ID: 1172357914

View in Genome Browser
Species Human (GRCh38)
Location 20:34292500-34292522
Sequence GGCATACACTGGAGGGTGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357904_1172357914 10 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357914 20:34292500-34292522 GGCATACACTGGAGGGTGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 259
1172357905_1172357914 -1 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357914 20:34292500-34292522 GGCATACACTGGAGGGTGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 259
1172357907_1172357914 -7 Left 1172357907 20:34292484-34292506 CCGTTTCGCCCTTCCAGGCATAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1172357914 20:34292500-34292522 GGCATACACTGGAGGGTGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357914 Original CRISPR GGCATACACTGGAGGGTGAG TGG Exonic
900314028 1:2048276-2048298 GGCAGAGAGTAGAGGGTGAGGGG - Intergenic
900664958 1:3809006-3809028 AGCATCCTCTGGAGGGAGAGAGG + Intergenic
900697632 1:4022077-4022099 AGCAGACTCTGGAGTGTGAGTGG - Intergenic
901238406 1:7679647-7679669 AGGATACACAGGAGGGTGACAGG + Intronic
902464601 1:16608193-16608215 GGCAGAGAATGGGGGGTGAGAGG + Intronic
902995585 1:20222443-20222465 GGCATTCACTGGGGAGGGAGAGG + Intergenic
903156207 1:21445512-21445534 GGCAGAGAATGGGGGGTGAGAGG - Intronic
903861501 1:26367537-26367559 GGCAGAGGCTGGAGGGTGGGGGG - Intronic
904042642 1:27593349-27593371 GGCATTCACTGCAGGGAGAGAGG - Intronic
904364484 1:30001749-30001771 GGCAGGCACAGGAGGGAGAGAGG - Intergenic
907475998 1:54706060-54706082 GGGATAAACTGGAGAGTCAGGGG - Intronic
907715998 1:56926688-56926710 GGCTTCAACAGGAGGGTGAGTGG + Intergenic
909107395 1:71429885-71429907 AGGATTCACTGCAGGGTGAGAGG + Intronic
914361992 1:146943854-146943876 GGCAGAGAATGGGGGGTGAGAGG - Intronic
914489633 1:148143101-148143123 GGCAGAGAATGGGGGGTGAGAGG + Intronic
915115821 1:153598841-153598863 AGCAGCCACTGGAGGGTCAGTGG - Intergenic
915671981 1:157497279-157497301 AGGATATAGTGGAGGGTGAGAGG - Intergenic
916021749 1:160798691-160798713 TGCAGACACTGGAAGGAGAGAGG - Intronic
917666095 1:177227172-177227194 GGCATGCACAGAAGGGTGTGGGG + Intronic
919096394 1:193042247-193042269 GGGTTACACTGGATGGAGAGAGG + Intronic
919858731 1:201724309-201724331 GGCATCCATTGGAGTGGGAGGGG + Intronic
919904353 1:202067794-202067816 AGAATGCACTGGAGGGTGTGCGG + Intergenic
920191916 1:204199144-204199166 GGCGTACCCTGGGGAGTGAGGGG - Intronic
920543047 1:206793653-206793675 GGCATAAAATGGAGGGTGAAAGG - Intergenic
921823028 1:219639489-219639511 CGAATGCACTGGGGGGTGAGAGG - Intergenic
922590487 1:226772114-226772136 AGAAAACAATGGAGGGTGAGGGG - Intergenic
923233872 1:232013679-232013701 GTTATAGACTGGGGGGTGAGCGG + Intronic
924448949 1:244160280-244160302 GTCAGACACTGGAGGGAGTGAGG - Intergenic
924908623 1:248484213-248484235 GGTGGACACTGCAGGGTGAGAGG - Intergenic
924915489 1:248563849-248563871 GGTGGACACTGCAGGGTGAGAGG + Intergenic
1066746664 10:38608176-38608198 AGCATTCACTGGTGGGGGAGGGG + Intergenic
1068403181 10:56556324-56556346 GGAATACATTTGAAGGTGAGAGG + Intergenic
1068702767 10:60037447-60037469 GGGATCTACTTGAGGGTGAGAGG - Intronic
1069058735 10:63871739-63871761 GGCAAACGCTGGAGGGCAAGAGG + Intergenic
1069736830 10:70662023-70662045 GGCGTATCCTGGAGGATGAGGGG + Intergenic
1069752078 10:70751406-70751428 GGCATGCACTGGGAGGGGAGGGG - Intronic
1072329527 10:94333493-94333515 GACATTCCCTGGAGGGTGACTGG - Exonic
1072363328 10:94682665-94682687 CACAGACACTGGAGAGTGAGTGG + Intergenic
1072493955 10:95936086-95936108 GGCATACTCTGCTGGGTGGGAGG - Intronic
1074255853 10:111801963-111801985 GGCAGAGATTGGAGGGTGAGAGG - Intergenic
1075182904 10:120227939-120227961 GGCATAAACAGGATGGTGAAGGG + Intergenic
1075485198 10:122816015-122816037 GGCATAAACTGGAGTACGAGAGG - Intergenic
1076139685 10:128069179-128069201 GAGCTACACTGGAGGGTGGGTGG - Intronic
1076188835 10:128468953-128468975 GTCATACAGTGGAGGGTGCTGGG + Intergenic
1076462651 10:130657030-130657052 GCACTACACTGGAGGCTGAGGGG + Intergenic
1076544667 10:131237201-131237223 GGCAAAGCTTGGAGGGTGAGGGG - Intronic
1078053395 11:7986826-7986848 AGAAGAGACTGGAGGGTGAGGGG - Intronic
1078758911 11:14236027-14236049 GGCAGACCATGGAGGGTGTGGGG + Intronic
1079927404 11:26511646-26511668 GGTATGGTCTGGAGGGTGAGGGG + Intronic
1080490013 11:32752022-32752044 GAAAGACACTGGAGTGTGAGCGG - Intronic
1080779644 11:35418942-35418964 GGCATCTACGGAAGGGTGAGGGG - Exonic
1082134057 11:48527292-48527314 AGCATACAATGGAGGAAGAGAGG + Intergenic
1082567080 11:54693678-54693700 AGCATACAATGGAGGAAGAGAGG + Intergenic
1082774042 11:57232341-57232363 GGCACACAGTGGAGAGTGAATGG - Intergenic
1084572133 11:69966210-69966232 GCCATACCCTGGAGGGAGAGAGG + Intergenic
1084593572 11:70104460-70104482 GCCAGACACTGGAGGGGGATGGG - Intronic
1084865191 11:72050112-72050134 GGCATACAATGAAAGGTGATTGG + Intronic
1085473311 11:76771930-76771952 GGCTGAGACTGGAGGGTGATGGG - Intergenic
1089362939 11:117902952-117902974 GGCACACACTGAAGGGTCTGTGG + Intronic
1089418883 11:118316070-118316092 GGCCTACAGTGGAGGGGGGGTGG - Exonic
1089786675 11:120912345-120912367 GGCGTAGACTGTAGGGTGAATGG + Intronic
1090351810 11:126112789-126112811 CGAATACACTGGAGGGGGTGGGG - Intergenic
1090471646 11:126986106-126986128 GGCATCCACTGTGGGATGAGGGG + Intronic
1097286554 12:57881735-57881757 GGCCTTCAATGGAGGGTGTGTGG - Intergenic
1098830868 12:75361012-75361034 TGCAGACACTGGAAAGTGAGTGG + Intronic
1100259014 12:92914159-92914181 GGCATGGGCTGGTGGGTGAGTGG - Intronic
1100664329 12:96734648-96734670 TTCATACACTGGAGAGAGAGAGG - Intronic
1100708595 12:97228950-97228972 GGGAGAGACTGGAGGCTGAGAGG - Intergenic
1101111587 12:101491722-101491744 GCCATACACTAGAGATTGAGGGG - Intergenic
1101475281 12:105040413-105040435 GAAATACAGTGGTGGGTGAGTGG - Intronic
1102198189 12:111039321-111039343 GTCATATACTGGAGGGTGTCAGG + Intronic
1102236313 12:111296656-111296678 GGCAAGTACTGGAGGGTCAGAGG - Intronic
1102236338 12:111296740-111296762 GGCAAGTACTGGAGGGTCAGAGG - Intronic
1102236363 12:111296824-111296846 GGCAAGTACTGGAGGGTCAGAGG - Intronic
1102236387 12:111296908-111296930 GGCAAGTACTGGAGGGTCAGAGG - Intronic
1105211091 13:18257535-18257557 GGGATACCCTGAAGGGAGAGAGG + Intergenic
1105534634 13:21253999-21254021 GGCACACACGGGAAGGAGAGAGG + Intergenic
1105721100 13:23115343-23115365 TGCAAACACTCGATGGTGAGAGG - Intergenic
1106128583 13:26921067-26921089 GGCCCACGCTGGAGGGAGAGAGG + Intergenic
1106670915 13:31904023-31904045 GCCAGACACTGGAGTGGGAGGGG - Intergenic
1107777089 13:43856185-43856207 AACACACACTGGAGGGTGAGAGG + Intronic
1108936312 13:55885574-55885596 GCCATACACAGAAGGGTGTGTGG + Intergenic
1111275118 13:85937545-85937567 GGTATTCACTGGAAAGTGAGAGG + Intergenic
1112589898 13:100753365-100753387 GTCATACACAAGAGGGAGAGAGG + Intergenic
1114517359 14:23308584-23308606 GGAATTCACTGGAGGCAGAGTGG + Intronic
1119918844 14:78427337-78427359 GCCAAACCCTGGAGGGTGGGAGG + Intronic
1120546091 14:85813233-85813255 GAAATACACTGGGGGGTGTGTGG - Intergenic
1121345983 14:93136207-93136229 GGCTTCCACTGGAGGGACAGGGG - Intergenic
1122234360 14:100323547-100323569 GGCAGATCCTGGGGGGTGAGGGG - Intronic
1122236567 14:100333715-100333737 GTCATCCACAGAAGGGTGAGGGG + Intergenic
1126304359 15:47238397-47238419 GGTATACTCTGGGGGGTGAGGGG - Intronic
1126538998 15:49801632-49801654 GGAAGCCAGTGGAGGGTGAGAGG - Intergenic
1126844511 15:52746319-52746341 GGCAGCCTCTGGAGGGGGAGGGG + Intergenic
1129031059 15:72617934-72617956 GAGTTACACTGGAGGGTGACAGG + Intergenic
1129760046 15:78124061-78124083 GGGATACACTGGGGGATGACAGG + Intronic
1129886404 15:79041046-79041068 GGCATACACTAGACTGTGAATGG - Intronic
1130112594 15:80977874-80977896 GGCATGGCCTGGAGGGTGGGGGG + Exonic
1130179088 15:81607061-81607083 GTCAGCCACTGGAGGGAGAGAGG - Intergenic
1130363300 15:83209636-83209658 GGACTAGACTTGAGGGTGAGAGG + Intergenic
1130509959 15:84581462-84581484 GAGTTACACTGGAGGGTGACAGG - Intergenic
1130585124 15:85174532-85174554 GAGTTACACTGGAGGGTGACAGG + Intergenic
1133841524 16:9414226-9414248 TGCATAGAATGGAGGGTGAGGGG - Intergenic
1136736398 16:32471457-32471479 AGCATTCACTGGTGGGGGAGGGG - Intergenic
1137298962 16:47127584-47127606 GGCATGCACTGGAGGCTGGAAGG + Intronic
1138321787 16:56120223-56120245 GGCAGGCACTGGAGGGTGAAAGG + Intergenic
1138793430 16:59937578-59937600 GGCATAGATTAGAAGGTGAGGGG - Intergenic
1140170420 16:72598760-72598782 GACAGACACTGGAGAGTGGGAGG + Intergenic
1140170437 16:72598821-72598843 GACAGACACTGGAGAGTGGGAGG + Intergenic
1140170462 16:72598940-72598962 GACAGACACTGGAGAGTGGGAGG + Intergenic
1140170469 16:72598972-72598994 GACAGACACTGGAGAGTGGGAGG + Intergenic
1140792808 16:78408473-78408495 TGCAGACAATGGAGAGTGAGTGG - Intronic
1203016672 16_KI270728v1_random:358121-358143 AGCATTCACTGGTGGGGGAGGGG + Intergenic
1203035007 16_KI270728v1_random:631279-631301 AGCATTCACTGGTGGGGGAGGGG + Intergenic
1142483215 17:231116-231138 GGCAGATCCTGGAGAGTGAGAGG - Intronic
1148758968 17:49989595-49989617 GGGACAGACAGGAGGGTGAGGGG + Intergenic
1150852613 17:68718842-68718864 GGGGTACACTGGGGGGTGGGAGG - Intergenic
1151567140 17:74904989-74905011 AGCACACACTGGAGGGACAGGGG + Intergenic
1151595700 17:75077042-75077064 GACACAGCCTGGAGGGTGAGTGG - Intergenic
1151698296 17:75729348-75729370 GGAATAAACTGCAGGGAGAGCGG + Exonic
1152239892 17:79155728-79155750 GGCAAGGACTGGAGGGTGGGTGG + Intronic
1152383525 17:79954883-79954905 GGCCTGCCCTGTAGGGTGAGTGG - Intronic
1152778575 17:82216539-82216561 GGTAAACAAGGGAGGGTGAGAGG + Intergenic
1156042682 18:32840947-32840969 GGCATTTGCTGGGGGGTGAGAGG - Intergenic
1157323130 18:46649262-46649284 TTCATACACTGGAGGAGGAGAGG + Intronic
1159942608 18:74420075-74420097 GGCAGCCCCTGGAGGGTGACTGG - Intergenic
1160325334 18:77941697-77941719 ACCACACACAGGAGGGTGAGGGG - Intergenic
1161286007 19:3468564-3468586 GGCATACAGTGGGGGGTGGGGGG + Intronic
1163411416 19:17157231-17157253 GGCTTTCACTTGAGGGTGGGAGG - Intronic
1165151611 19:33763922-33763944 GGCATACTGTGGATGGTGAAAGG + Intronic
1166542058 19:43611981-43612003 TGAAGACTCTGGAGGGTGAGTGG - Intronic
1166996344 19:46721396-46721418 GGCAGCCTCTGGTGGGTGAGGGG - Intronic
1167388905 19:49181447-49181469 GACATCCAATGGCGGGTGAGGGG + Exonic
1167600449 19:50451596-50451618 GGCCTAGACTGTAGGGTGTGAGG + Intronic
1168403799 19:56100525-56100547 AGCATACCCTGGAGGGGCAGGGG - Intronic
1168700357 19:58435183-58435205 GGCATGGAGTAGAGGGTGAGGGG - Exonic
925180988 2:1816843-1816865 GGCCTGCATTGTAGGGTGAGAGG + Intronic
926055022 2:9769414-9769436 GGCATACACAGGTGTGTGTGGGG - Intergenic
926926723 2:17995121-17995143 TGCAGACATTGAAGGGTGAGTGG - Intronic
928204440 2:29273913-29273935 GGCATGAACTGGGAGGTGAGGGG + Intronic
928499558 2:31875999-31876021 GGATTACACAGGAGGGTCAGAGG - Intronic
929381215 2:41356469-41356491 GGCATACAATGGATGGACAGGGG - Intergenic
931269290 2:60687650-60687672 GGCAGGGAATGGAGGGTGAGGGG + Intergenic
931465949 2:62486922-62486944 GGCAGACACTGGGGGGTAAAGGG + Intergenic
931841494 2:66154661-66154683 GGGATATACTTGAGGGTGAAGGG - Intergenic
932152554 2:69386882-69386904 GGCATCCACGGGCGGGAGAGGGG - Intronic
934309071 2:91847365-91847387 AGCATTCACTGGTGGGGGAGGGG + Intergenic
935215174 2:100970238-100970260 GGCACAGCCTGAAGGGTGAGGGG - Intronic
936376447 2:111945485-111945507 GTGAAACCCTGGAGGGTGAGTGG + Intronic
936451391 2:112636389-112636411 GGCACACAGTGGAGGGATAGGGG - Intergenic
938836904 2:135113256-135113278 GGGAAACACTGGCTGGTGAGTGG + Exonic
940132309 2:150396247-150396269 GGCGTACAATGTAGGGTCAGAGG + Intergenic
942359557 2:175157631-175157653 GGCCAACACTGAAGGGGGAGGGG + Intronic
944354934 2:198776319-198776341 GGGATTCACTGGATGATGAGAGG - Intergenic
946162084 2:217841498-217841520 GGCACACACTGGAGGGAGGTGGG + Intronic
946328900 2:218999038-218999060 GGCATACGCTGGATAGGGAGGGG - Intergenic
948082384 2:235216990-235217012 GGCATCCACTGGGGAGTCAGAGG + Intergenic
948369388 2:237478377-237478399 GTCATACTTTGGAGGGTGATTGG - Intergenic
948505295 2:238423892-238423914 GGCAAAGCCTGGAGGGTCAGCGG + Intergenic
948682808 2:239647966-239647988 GGCAGACTCTGGAGAGTGGGAGG + Intergenic
1168764593 20:373094-373116 GGTAAGCACTGGAGGGTGAGTGG - Intronic
1168908305 20:1424478-1424500 GCCACACACTAGAGGGAGAGAGG - Intergenic
1168995605 20:2130707-2130729 GGCATACAGGGGAGGGAGATGGG + Intronic
1169169742 20:3455316-3455338 GGAAAACACTGGTGGGAGAGGGG - Intergenic
1169750976 20:8994336-8994358 GGGGTAGAGTGGAGGGTGAGGGG - Intergenic
1172357914 20:34292500-34292522 GGCATACACTGGAGGGTGAGTGG + Exonic
1173019213 20:39253312-39253334 AGCATAGCATGGAGGGTGAGAGG - Intergenic
1174400442 20:50273186-50273208 GGCATATGGTGGAGGGTGACAGG + Intergenic
1175722275 20:61294482-61294504 GGCATAGGGTGGAGGGTGATGGG - Intronic
1179885358 21:44311985-44312007 GGCAGACCCTGCAGAGTGAGAGG - Intronic
1180765153 22:18341901-18341923 GGGATACCCTGAAGGGAGAGAGG - Intergenic
1180813877 22:18777783-18777805 GGGATACCCTGAAGGGAGAGAGG + Intergenic
1181200062 22:21212118-21212140 GGGATACCCTGAAGGGAGAGAGG + Intronic
1181701673 22:24624841-24624863 GGGATACCCTGAAGGGAGAGAGG - Intronic
1183170247 22:36182584-36182606 GGCAGAGACAGTAGGGTGAGAGG - Intergenic
1183465796 22:37979905-37979927 GGCACTCACTGGGGTGTGAGGGG - Intronic
1183712765 22:39515411-39515433 GGCAGACGCTGGAGGATGAAGGG - Exonic
1184483629 22:44762996-44763018 GAGAGAGACTGGAGGGTGAGCGG + Intronic
1184582464 22:45426741-45426763 GGCAGACACTAGGGGCTGAGGGG + Intronic
1203226774 22_KI270731v1_random:82806-82828 GGGATACCCTGAAGGGAGAGAGG - Intergenic
1203263976 22_KI270734v1_random:3470-3492 GGGATACCCTGAAGGGAGAGAGG + Intergenic
950026566 3:9824354-9824376 GCCATACACTGAAAGTTGAGTGG - Intronic
950282719 3:11720676-11720698 AGCAAACACTGGTGTGTGAGCGG - Intronic
950505040 3:13389331-13389353 GGCACACGCTGGATGTTGAGGGG - Intronic
951703629 3:25522392-25522414 GGTATACAGAGGAGGGTGATGGG - Intronic
953889772 3:46743213-46743235 GGCCTGCACTGCAGGGGGAGGGG - Intronic
954580890 3:51702431-51702453 GGCATATTCTGGGGGCTGAGTGG + Intronic
958254176 3:91305668-91305690 GCCAGACAGTGGGGGGTGAGAGG - Intergenic
959334607 3:105048424-105048446 GGCAAGTACTGGTGGGTGAGAGG - Intergenic
962432746 3:135335234-135335256 GGCAGACACATGAGGATGAGGGG - Intergenic
962473953 3:135739720-135739742 TGCATAAAGTGGAGGGTGGGAGG - Intergenic
965357562 3:167695024-167695046 GGAGTACAGTGAAGGGTGAGAGG - Intronic
968833660 4:2947155-2947177 GGGTTTCACTGAAGGGTGAGGGG + Intronic
970118482 4:12725980-12726002 GGAAAACACTGGTTGGTGAGTGG + Intergenic
970338180 4:15074937-15074959 GGCATACTCTAGAGGCTTAGAGG + Intergenic
970819410 4:20195777-20195799 TGCATTCACTGGATGGTTAGAGG + Intergenic
970965728 4:21925609-21925631 GGCAGACAATAGAGGGTGGGGGG - Intronic
973988764 4:56382165-56382187 GGCTCACAATGGAGTGTGAGGGG + Intronic
974438776 4:61890512-61890534 AGCATACAGTTGAGGGGGAGGGG + Intronic
978825915 4:113023374-113023396 GGAATGGACTGGAGGGTGGGAGG - Intronic
980953819 4:139408356-139408378 AGCATAGAATTGAGGGTGAGTGG + Intronic
981456895 4:144962843-144962865 GGGAGACCTTGGAGGGTGAGGGG - Intergenic
985669838 5:1201593-1201615 GGCAGAAGCTGGAGGGCGAGTGG - Exonic
985780427 5:1868065-1868087 GGTAAAAACTGGAGTGTGAGAGG + Intergenic
985919736 5:2960930-2960952 GGCAGACACTGGATGGTCAGTGG + Intergenic
987110772 5:14684504-14684526 GGCATCCACAGGAGGGTCTGCGG - Intronic
988882243 5:35516368-35516390 GGCATAAACTGGAAGCTGGGGGG + Intergenic
988984658 5:36605464-36605486 GACATACAGTTGAGGGTGAAAGG + Intergenic
990861411 5:60331620-60331642 GGCTTACATGGGAGGGTTAGGGG + Intronic
992198106 5:74359564-74359586 GTAGTACAGTGGAGGGTGAGGGG + Intergenic
1001947380 5:175791156-175791178 GGCATAAAGTGGAAGGAGAGTGG - Intergenic
1003376658 6:5584550-5584572 GGCACACACGGGAAGGAGAGAGG - Intronic
1003387567 6:5683274-5683296 GGCATGCTCTGTAGGGTGTGAGG + Intronic
1003542887 6:7033562-7033584 GGCATAGACTGGAGAGGAAGGGG - Intergenic
1005040727 6:21596933-21596955 GGCAGTCAGTGGAGGGCGAGTGG + Exonic
1006341424 6:33449162-33449184 GACATACACTGGAGAGGTAGAGG - Intronic
1007277650 6:40687152-40687174 GGCAAACACAGGAGGCAGAGTGG + Intergenic
1007582081 6:42965782-42965804 GGCAAACACTGAAGAGAGAGAGG + Exonic
1007871241 6:45041360-45041382 GGCATTCACTGGAGAGAGAGTGG + Intronic
1008138666 6:47806779-47806801 GGCATAGACAGGAATGTGAGAGG - Intronic
1008147418 6:47908334-47908356 GGCAAGAGCTGGAGGGTGAGGGG - Intronic
1009189652 6:60614813-60614835 GCCAGACAGTGGGGGGTGAGAGG + Intergenic
1009292780 6:61904758-61904780 GTCAGACATTGTAGGGTGAGGGG + Intronic
1012859811 6:104545624-104545646 AGGATACACTGGAGCGAGAGAGG + Intergenic
1016635748 6:146288183-146288205 GGAGTACTCTGGAGGGTGTGAGG + Intronic
1017326173 6:153143660-153143682 GGCATAAACTGGTGTGAGAGGGG - Intergenic
1019791088 7:3014362-3014384 GGAAGACGCAGGAGGGTGAGAGG + Intronic
1019863547 7:3683654-3683676 GGAAGACTCTGGAGGGTGAAAGG + Intronic
1021103619 7:16611996-16612018 GGTGGACACTGGAGAGTGAGTGG - Intronic
1022584435 7:31592728-31592750 GCCATACACTAGGAGGTGAGCGG - Intronic
1022993235 7:35728827-35728849 GACAGACACTGGAGAATGAGAGG - Intergenic
1024432792 7:49309650-49309672 GTCAGAGAGTGGAGGGTGAGAGG - Intergenic
1026219330 7:68378976-68378998 GGCAGAAAGTGGAAGGTGAGTGG - Intergenic
1029585075 7:101465409-101465431 GTCCTGCACTGGAGTGTGAGAGG - Intronic
1030873346 7:114784248-114784270 GTCATACACTGGAGTGTTACAGG - Intergenic
1031832211 7:126641763-126641785 AGCAGAGACTGGAGGGTGGGTGG + Intronic
1032216979 7:129965045-129965067 GGAATAGACTGTAGGGTGAGGGG - Intergenic
1034135451 7:148763704-148763726 GGCATACACTGGAGGTTTTGTGG - Intronic
1034439305 7:151078530-151078552 GAGATGCACTGGAGGGTGGGTGG + Intronic
1035626153 8:1072127-1072149 GGCACACAGTGGAGGGGGTGCGG + Intergenic
1037447557 8:18981569-18981591 GGCATACTCTGGAGATTGTGTGG + Intronic
1037710947 8:21355079-21355101 GGCCAACACTTAAGGGTGAGGGG + Intergenic
1039861027 8:41457822-41457844 AGCATACACTGAAGGATGAAGGG - Intergenic
1040500864 8:48003909-48003931 GGCATCCACTGGAGAGAGATGGG + Intergenic
1040516579 8:48140461-48140483 CGAATGCACTGGGGGGTGAGAGG - Intergenic
1041868003 8:62598794-62598816 GGTAGACACTGGAGGCTCAGAGG + Intronic
1042185494 8:66132590-66132612 AGCCTACACTGAACGGTGAGGGG + Intronic
1042579651 8:70262795-70262817 GGCATCCACTCGAGGATGAGGGG - Intronic
1048300467 8:133247630-133247652 GACACAGACTGGCGGGTGAGGGG + Intronic
1048573329 8:135672442-135672464 TGCAGAGACTGGAGGGAGAGAGG - Intergenic
1048735046 8:137489827-137489849 GGCACCCACTGGGGGGTGGGGGG + Intergenic
1049353914 8:142178422-142178444 GGGATACACTGGCTGGTGGGGGG - Intergenic
1049555780 8:143281193-143281215 GGCATGTACTGGAGTGAGAGTGG + Intergenic
1054782494 9:69177860-69177882 TGCATACATTGTAGTGTGAGAGG + Intronic
1054829128 9:69604193-69604215 TGCACACACTTGAGGGTAAGTGG + Intronic
1054829154 9:69604377-69604399 TGCACACACTTGAGGGTAAGTGG + Intronic
1054829183 9:69604599-69604621 GGCACACACATGAGGGTAAGTGG + Intronic
1054829208 9:69604781-69604803 GGCACACACATGAGGGTAAGTGG + Intronic
1060443410 9:123663601-123663623 ATCAAACACTGGAGGGAGAGTGG + Intronic
1060736883 9:126071654-126071676 GGGATGCACTTGAGGCTGAGGGG - Intergenic
1061085142 9:128393860-128393882 GGCTTCCACTGGAGGGTGAGGGG + Intergenic
1061116601 9:128617388-128617410 GGGATGCACTGGAGGATGGGAGG - Intronic
1061637336 9:131920835-131920857 GGCTTTCACTGGAGGGAGATGGG + Intronic
1062019953 9:134314620-134314642 GGCATACCCTGGAGAGTGCTGGG + Intergenic
1062133629 9:134913333-134913355 GGCAGACACTGGGAGGTGGGAGG - Intronic
1062597024 9:137304096-137304118 GGCCTCCCCTGGAGGGTGGGTGG + Intergenic
1186870466 X:13766366-13766388 TGCAAACACTGGTGGCTGAGTGG + Intronic
1187059842 X:15775806-15775828 GGGATACAGTGGGGGATGAGAGG - Intronic
1188179296 X:27034402-27034424 TGAACACACTGAAGGGTGAGGGG + Intergenic
1190329127 X:49224979-49225001 GGCATACTCTGTGGGGAGAGAGG + Exonic
1190576778 X:51847511-51847533 TGGATACATTGAAGGGTGAGGGG + Intronic
1196469502 X:116010114-116010136 GGTAGACGCTGGAGAGTGAGGGG - Intergenic
1196575402 X:117312195-117312217 GGCATACTCTGATGGGTGATTGG - Intergenic
1197864364 X:131002066-131002088 GGCATACACTGGAGACTGTCAGG - Intergenic
1199488812 X:148376714-148376736 GTCAAAGAGTGGAGGGTGAGAGG + Intergenic
1200112313 X:153747322-153747344 AGCATTCACTGGCGGGGGAGGGG + Intergenic
1200374730 X:155767621-155767643 GGAAAATACTGGAGGGGGAGGGG + Intergenic