ID: 1172357904

View in Genome Browser
Species Human (GRCh38)
Location 20:34292467-34292489
Sequence AAACGGACGAGGAGTACCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357904_1172357912 3 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 104
1172357904_1172357908 -1 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357908 20:34292489-34292511 TCGCCCTTCCAGGCATACACTGG 0: 1
1: 1
2: 2
3: 2
4: 108
1172357904_1172357915 19 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG 0: 1
1: 0
2: 1
3: 24
4: 237
1172357904_1172357916 20 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1172357904_1172357917 25 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1172357904_1172357910 2 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357910 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 4
3: 25
4: 297
1172357904_1172357914 10 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357914 20:34292500-34292522 GGCATACACTGGAGGGTGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357904 Original CRISPR AAACGGACGAGGAGTACCTG TGG (reversed) Exonic
904821553 1:33248163-33248185 AAATGGGCCAGTAGTACCTGTGG - Intergenic
918431303 1:184463745-184463767 AAAAGGAAGAGGACTCCCTGTGG + Intronic
1076782909 10:132734318-132734340 AAGTGGACGAGGAATCCCTGTGG + Intronic
1077886679 11:6392151-6392173 CCACGGACGATAAGTACCTGAGG - Exonic
1082058983 11:47844647-47844669 AGAGGGAAGAGGAATACCTGTGG - Intronic
1086342121 11:85857396-85857418 AAACAGAGGAGGAGTACCTGTGG + Intronic
1097007080 12:55927393-55927415 GGACGTACGAGGAGTTCCTGGGG - Intronic
1097585890 12:61515888-61515910 AAAAGGATGAGGAGGAACTGGGG - Intergenic
1100959546 12:99947025-99947047 AAATGGCCAAGGAGGACCTGTGG + Intronic
1113675182 13:112202167-112202189 AAAGGGACCATGAGTCCCTGAGG + Intergenic
1122690613 14:103530516-103530538 AAATGGACCAGGAGGAGCTGGGG + Intronic
1126024877 15:44435999-44436021 AAAAGGAGGAGGAGGACTTGGGG - Intronic
1126599846 15:50417696-50417718 AAACGGAGGAGAAGTACCTTTGG + Intergenic
1133462071 16:5995710-5995732 AAACAGAAGAAGAGTTCCTGGGG + Intergenic
1141288262 16:82692881-82692903 CAAGGGAAGAGGATTACCTGAGG - Intronic
1153271881 18:3330609-3330631 AAAAGGAAAAGGACTACCTGGGG + Intergenic
1163443897 19:17335277-17335299 AACCGGACGAAGAGTGCATGAGG - Intronic
925070880 2:965605-965627 CAAAGGACGAGGAGGACCAGGGG - Intronic
930557268 2:52914124-52914146 AAATGGAGGAGGAGCACCTGTGG - Intergenic
931248331 2:60509322-60509344 AAAGGGAGGAGGAGAACCTGTGG + Intronic
935383608 2:102478778-102478800 AAACGGTCTGGGTGTACCTGAGG - Intronic
937704482 2:124903819-124903841 AAACGCAGGAGGATCACCTGAGG + Intronic
939189763 2:138902393-138902415 AAACAGACGAGGAGTACCTGTGG - Intergenic
939683792 2:145172003-145172025 AAAGGCAGGAGGAGAACCTGAGG - Intergenic
939802901 2:146734687-146734709 AAACGCATGAGAATTACCTGAGG - Intergenic
944062455 2:195583696-195583718 AAACAGACGAGGAGTACCAGTGG - Intronic
1172357904 20:34292467-34292489 AAACGGACGAGGAGTACCTGTGG - Exonic
1172625535 20:36344606-36344628 GAAAGGAAGATGAGTACCTGGGG - Intronic
956129745 3:66041660-66041682 AAAAGAAGGAGTAGTACCTGTGG + Intergenic
968964624 4:3763706-3763728 AAAAGGACACGGAGCACCTGGGG - Intergenic
980562602 4:134497612-134497634 AAAAGGAAGAGGAGTCCCGGAGG + Intergenic
993877112 5:93320553-93320575 AAACGGATGAGGGGAAACTGAGG + Intergenic
1002715543 5:181224415-181224437 ACATGGAGGAGGAGGACCTGAGG + Exonic
1008935893 6:56991843-56991865 AGAAGGACAAGAAGTACCTGTGG - Intronic
1012395414 6:98790717-98790739 AAAGGGAAGAGGGGGACCTGGGG + Intergenic
1019079304 6:169419061-169419083 AAAAGGATGGGGAGTAGCTGTGG + Intergenic
1025957060 7:66191137-66191159 TAAGGCACGAGGATTACCTGAGG - Intergenic
1033604999 7:142920378-142920400 AAACTGGAGAGGAGTATCTGGGG + Intronic
1048690199 8:136954598-136954620 AAAGAGAGGAGGAGTAGCTGGGG + Intergenic
1048869747 8:138787450-138787472 ACAAGGAGGAGGAGTACCTCTGG + Intronic
1049527401 8:143134677-143134699 AAGCGGACGAAGAGTAGCTGAGG + Intergenic
1061132418 9:128715363-128715385 AACTGGACCAGGAGGACCTGGGG - Exonic
1189019375 X:37318604-37318626 AAACTGAAGAGGAGTACAGGGGG - Intergenic