ID: 1172357905

View in Genome Browser
Species Human (GRCh38)
Location 20:34292478-34292500
Sequence CTGGAAGGGCGAAACGGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357905_1172357918 27 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357918 20:34292528-34292550 CAGGGCCTGGACTTCCCAACTGG 0: 1
1: 0
2: 1
3: 25
4: 176
1172357905_1172357912 -8 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 104
1172357905_1172357915 8 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG 0: 1
1: 0
2: 1
3: 24
4: 237
1172357905_1172357917 14 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1172357905_1172357910 -9 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357910 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 4
3: 25
4: 297
1172357905_1172357916 9 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1172357905_1172357914 -1 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357914 20:34292500-34292522 GGCATACACTGGAGGGTGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357905 Original CRISPR CTGGAAGGGCGAAACGGACG AGG (reversed) Exonic
903240317 1:21978383-21978405 CTGGAAGGGCGAGAGGAAGGTGG - Exonic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
915163185 1:153933694-153933716 CTGGAAGGGCTAAGTGGGCGGGG - Exonic
915939051 1:160106863-160106885 CTGGAAGGGAGAGACTGATGGGG - Intergenic
922609297 1:226912706-226912728 CTGGAGACGCGAAAGGGACGTGG - Intronic
1073996765 10:109324558-109324580 CTGGGAGGGCGGAAGGGATGGGG - Intergenic
1076067896 10:127463705-127463727 CAGGAAGGGAGAAAAGGACATGG - Intergenic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1084115642 11:67041573-67041595 CTGGAAGGGCGTAACAGGAGGGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1090191918 11:124777223-124777245 TTGGAAGGGTGAAAGGGACATGG - Intronic
1096779049 12:53981863-53981885 CTGGAAAGGCAACAAGGACGGGG - Intergenic
1103566621 12:121819381-121819403 CTGGATGGGGGACACAGACGAGG - Intronic
1104325023 12:127787484-127787506 CTGGAAGGGCGAGAAGGTGGAGG - Intergenic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1122421040 14:101577547-101577569 CTGGAAGGGCCACAGGGACAGGG + Intergenic
1127515446 15:59689155-59689177 CTGGAGGGGCGAAGAGGACGAGG - Exonic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1141632404 16:85295442-85295464 GTGGATGGGCAAAAAGGACGCGG - Intergenic
1142127328 16:88416761-88416783 CTGGAAGGGCGAAGGGTGCGTGG - Intergenic
1143595639 17:7912062-7912084 CTGGGAGGGAGGAAGGGACGAGG + Exonic
1150241201 17:63634381-63634403 TTGGAAGGCCCAAAAGGACGAGG + Intronic
1152902396 17:82950400-82950422 CTGGAAGAGCGGCACTGACGGGG + Intronic
1160760539 19:782060-782082 CAGGGAGGGAGAGACGGACGGGG - Intergenic
1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG + Intergenic
1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG + Intronic
1168150950 19:54448450-54448472 CTGGAAGGGCGCAGGGGAGGGGG - Intergenic
927946491 2:27137934-27137956 CTGGGAGGGAGAAAAGGAAGGGG + Exonic
935326573 2:101943049-101943071 CTGGAAGGTCGAAAAGGGCAGGG + Intergenic
937932632 2:127218898-127218920 CACGAAGGGCGCAACGGAGGTGG + Intronic
938220659 2:129564464-129564486 CTGGTAGGGAGAAAGGAACGAGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
944465183 2:199993603-199993625 GTGGAAGGGGGAAATTGACGAGG + Intronic
1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG + Intronic
1184093743 22:42305647-42305669 CTGGAAGGACGAATGGGAGGTGG - Intronic
1184409826 22:44320045-44320067 ATGGAAGGAAGAAAGGGACGGGG - Intergenic
950206074 3:11082159-11082181 CAGGAAGGGAGAAAGGGACTGGG - Intergenic
967081588 3:186054695-186054717 CTTGAAGGGTGAAGCGGAGGAGG - Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
999240896 5:150126849-150126871 CTGGCAGGGCTGAAGGGACGTGG - Intronic
1001948499 5:175799433-175799455 CTGGAAGGTGGAAAAGGAAGGGG + Intronic
1002570122 5:180135474-180135496 CTGGAAGGGGGAAACGTGGGCGG - Intronic
1007752542 6:44079258-44079280 CTGTAAGGGAGAAAAGGAGGAGG - Intergenic
1014398236 6:120953285-120953307 CTGGAAGGAGGAAACGGAGTGGG + Intergenic
1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG + Exonic
1024803506 7:53108566-53108588 CTGAGAGGGGGAAACGGATGAGG + Intergenic
1035518223 8:254935-254957 GTGGAAGGGAGAAATGGAAGAGG + Intergenic
1044506149 8:93022249-93022271 GTGGAAGGGGGAGACGGAGGTGG + Intergenic
1046094406 8:109540056-109540078 GTGGAAGGGCGAAAGGAAGGTGG - Intronic
1060088283 9:120720974-120720996 CTGGAAGGGCAAAATGAAAGAGG + Intergenic
1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG + Intergenic
1062617272 9:137403510-137403532 CTGGAGGGCTGAAACGGACCTGG - Intronic
1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG + Intronic