ID: 1172357910

View in Genome Browser
Species Human (GRCh38)
Location 20:34292492-34292514
Sequence CCCTTCCAGGCATACACTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357905_1172357910 -9 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357910 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 4
3: 25
4: 297
1172357904_1172357910 2 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357910 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 4
3: 25
4: 297
1172357902_1172357910 30 Left 1172357902 20:34292439-34292461 CCTTGAAGTACAGGGTCTGCTCA 0: 1
1: 0
2: 2
3: 33
4: 422
Right 1172357910 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 4
3: 25
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357910 Original CRISPR CCCTTCCAGGCATACACTGG AGG Exonic
900075198 1:809540-809562 CAGTTTCAGGCATCCACTGGAGG + Intergenic
900685099 1:3943255-3943277 CCCTCCGAGGCAGTCACTGGTGG + Intergenic
901371077 1:8798589-8798611 CCCTTACAGCCATGCTCTGGTGG + Intronic
902403740 1:16172159-16172181 CCCTTGCAGGTTTACAGTGGGGG - Intergenic
902826091 1:18975418-18975440 CAGTTTCAGGCATCCACTGGGGG + Intergenic
903231961 1:21927477-21927499 CCCCCCCTGGCCTACACTGGAGG - Intronic
904301201 1:29555993-29556015 CCCTTCCGGGCACACACTCCTGG + Intergenic
905065588 1:35178664-35178686 CCCTGCCAGGCATATAGTGAAGG - Intronic
905221041 1:36447812-36447834 CCCTTCTGGACATTCACTGGAGG - Intronic
905884415 1:41484197-41484219 CCCTTCCCTGCATGCACAGGAGG + Exonic
906034375 1:42741291-42741313 CCCTTCCTGGACTGCACTGGGGG + Intergenic
906428856 1:45738087-45738109 CAGTTTCAGGCATCCACTGGGGG + Intronic
906804190 1:48764186-48764208 GCCTTCCAGGGTTACACTGACGG - Intronic
908493692 1:64672624-64672646 CACTTTCAGGCATCCATTGGGGG + Intronic
908806197 1:67936013-67936035 CAGTTTCAGGCATCCACTGGGGG + Intergenic
909338084 1:74499588-74499610 CAGTTTCAGGCATCCACTGGGGG + Intronic
909350742 1:74650511-74650533 CGGTTTCAGGCATCCACTGGGGG - Intronic
910178979 1:84460802-84460824 CAGTTTCAGGCATTCACTGGGGG - Intergenic
910496640 1:87836648-87836670 CAGTTTCAGGCATCCACTGGCGG - Intergenic
910589883 1:88919146-88919168 CCCTTCCAGGCAGGCAATGTAGG + Intergenic
911507781 1:98774943-98774965 CAGTTTCAGGCATCCACTGGGGG - Intergenic
911681381 1:100719784-100719806 CCCTCCCAGGCACACACAGGTGG + Exonic
915026725 1:152837563-152837585 CCCTCACAGGAAGACACTGGAGG + Intergenic
916470522 1:165118487-165118509 CCCTTCCTGGCATGCTGTGGGGG - Intergenic
916895523 1:169158183-169158205 CAGTTTCAGGCATCCACTGGGGG - Intronic
919894748 1:202002460-202002482 ACCTCCCAGGCAGAAACTGGCGG - Intronic
921092238 1:211855210-211855232 CCCTAGCAGGCAGACACAGGCGG - Intergenic
921848165 1:219905850-219905872 ACCTCCCAGCCATACACAGGTGG - Intronic
922271038 1:224034439-224034461 CAGTTTCAGGCATCCACTGGAGG + Intergenic
922823951 1:228504043-228504065 CAGTTTCAGGCATCCACTGGGGG - Intergenic
924170815 1:241338614-241338636 CCTTTCCAGGCTTTCACTGTAGG + Intronic
924866654 1:247990154-247990176 CAATTTCAGGCATTCACTGGCGG + Intronic
924869132 1:248021835-248021857 CAATTTCAGGCATTCACTGGAGG + Intronic
1063138426 10:3236681-3236703 CCCTTCCAGGCCTTGGCTGGCGG + Intergenic
1063399122 10:5724783-5724805 CAGTTTCAGGCATCCACTGGGGG - Intronic
1063546449 10:6986539-6986561 CAGTTCCAGACATCCACTGGTGG + Intergenic
1064491945 10:15867537-15867559 CAGTTTCAGGCATCCACTGGGGG - Intergenic
1065369885 10:24972891-24972913 CAGTTTCAGGCATTCACTGGGGG - Intergenic
1067147274 10:43702778-43702800 GCCTTCCAGGCATAGAACGGTGG + Intergenic
1069182719 10:65383279-65383301 CAGTTCCAGGCATCCACTGGGGG + Intergenic
1070123180 10:73598178-73598200 TGGTTCCAGGCATCCACTGGAGG + Intronic
1070624911 10:78044136-78044158 CGGTTTCAGGCATCCACTGGGGG + Intronic
1070783579 10:79150748-79150770 CCTTTCCAGGCAGACAGGGGTGG - Intronic
1071120157 10:82267495-82267517 CCCTTCCAGGTACACACTAGAGG + Intronic
1073454959 10:103630949-103630971 CAGTTTCAGGCATCCACTGGGGG - Intronic
1074307229 10:112290287-112290309 CAGTTTCAGGCATCCACTGGGGG + Intronic
1074353480 10:112760184-112760206 AGCTTTCAGGCATCCACTGGCGG - Intronic
1074999051 10:118781969-118781991 CCCCTCCAGGCATACAGTGGTGG - Intergenic
1075513623 10:123092276-123092298 CCCTTCCACTCAGACCCTGGTGG - Intergenic
1075589120 10:123678685-123678707 CCCCTCCAGGCACACCCTGATGG + Intronic
1076632935 10:131862798-131862820 CGGTTTCAGGCATCCACTGGGGG - Intergenic
1076758076 10:132585537-132585559 CCGTTACAGGCGTCCACTGGGGG + Intronic
1077172954 11:1176519-1176541 CGCAGCCAGGCACACACTGGGGG - Intronic
1077222659 11:1424433-1424455 TCCCTCCAGGCAGACAGTGGAGG + Intronic
1079839102 11:25372230-25372252 CGGCTCCAGGCATTCACTGGGGG + Intergenic
1080349041 11:31360403-31360425 CACTTTTAGGCATCCACTGGGGG - Intronic
1080793747 11:35543939-35543961 CAGTTTCAGGCATCCACTGGAGG - Intergenic
1080844178 11:36012145-36012167 CGGTTTCAGGCATCCACTGGGGG - Intronic
1081478325 11:43458999-43459021 CAGTTTCAGGCATACACCGGGGG + Intronic
1081669084 11:44933373-44933395 CCCATCCTGGCATAGAGTGGGGG - Exonic
1082872807 11:57959114-57959136 CAATTTCAGGCATCCACTGGGGG - Intergenic
1083560171 11:63667184-63667206 CAGTTTCAGGCATCCACTGGGGG + Intronic
1083936350 11:65872005-65872027 CCCTTCCAGGAATGCACAGATGG - Exonic
1084885885 11:72206607-72206629 CCCTTCCAGGGAGAAACAGGAGG - Intergenic
1085920597 11:80950809-80950831 CAGTTTCAGGCATCCACTGGGGG + Intergenic
1088464699 11:110122493-110122515 CAGTTCCAGGCATCCACTGTGGG - Intronic
1088615878 11:111627516-111627538 CAGTTTCAGGCATCCACTGGAGG + Intronic
1088649242 11:111942820-111942842 CGGTTTCAGGCATCCACTGGGGG - Intronic
1088809051 11:113377615-113377637 CCTTTCCAGGTATACAGTGGTGG - Intronic
1088832410 11:113548623-113548645 CAGTTTCAGGCATCCACTGGGGG + Intergenic
1089584955 11:119504451-119504473 GCCTTCCAGGGAGACACAGGAGG + Intergenic
1090687851 11:129143931-129143953 CAGTTTCAGGCATCCACTGGGGG + Intronic
1092174851 12:6396664-6396686 CGGTTTCAGGCATCCACTGGGGG + Intergenic
1092463743 12:8709889-8709911 CAGTTTCAGGCATCCACTGGGGG + Intronic
1092894411 12:12999182-12999204 CCGTTTCAGGTATCCACTGGGGG - Intronic
1093763421 12:22935969-22935991 CAGTTTCAGGCATTCACTGGGGG - Intergenic
1096386756 12:51199407-51199429 CTCTTACAGGCATCCACTGGAGG + Intronic
1096880176 12:54661152-54661174 CAGTTTCAGGCATCCACTGGGGG + Intergenic
1099440902 12:82698574-82698596 CAGTTTCAGGCATACACTGGGGG - Intronic
1099903017 12:88735832-88735854 CGGTTTCAGGCATTCACTGGGGG - Intergenic
1100938657 12:99700336-99700358 CAGTTTCAGGCATTCACTGGGGG - Intronic
1100977114 12:100134050-100134072 CAGTTTCAGGCATCCACTGGGGG + Intronic
1101700814 12:107172080-107172102 CCATTCCAAGCACACACTGTTGG - Intergenic
1103674444 12:122644572-122644594 CCCTAGCAGGCAGACACAGGTGG - Intergenic
1104056296 12:125233415-125233437 ACCTTCCAGGCAGGCCCTGGAGG + Intronic
1106181343 13:27372115-27372137 ACCTTCCAGGCATAGCCAGGTGG + Intergenic
1106829698 13:33566348-33566370 CGGTTTCAGGCATCCACTGGGGG + Intergenic
1106851287 13:33795550-33795572 TCCTTCCAAGCTTACAGTGGTGG - Intergenic
1106922124 13:34574734-34574756 CCATTACATGCATACGCTGGTGG - Intergenic
1107365884 13:39674874-39674896 CAGTTTCAGGCATCCACTGGAGG + Intronic
1108217680 13:48201077-48201099 CCCCTCAAGGCAGGCACTGGAGG - Intergenic
1108485228 13:50917023-50917045 CCCCTCCCAGCAGACACTGGGGG - Intronic
1108753847 13:53476366-53476388 CCCTTCCAGGCAAACATAGCAGG - Intergenic
1110362141 13:74639148-74639170 CTGTTTCAGGCATTCACTGGGGG + Intergenic
1111666605 13:91277275-91277297 CAGTTTCAGGCATCCACTGGTGG - Intergenic
1112422168 13:99262308-99262330 CAGTTTCAGGCATCCACTGGGGG + Intronic
1113798819 13:113075887-113075909 CCTGTCCAGGCACACACTGCCGG - Intronic
1114809116 14:25875035-25875057 CAGTTTCAGGCATCCACTGGGGG + Intergenic
1115342449 14:32306988-32307010 CAATTTCAGGCATGCACTGGGGG - Intergenic
1116395573 14:44445009-44445031 CACTTTCAGGCATACACTGGGGG + Intergenic
1117790951 14:59341643-59341665 CAGTTTCAGGCATCCACTGGGGG + Intronic
1119747976 14:77058067-77058089 CCCTTCAATACCTACACTGGAGG + Intergenic
1120070286 14:80095121-80095143 CATTTTCAGGCATTCACTGGGGG + Intergenic
1120855434 14:89207974-89207996 CCCAACCAGGCATGCACTGAAGG - Intronic
1120927512 14:89812330-89812352 CCCATCCAGGAATACACACGTGG - Intronic
1121740660 14:96249952-96249974 CAGTTTCAGGCATCCACTGGGGG + Intronic
1122152212 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG + Intergenic
1122345445 14:101055878-101055900 CCCTTACAGGAATTCTCTGGAGG - Intergenic
1125361403 15:38868103-38868125 CAGTTTCAGGCATTCACTGGGGG + Intergenic
1125910183 15:43430673-43430695 CAGTTTCAGGCATCCACTGGGGG - Intronic
1126385415 15:48088832-48088854 CAGTTTCAGGCATCCACTGGGGG + Intergenic
1127490479 15:59457506-59457528 CGGTTTCAGGCATCCACTGGGGG + Intronic
1127542768 15:59958707-59958729 CAGTTTCAGGCATTCACTGGGGG + Intergenic
1128921871 15:71618303-71618325 CACTTCCAGGTATACACTTTAGG + Intronic
1130059906 15:80561992-80562014 CAATTCCAAGCATCCACTGGGGG + Intronic
1130658506 15:85810844-85810866 GCGTTTCAGGCATTCACTGGGGG + Intergenic
1130767303 15:86883941-86883963 CAGTTTCAGGCATCCACTGGGGG - Intronic
1132222792 15:100117411-100117433 CCCCCCCAGGTATACTCTGGAGG + Intronic
1134608209 16:15587500-15587522 CCCCTCCAGGCACACACCTGAGG - Exonic
1135057358 16:19241804-19241826 CCCATCCAGTCATACAAGGGTGG + Intronic
1135257084 16:20949559-20949581 CAGTTTCAGGCATCCACTGGGGG + Intronic
1135276092 16:21113928-21113950 CGGTTTCAGGCATTCACTGGGGG - Intronic
1138254334 16:55540759-55540781 CAGTTTCAGGCATTCACTGGGGG - Intronic
1139033543 16:62915099-62915121 CAGTTCCAGACATTCACTGGGGG + Intergenic
1140397383 16:74640057-74640079 CGGTTTCAGGCATTCACTGGGGG + Intronic
1141224960 16:82106132-82106154 CTGTTTCAGGCATTCACTGGGGG - Intergenic
1143237124 17:5412481-5412503 CAGTTTCAGGCATTCACTGGGGG + Intronic
1144609988 17:16702628-16702650 CACTTCCAGGCATTCACTGGGGG - Intronic
1144902756 17:18612788-18612810 CTGTTCCAGGCATTCACTGGGGG + Intergenic
1144928304 17:18833190-18833212 CAGTTCCAGGCATTCACTGGGGG - Intergenic
1145039431 17:19566238-19566260 CGATTTCAGGCATCCACTGGGGG + Intronic
1145129811 17:20333957-20333979 CAGTTCCAGGCATTCACTGGGGG - Intergenic
1145187672 17:20809281-20809303 CAGTTTCAGGTATACACTGGAGG + Intergenic
1145194932 17:20883990-20884012 CAGTTCCAGGCATTCACTGGGGG + Intronic
1146465179 17:33080484-33080506 CAGTTTCAGGCATCCACTGGTGG - Intronic
1146851308 17:36224133-36224155 CAGTTTCAGGTATACACTGGAGG - Intronic
1146867220 17:36348006-36348028 CAGTTTCAGGTATACACTGGAGG - Intronic
1147070095 17:37948617-37948639 CAGTTTCAGGTATACACTGGAGG - Intergenic
1147081616 17:38028143-38028165 CAGTTTCAGGTATACACTGGAGG - Intronic
1147097567 17:38152113-38152135 CAGTTTCAGGTATACACTGGAGG - Intergenic
1150079268 17:62222233-62222255 CAGTTTCAGGTATACACTGGAGG - Intergenic
1150494555 17:65597340-65597362 CCCGTCCAGTCTCACACTGGAGG + Intronic
1151771451 17:76165135-76165157 CAGTTTCAGGCATCCACTGGGGG + Intronic
1156161056 18:34358792-34358814 CAGTTTCAGGCATCCACTGGAGG + Intergenic
1157774282 18:50379469-50379491 CCCTTCCACACACACACTGAAGG + Intronic
1159598329 18:70404780-70404802 CAGTTGCAGGCATTCACTGGGGG - Intergenic
1162931066 19:13958072-13958094 CCCTTCCTGGTATAGATTGGGGG - Intronic
926255153 2:11187451-11187473 TGATTCCAGGCATCCACTGGGGG + Intronic
928299179 2:30110558-30110580 CAGTTTCAGGCATTCACTGGGGG - Intergenic
928787892 2:34912607-34912629 CAGTTTCAGGCATTCACTGGTGG + Intergenic
930479124 2:51925090-51925112 CAGTTTCAGGCATCCACTGGGGG - Intergenic
930771957 2:55138004-55138026 CCCTTCCAGGCATGGTTTGGAGG + Intergenic
931076088 2:58714309-58714331 CAGTTTCAGGCATCCACTGGAGG - Intergenic
931636661 2:64346731-64346753 CAGTTTCAGGCATCCACTGGGGG - Intergenic
933324098 2:80814414-80814436 ACGTTTCAGGCATTCACTGGGGG + Intergenic
933674988 2:85047078-85047100 CCATTTCAGCCATTCACTGGGGG + Intronic
933875544 2:86617568-86617590 CGGTTTCAGGCATCCACTGGGGG + Intronic
935308101 2:101757603-101757625 CAGTTTCAGGCATCCACTGGGGG - Intronic
935501968 2:103852374-103852396 CCTTTCTAGGCATACAATGTAGG + Intergenic
935627638 2:105184496-105184518 CCCTTGCAGCCACAGACTGGTGG + Intergenic
936787111 2:116106976-116106998 CAGTTTCAGGCATTCACTGGGGG - Intergenic
937506167 2:122539628-122539650 CTGTTTCAGGCATCCACTGGGGG + Intergenic
937790153 2:125951896-125951918 TGCTTTCAGGCATTCACTGGGGG + Intergenic
938107364 2:128542324-128542346 CAGTTTCAGGCATCCACTGGGGG + Intergenic
938607607 2:132911954-132911976 CTCCTCCAGGCAGACACTGTGGG - Intronic
938779276 2:134570401-134570423 AGCTTACAGGCATCCACTGGGGG + Intronic
940225008 2:151392072-151392094 CAGTTTCAGGCATCCACTGGGGG + Intergenic
940845209 2:158633177-158633199 CCATTTCAGGCATCCACTGATGG - Intronic
941157467 2:161996855-161996877 CAGTTTCAGGCATCCACTGGGGG + Intronic
941511139 2:166411747-166411769 CGGTTTCAGGCATCCACTGGAGG + Intronic
941865723 2:170332333-170332355 CCATTCCATGCATTCACTGAGGG - Intronic
943583207 2:189708785-189708807 CCGTTTCAGGCATCCACTGGGGG + Intronic
944715422 2:202372586-202372608 CAGTTTCAGGCATCCACTGGAGG - Intergenic
944991009 2:205235492-205235514 CAGTTTCAGGCATCCACTGGGGG - Intronic
945056285 2:205872208-205872230 CACTTTTAGGCATCCACTGGGGG - Intergenic
945104451 2:206296567-206296589 CCGTTTCAGGCATCCACTGGGGG + Intronic
945665433 2:212735412-212735434 CAGTTTCAGGCATTCACTGGGGG - Intergenic
945747663 2:213738241-213738263 CAATTTCAGGCATCCACTGGGGG - Intronic
946368235 2:219264052-219264074 CCATTTCAGGCATCCGCTGGGGG - Intronic
947481414 2:230503796-230503818 CCATTCCAGGCATTGACTGAGGG - Intronic
947941706 2:234062188-234062210 CCCTATCAGGCAGGCACTGGGGG + Intronic
948584214 2:239008949-239008971 CCCTTCCATGCCTACTCTGCAGG + Intergenic
948826923 2:240577401-240577423 CCCTTCCAGGCCAACCATGGAGG - Intronic
948989343 2:241544579-241544601 CGATTTCAGGCATCCACTGGGGG + Intergenic
949082523 2:242115244-242115266 CAGTTTCAGGCATCCACTGGAGG - Intergenic
1169254749 20:4088462-4088484 CGGTTTCAGGCATCCACTGGGGG + Intergenic
1171199915 20:23232468-23232490 CGCTTCCAGGCTTACTCAGGTGG - Intergenic
1172357910 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG + Exonic
1172409650 20:34711643-34711665 CTCTTCCAGGTATTTACTGGAGG - Exonic
1174367378 20:50064707-50064729 CCCTCCCAGGCACACACAGAGGG + Intergenic
1174879298 20:54260953-54260975 CAGTTTCAGGCATCCACTGGGGG + Intergenic
1177012666 21:15747246-15747268 CAGTTTCAGGCATCCACTGGGGG - Intronic
1177571915 21:22898146-22898168 CCATTTCAGGAATTCACTGGGGG - Intergenic
1180089918 21:45528631-45528653 CCCTTCCAGGAATCCACCTGAGG + Intronic
1180178081 21:46099721-46099743 CCCTTCCTGGCCTGCAGTGGAGG + Intronic
1180615685 22:17124450-17124472 CAGTTTCAGGCATCCACTGGAGG - Intronic
1183741601 22:39671496-39671518 CCATTTCAGGCAAACACTGGGGG + Intronic
1185072462 22:48664206-48664228 CCGTTCCAGTCAGCCACTGGTGG + Intronic
949926251 3:9044254-9044276 CAGTTTCAGGCATCCACTGGGGG - Intronic
950423372 3:12911597-12911619 CTCTTCCAGGCAGGCCCTGGGGG + Intronic
951440238 3:22714421-22714443 CGGTTTCAGGCATCCACTGGGGG + Intergenic
951642250 3:24849059-24849081 CCATTTCAGGCATCCACTGGGGG - Intergenic
951996903 3:28740816-28740838 CAGTTCCAGGCATCCACTGGGGG - Intergenic
952387731 3:32855148-32855170 TGCTTTCAGGCATCCACTGGGGG + Intronic
952863571 3:37835150-37835172 CAGTTTCAGGCATCCACTGGTGG + Intergenic
953752817 3:45622353-45622375 CAGTTTCAGGCATCCACTGGGGG - Intronic
954593928 3:51809290-51809312 CCCTTCTTGGCAGACACTGGGGG + Intergenic
954660351 3:52223748-52223770 CCCCTGCAGGCAGGCACTGGAGG - Exonic
954793724 3:53150742-53150764 GCTTTCCAGGCAGAAACTGGAGG - Intergenic
955160556 3:56461530-56461552 TCCTTCCAGGCATATGTTGGAGG - Intronic
956134894 3:66088904-66088926 CCCTTCCTGGCCTACTCTAGTGG - Intergenic
956299428 3:67754152-67754174 CATTTTCAGGCATCCACTGGGGG - Intergenic
956710922 3:72038128-72038150 CAGTTCCAGGCATCCACTGGGGG - Intergenic
960828955 3:121824183-121824205 CACCTTCAGGCATCCACTGGGGG - Intronic
961849039 3:129796422-129796444 CAGTTTCAGGCATCCACTGGGGG + Intronic
965465872 3:169030151-169030173 CAGTTTCAGGCATACACTGGAGG + Intergenic
965744376 3:171908689-171908711 CAGTTTCAGGCATGCACTGGGGG + Intronic
966874691 3:184315229-184315251 CCCTTCCTGGCCTACACTCCTGG + Intronic
968402361 4:308996-309018 CCCTTCAAAGCATACTCTGCTGG - Intergenic
968410029 4:382329-382351 CCCTTCGAAGCATACTCTGCTGG + Intronic
968817988 4:2831629-2831651 CCCTCACAGGCTGACACTGGCGG + Exonic
969442849 4:7227572-7227594 CCCTTCCAGGCAGACACACCTGG + Intronic
969828067 4:9773870-9773892 CCCTTCCAGGGAAAGACTGAAGG + Intronic
970552460 4:17196380-17196402 CAATTTCAGGCATCCACTGGGGG + Intergenic
971126853 4:23763841-23763863 CCCTTGCCCGCCTACACTGGTGG + Intronic
971670515 4:29549536-29549558 CCATCCCAGGCATCCTCTGGAGG + Intergenic
973689508 4:53410894-53410916 CAGTTTCAGGCATCCACTGGAGG + Intronic
973739299 4:53903563-53903585 AGCTTGCAGGCATCCACTGGTGG + Intronic
974064064 4:57061231-57061253 CAGTTTCAGGCATCCACTGGGGG - Intronic
975192053 4:71475945-71475967 TCCTTCTAGGCATACATTGTAGG + Intronic
976141488 4:81997726-81997748 CAGTTGCAGGCATCCACTGGGGG + Intronic
977142815 4:93396364-93396386 CAGTTTCAGGCATCCACTGGGGG - Intronic
977493595 4:97744580-97744602 CAGTTTCAGGCATCCACTGGGGG - Intronic
978743930 4:112170287-112170309 CAATTTCAGGCATCCACTGGGGG - Intronic
980690322 4:136288547-136288569 ACCTTCCAGGAATAAACTCGGGG - Intergenic
982044271 4:151426743-151426765 CACTTCCTGGCATAGGCTGGTGG + Intronic
982343376 4:154329537-154329559 CCTTTCCAGGGAGACACTGGGGG + Exonic
983919495 4:173330821-173330843 CTCTTTCAGGCATCCACTGTAGG + Intergenic
983998174 4:174211150-174211172 CATTTCCAGGCCTACACTAGAGG + Intergenic
984725587 4:183017098-183017120 CGGTTTCAGGCATCCACTGGGGG - Intergenic
985386174 4:189450605-189450627 GCCTTCCAGGGAGACACTTGAGG + Intergenic
987169716 5:15241290-15241312 CAGTTTCAGGCATCCACTGGAGG - Intergenic
988388545 5:30597985-30598007 CCCTTCCAGGAAACAACTGGTGG + Intergenic
989204550 5:38797949-38797971 CCCTAGCAGGCAGACACAGGTGG - Intergenic
989305277 5:39947979-39948001 GACTTCCAGTCACACACTGGAGG - Intergenic
990168712 5:53023100-53023122 CCTTTCCAGGCATTCACATGAGG + Intronic
990484820 5:56247834-56247856 TCCTTCCTGGCAGACTCTGGAGG + Intergenic
990862156 5:60338921-60338943 CAGTTTCAGGCCTACACTGGGGG - Intronic
993468906 5:88282619-88282641 CAGTTTCAGGCATCCACTGGGGG - Intergenic
993777566 5:92019479-92019501 CAATTTCAGGCATCCACTGGGGG - Intergenic
994953913 5:106501967-106501989 CGGTTTCAGGCATCCACTGGGGG + Intergenic
995792769 5:115909807-115909829 CAGTTTCAGGCATCCACTGGGGG - Intronic
996841803 5:127854562-127854584 CAGTTTCAGGCATCCACTGGGGG + Intergenic
997409792 5:133682139-133682161 CCCTTCCAGACAGAGACTGTGGG - Intergenic
998422104 5:141997203-141997225 CGGTTTCAGGCATTCACTGGGGG + Intronic
998792055 5:145776594-145776616 CCGTTTCAGGCACCCACTGGGGG + Intronic
1000494810 5:161968605-161968627 TCCTTTCAGGCACCCACTGGGGG - Intergenic
1002434950 5:179225525-179225547 CCCTAACAGGCAGACACAGGCGG + Intronic
1004718520 6:18243049-18243071 CAGTTTCAGGCATACACTGGGGG + Intronic
1005416800 6:25608430-25608452 CGGTTTCAGGCATCCACTGGAGG + Intronic
1008513163 6:52296194-52296216 CCATTTCAGGTATCCACTGGGGG - Intergenic
1009342455 6:62572760-62572782 CAGTTTCAGGCATGCACTGGGGG + Intergenic
1010968933 6:82243635-82243657 CAGTTTCAGGCATCCACTGGGGG + Intronic
1011541873 6:88439508-88439530 CAGTTTCAGGCATCCACTGGTGG + Intergenic
1012239259 6:96853657-96853679 CAGTTTCAGGCATCCACTGGTGG + Intergenic
1014228967 6:118880896-118880918 CACTTTCAGGCATGCACTGGGGG - Intronic
1014247288 6:119081970-119081992 CCCTAGCAGGCAGACACAGGTGG - Intronic
1015342246 6:132114361-132114383 CACTTACATGTATACACTGGGGG + Intergenic
1016835825 6:148475767-148475789 CAGTTTCAGGCATCCACTGGGGG - Intronic
1017026973 6:150189938-150189960 CCCCTCCAGGCATCTACAGGAGG + Intronic
1017140744 6:151187776-151187798 CCCTCCCAGGTATACACCTGTGG + Intergenic
1017687080 6:156924202-156924224 CACTTTCAGGCATCCACTGGGGG - Intronic
1020761553 7:12273340-12273362 CGGTTTCAGGCATCCACTGGAGG + Intergenic
1021680436 7:23125898-23125920 CAGTTTCAGGCATTCACTGGGGG - Intronic
1022075521 7:26965558-26965580 CAGTTTCAGGCATCCACTGGGGG - Intronic
1022135474 7:27443565-27443587 CAGTTTCAGGCATCCACTGGAGG - Intergenic
1022521564 7:31011240-31011262 CCCTTCCAGGCAGGAACAGGAGG - Intergenic
1022548273 7:31209543-31209565 CGGTTTCAGGCATCCACTGGGGG - Intergenic
1022875422 7:34522880-34522902 CAGTTTCAGGCATCCACTGGGGG + Intergenic
1023351021 7:39320272-39320294 CCCTTCCTGGCATCCATTGATGG - Intronic
1027188497 7:75985224-75985246 CCCTGCCAGCCACACGCTGGAGG + Intronic
1027603931 7:80275878-80275900 CAGTTTCAGGCATCCACTGGAGG - Intergenic
1027772683 7:82427067-82427089 CAGTTTCAGGCATCCACTGGGGG + Intronic
1028948367 7:96606219-96606241 CATTTGCAGGCATCCACTGGGGG + Intronic
1029339483 7:99931490-99931512 CAATTTCAGGCATCCACTGGAGG + Intergenic
1029588806 7:101493325-101493347 GCCTGCCAGGCAAACACTGAAGG - Intronic
1031642408 7:124180971-124180993 CCCTAGCAGGCAGACACAGGTGG - Intergenic
1034135455 7:148763712-148763734 TCCTCCCAGGCATACACTGGAGG - Intronic
1034381710 7:150701713-150701735 CCCTTCCAGGCAGAAGCTGGAGG - Intergenic
1034842942 7:154416628-154416650 CAGTTTCAGGCATCCACTGGGGG + Intronic
1035540444 8:431950-431972 CAGTTTCAGGCATCCACTGGAGG - Intronic
1037349041 8:17929728-17929750 CAGTTTCAGGCATGCACTGGGGG - Intronic
1038927755 8:32158946-32158968 CCCTGCCAGACAGACTCTGGTGG - Intronic
1040923293 8:52648614-52648636 CAGTTTCAGGCATCCACTGGGGG - Intronic
1042843467 8:73147640-73147662 CACTTCCAGTGATCCACTGGGGG - Intergenic
1042869144 8:73381507-73381529 CAATTTCAGGCATCCACTGGGGG - Intergenic
1044074456 8:87802035-87802057 CATTTTCAGGCATCCACTGGGGG - Intergenic
1044432879 8:92129298-92129320 CCTTGCCAGGCATACAATGCGGG + Intergenic
1045662951 8:104456996-104457018 CAGTTTCAGGCATCCACTGGAGG - Intronic
1045861572 8:106819590-106819612 CCTTTCAAGGCACACAATGGGGG - Intergenic
1046148146 8:110189241-110189263 CCCTTTCTTGGATACACTGGAGG + Intergenic
1050640596 9:7663220-7663242 CCTTTTCAGGCATTCACTGAAGG + Intergenic
1051548313 9:18301414-18301436 CGGTTTCAGGCATCCACTGGGGG - Intergenic
1051963733 9:22800897-22800919 CCCTTAGTGGCATGCACTGGTGG - Intergenic
1054737943 9:68774715-68774737 CAGTTTCAGGCATCCACTGGGGG - Intronic
1055076292 9:72218592-72218614 TCCCTGCAGGCATAAACTGGTGG + Intronic
1056719796 9:89061918-89061940 TGGTTCCAGGCATCCACTGGGGG + Intronic
1057892276 9:98878402-98878424 CAGTTTCAGGCATTCACTGGGGG + Intergenic
1058312368 9:103519763-103519785 CCATTTCAGGCATGCACTGGGGG + Intergenic
1059315173 9:113418422-113418444 CAGTTTCAGGCATCCACTGGGGG - Intronic
1060800300 9:126540279-126540301 AGGTTCCAGGCATCCACTGGGGG - Intergenic
1186746084 X:12570700-12570722 CGGTTCCAGGCATCCACTAGGGG - Intronic
1187426592 X:19182855-19182877 CCCTTCCAAGCATACTCATGTGG + Intergenic
1188014755 X:25096478-25096500 CTCTTCCAGGGAGAAACTGGGGG + Intergenic
1189004150 X:36978263-36978285 CGGTTTCAGGCATCCACTGGGGG + Intergenic
1189044826 X:37579351-37579373 TGGTTCCAGGCATCCACTGGCGG - Intronic
1189530704 X:41879284-41879306 CAGTTTCAGGCATCCACTGGGGG - Intronic
1190836032 X:54101435-54101457 CCCTTTTAGGCATAAAGTGGTGG + Intronic
1192360864 X:70438322-70438344 CTGTTTCAGGCATCCACTGGGGG - Intergenic
1192557438 X:72101657-72101679 CCCTCCCAGGCAGCCACAGGAGG - Intergenic
1195957008 X:110342255-110342277 CCATTTCAGGCATCCACTGGGGG + Intronic
1196638216 X:118029060-118029082 CGTTTTCAGGCATCCACTGGGGG + Intronic
1197233101 X:124028246-124028268 CAATTTCAGGCATCCACTGGGGG - Intronic
1197807911 X:130415113-130415135 CAGTTTCAGGCATCCACTGGGGG - Intergenic
1199296065 X:146160031-146160053 CCATTTCAGGTATCCACTGGGGG + Intergenic
1200398254 X:156003788-156003810 CCCTCCCAGACATGCAGTGGTGG - Exonic
1202392713 Y:24387875-24387897 TCCTTCCAGACAGAGACTGGAGG + Intergenic