG - Intergenic
987708377 5:21482519-21482541 ACTTTGTCCTCACTTGCAACAGG - Intergenic
987708553 5:21483326-21483348 ACTTTGTCCTCACTTGCAACAGG - Intergenic
988751058 5:34190819-34190841 ACTTTGTCCTCACTTGCAACAGG + Intergenic
988751237 5:34191629-34191651 ACTTTGTCCTCACTTGCAACAGG + Intergenic
988751407 5:34192436-34192458 ACTTTGTCCTCACTTGCAACAGG + Intergenic
988751578 5:34193252-34193274 ACTTTGTCCTCACTTGCAACAGG + Intergenic
990857975 5:60292914-60292936 ACATGGTCCAAAATGGTAACAGG + Intronic
991134761 5:63168384-63168406 ACATGCTCCTGAAGAGAAACTGG - Intergenic
991519918 5:67484857-67484879 AGATGGTCCGCAATGGAAAATGG - Intergenic
991736199 5:69632743-69632765 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991736545 5:69634363-69634385 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991736722 5:69635179-69635201 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991736895 5:69635998-69636020 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991739331 5:69654031-69654053 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991758170 5:69899148-69899170 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991758344 5:69899964-69899986 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991758520 5:69900780-69900802 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991758691 5:69901593-69901615 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991758867 5:69902400-69902422 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991788469 5:70215722-70215744 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991790906 5:70233772-70233794 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991812696 5:70488382-70488404 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991812868 5:70489189-70489211 ACTTTGTCCTCATTTGCAACAGG + Intergenic
991813047 5:70490008-70490030 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991813220 5:70490827-70490849 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991815657 5:70508859-70508881 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991815827 5:70509666-70509688 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991815999 5:70510479-70510501 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991816175 5:70511289-70511311 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991816352 5:70512108-70512130 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991818792 5:70530148-70530170 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991837573 5:70775030-70775052 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991837749 5:70775846-70775868 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991837920 5:70776659-70776681 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991838096 5:70777466-70777488 ACTTTGTCCTCACTTGCAACAGG - Intergenic
991880916 5:71216086-71216108 ACTTTGTCCTCACTTGCAACAGG + Intergenic
991883353 5:71234107-71234129 ACTTTGTCCTCACTTGCAACAGG + Intergenic
994420275 5:99522714-99522736 ACTTTGTCCTCACTTGCAACAGG - Intergenic
994420445 5:99523533-99523555 ACTTTGTCCTCACTTGCAACAGG - Intergenic
994486427 5:100389962-100389984 ACTTTGTCCTCACTTGCAACAGG + Intergenic
994486598 5:100390781-100390803 ACTTTGTCCTCACTTGCAACAGG + Intergenic
994486765 5:100391600-100391622 ACTTTGTCCTCACTTGCAACAGG + Intergenic
994486930 5:100392419-100392441 ACTTTGTCCTCACTTGCAACAGG + Intergenic
996630051 5:125619976-125619998 TCATTTTCCTCATTTGAAACAGG - Intergenic
996843511 5:127874475-127874497 AAATGGTCTTAAATAGAAACAGG - Intergenic
997292979 5:132750636-132750658 ACATGGTCCCCCTCTGAAACCGG - Intronic
1004927568 6:20430737-20430759 ACATGTCCCTCTATTGCAACAGG - Intronic
1005549385 6:26898265-26898287 ACACTGTCCTCACTTGCAACAGG + Intergenic
1005549735 6:26899902-26899924 ACACTGTCCTCACTTGCAACAGG + Intergenic
1007448634 6:41926339-41926361 TCAATGTCCTCATTTGAAACTGG + Intronic
1008359701 6:50600980-50601002 AGCTGGGCCACAATTGAAACTGG - Intergenic
1008424632 6:51342835-51342857 ACATGCTACTCAATTCAATCTGG + Intergenic
1014992772 6:128102969-128102991 ACGTGGCCCTAAATGGAAACAGG + Intronic
1015484158 6:133749345-133749367 AAATTGTCTTCCATTGAAACTGG - Intergenic
1015884224 6:137899812-137899834 ATATGATCATCAGTTGAAACTGG + Intergenic
1016699132 6:147034070-147034092 AAATGGTTCTGAATTGAATCTGG + Intergenic
1017392107 6:153952073-153952095 CCATGGTCCTGAATTTTAACTGG + Intergenic
1018040200 6:159915204-159915226 ACATTGTTCTCAAAGGAAACTGG + Exonic
1021625913 7:22592946-22592968 ACATGATCTTCATTTGAACCTGG - Intronic
1021670223 7:23028390-23028412 ACATGGTCCACATTTGAATCTGG + Intergenic
1023978862 7:45054216-45054238 ACATAGGCCTCAAATGAAATGGG - Intronic
1024718946 7:52112988-52113010 GCATGGTACTAAATTTAAACTGG + Intergenic
1028218323 7:88162764-88162786 ACTGGGGCCTGAATTGAAACAGG - Intronic
1030497573 7:110318815-110318837 AGATGGCCCCAAATTGAAACAGG + Intergenic
1030981975 7:116196934-116196956 ACAGTGACCTCAATTTAAACAGG + Intergenic
1033552127 7:142457016-142457038 ACACAGTCCACAATTGTAACCGG + Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1036402826 8:8425682-8425704 ACAGGGCGCTCAATTGACACTGG + Intergenic
1039338319 8:36619443-36619465 ATATGGTCCCCAAGTAAAACTGG - Intergenic
1041065459 8:54078445-54078467 ACATGGTCCCCAATTTACAACGG + Intronic
1046279549 8:112007883-112007905 ACATGGTTCTGAACTGATACAGG - Intergenic
1046447236 8:114338929-114338951 ACATGGTAATCACTTGAACCCGG - Intergenic
1049881623 8:145068301-145068323 ACCTGATCCTCAAGTCAAACTGG - Intergenic
1051111230 9:13639159-13639181 ACATTGTCATCATTTGAAATTGG - Intergenic
1058780984 9:108335199-108335221 ACATGCTCATTATTTGAAACTGG + Intergenic
1059515876 9:114894807-114894829 ACACAGTCCTCAATTGCATCTGG - Intronic
1185961828 X:4552883-4552905 CCATGGCCCTAAATGGAAACAGG - Intergenic
1186317979 X:8391223-8391245 ACATAGACCTCCATTTAAACAGG + Intergenic
1186352215 X:8751392-8751414 ACATGGTACTCAATTCAGCCTGG + Intergenic
1189984752 X:46544208-46544230 ACATGGTCCTCCATGGCACCTGG + Intronic
1192991122 X:76457988-76458010 ACATGTTCCAAAATTGAATCTGG + Intergenic
1194091108 X:89582531-89582553 ACCTTGTTCCCAATTGAAACGGG - Intergenic