ID: 1172357912

View in Genome Browser
Species Human (GRCh38)
Location 20:34292493-34292515
Sequence CCTTCCAGGCATACACTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357904_1172357912 3 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 104
1172357905_1172357912 -8 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357912 Original CRISPR CCTTCCAGGCATACACTGGA GGG Exonic
901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG + Intronic
901219333 1:7574274-7574296 CCTTCCAAGCAGACACTGCCAGG + Intronic
905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG + Intergenic
905884417 1:41484198-41484220 CCTTCCCTGCATGCACAGGAGGG + Exonic
906430517 1:45752036-45752058 CCGTCCAGCCTTACACTGAAAGG - Intergenic
910744954 1:90563432-90563454 CCTTTCAGGCATGCACTAAAAGG - Intergenic
911149311 1:94581823-94581845 GCATCCAGGAAGACACTGGAGGG - Intergenic
911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG + Exonic
920543049 1:206793660-206793682 GGTTCCAGGCATAAAATGGAGGG - Intergenic
922364490 1:224851325-224851347 CATTCCAAGCCTGCACTGGATGG - Intergenic
923573518 1:235137800-235137822 CCTTCCAGGCTTTTCCTGGAAGG - Intronic
923573519 1:235137800-235137822 CCTTCCAGGAAAAGCCTGGAAGG + Intronic
1070488119 10:76950567-76950589 CCATCCAGGCATGCAGTGGGTGG - Intronic
1074751270 10:116589611-116589633 ACTTCCAGGCATCCCCAGGATGG - Intergenic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1084836957 11:71809271-71809293 CAATACAGGCATACCCTGGATGG + Intergenic
1087571331 11:99930353-99930375 ACATCCAGGCATACACAGTAAGG - Intronic
1088745334 11:112799993-112800015 CATACCAGGCATACACTAAATGG - Intergenic
1091801153 12:3325447-3325469 CCTTCCAGGCATGCTGTAGAGGG - Intergenic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1098761573 12:74431843-74431865 GCTTCCAGGCATGCACGTGAAGG - Intergenic
1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG + Intronic
1106851285 13:33795549-33795571 CCTTCCAAGCTTACAGTGGTGGG - Intergenic
1107365885 13:39674875-39674897 AGTTTCAGGCATCCACTGGAGGG + Intronic
1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114114985 14:19511672-19511694 CCATCCAGGAAAACACTGGCTGG - Intergenic
1114116676 14:19629435-19629457 CCATCCAGGAAAACACTGGCTGG - Intergenic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1122345443 14:101055877-101055899 CCTTACAGGAATTCTCTGGAGGG - Intergenic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1128921872 15:71618304-71618326 ACTTCCAGGTATACACTTTAGGG + Intronic
1129930381 15:79405599-79405621 GCTTCCAGGCATTCAGTGGTCGG - Intronic
1130658507 15:85810845-85810867 CGTTTCAGGCATTCACTGGGGGG + Intergenic
1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG + Intergenic
1133001814 16:2855727-2855749 CCTTCCAGGAATACACAGGGTGG + Exonic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134381251 16:13728534-13728556 TCTTCCAAGCATACATTGGGAGG - Intergenic
1147152871 17:38528386-38528408 CCTTCCAGGCGTGCAGCGGATGG + Intergenic
1151377793 17:73703244-73703266 CACTACAGGCCTACACTGGAAGG - Intergenic
1152703741 17:81832693-81832715 CCTTCTAGGCACTCACTGGGCGG - Intronic
1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG + Intronic
1155235435 18:23813912-23813934 ACTTCCAGGCACAGAATGGATGG + Intronic
1157774284 18:50379470-50379492 CCTTCCACACACACACTGAAGGG + Intronic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1162795498 19:13085375-13085397 CCTTCCAAGCAACCACAGGACGG - Intronic
1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG + Intergenic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1168683016 19:58329812-58329834 GGTTTCAGGCATCCACTGGAGGG + Intronic
938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG + Intronic
940755005 2:157671903-157671925 GGTTTCAGGCATCCACTGGAGGG - Intergenic
942366244 2:175230874-175230896 ACTGCCAGACATACAGTGGAGGG + Intergenic
942408134 2:175677135-175677157 GGTTTCAGGCATCCACTGGAGGG - Intergenic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
947448580 2:230183955-230183977 GGTTTCAGGCATCCACTGGAGGG - Intronic
947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG + Intronic
948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG + Intergenic
948783716 2:240340257-240340279 CATCCCGGGCAGACACTGGAAGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172372857 20:34408784-34408806 ACTTCCAAGCTTACACTGTAAGG - Exonic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1174090321 20:48041778-48041800 CCCTCCATGCTTACCCTGGAAGG - Intergenic
1174711342 20:52708655-52708677 CCTTCCACGAATAAACTGCAAGG - Intergenic
1178180754 21:30158491-30158513 CTTTCCAGGGATACACAGCAAGG - Intergenic
1180089920 21:45528632-45528654 CCTTCCAGGAATCCACCTGAGGG + Intronic
1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG + Intergenic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1182714740 22:32348452-32348474 CCTTCCTGGCCTCCACTGGGAGG - Intergenic
1183271938 22:36867769-36867791 CCTTGGGGGCAGACACTGGATGG - Intronic
1183297291 22:37037791-37037813 CCCTCCAGGGCTGCACTGGAAGG - Intergenic
1183702108 22:39456856-39456878 CCGTCCACGCATACACAGAACGG + Intergenic
952944524 3:38468916-38468938 CATTCCTGGAAAACACTGGAAGG - Intronic
953884576 3:46708034-46708056 GCATCCAGGCATACACTTGGAGG - Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG + Intronic
971400501 4:26271281-26271303 GATTTCAGGCATCCACTGGAGGG + Intronic
975192055 4:71475946-71475968 CCTTCTAGGCATACATTGTAGGG + Intronic
977465172 4:97374798-97374820 CATTCCAGGCAAACAATGCAAGG + Intronic
980690320 4:136288546-136288568 CCTTCCAGGAATAAACTCGGGGG - Intergenic
983971661 4:173882886-173882908 CGTTCCAGGCAGAGACTGTAAGG + Intergenic
984065793 4:175046194-175046216 CCTTCCTGGCATACATTCCATGG - Intergenic
984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG + Intergenic
989305276 5:39947978-39948000 ACTTCCAGTCACACACTGGAGGG - Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG + Intergenic
998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG + Intergenic
1001169400 5:169404468-169404490 CCTTCCATGAATACAAGGGAAGG + Intergenic
1001756775 5:174176404-174176426 CCTTTCAGCCAGAAACTGGAAGG - Intronic
1002146609 5:177188018-177188040 TCTTCCAGGCTTAGACTGGCAGG - Intronic
1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG + Intronic
1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG + Intronic
1020761554 7:12273341-12273363 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1022022503 7:26414421-26414443 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG + Intergenic
1025659838 7:63551048-63551070 CCTCCAAGGCATGCAGTGGACGG - Intergenic
1027610430 7:80353079-80353101 TCTTCCATGCATATACTTGAAGG + Intergenic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG + Intronic
1030187273 7:106776296-106776318 CCTTCCAGGTTTTCCCTGGATGG - Intergenic
1033094642 7:138419835-138419857 GCTTTCAGGCATACAGGGGATGG - Intergenic
1035626150 8:1072120-1072142 CCGTCAAGGCACACAGTGGAGGG + Intergenic
1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1047774927 8:128062132-128062154 CCTTCCAGGCATTCACCAGTTGG - Intergenic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1047959677 8:130001847-130001869 CCTTCCAGGCAAACAGCTGATGG - Intronic
1055076294 9:72218593-72218615 CCCTGCAGGCATAAACTGGTGGG + Intronic
1057672755 9:97109093-97109115 ACTCTTAGGCATACACTGGAAGG + Intergenic
1059860677 9:118457579-118457601 CCCTCTAGTCATGCACTGGAGGG - Intergenic
1060260809 9:122072081-122072103 TCATGCAGGCCTACACTGGAAGG - Intronic
1060800299 9:126540278-126540300 GGTTCCAGGCATCCACTGGGGGG - Intergenic
1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG + Exonic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1186230621 X:7449836-7449858 CCTTCCAGGCATACCCAGCCTGG + Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic