ID: 1172357915

View in Genome Browser
Species Human (GRCh38)
Location 20:34292509-34292531
Sequence TGGAGGGTGAGTGGCACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357911_1172357915 -7 Left 1172357911 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 128
Right 1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG 0: 1
1: 0
2: 1
3: 24
4: 237
1172357904_1172357915 19 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG 0: 1
1: 0
2: 1
3: 24
4: 237
1172357907_1172357915 2 Left 1172357907 20:34292484-34292506 CCGTTTCGCCCTTCCAGGCATAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG 0: 1
1: 0
2: 1
3: 24
4: 237
1172357905_1172357915 8 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG 0: 1
1: 0
2: 1
3: 24
4: 237
1172357909_1172357915 -6 Left 1172357909 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG 0: 1
1: 0
2: 1
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357915 Original CRISPR TGGAGGGTGAGTGGCACATC AGG Intronic
901822106 1:11836894-11836916 GGGAGGGTCAGAAGCACATCCGG - Intronic
902334606 1:15747710-15747732 TGGAGGCAGAGTGGCAGAGCTGG + Exonic
903679773 1:25089154-25089176 TGCAGGGCGTGTGGCACAGCTGG + Intergenic
904269897 1:29343096-29343118 AGCAGGGTGAGTGGCTCATCTGG - Intergenic
904555024 1:31355922-31355944 TGGTGTGTGAGTGGCAGATTTGG + Intronic
905328735 1:37176846-37176868 GGGAGGGTGACTGGCACAGAGGG + Intergenic
907722044 1:56981228-56981250 TGGAGGGTGATTGGATCATGGGG - Intergenic
915307702 1:154990166-154990188 TGGAGGGGGTTTGGAACATCAGG - Exonic
915902691 1:159857697-159857719 TCGGGGGTGAGTGGAAGATCAGG - Intronic
916495128 1:165339785-165339807 GGAAGGGTGAGGGGCACATCTGG - Intronic
919943837 1:202306045-202306067 TGGAGGGACAGGGTCACATCAGG + Intronic
920292381 1:204932832-204932854 TTGTGGTTGAGTGGCACAGCAGG + Intronic
921456777 1:215380653-215380675 TGAAGGGTGAGTCCCAGATCAGG + Intergenic
921942396 1:220855622-220855644 GGGAGGGTGAGTGGGAGATGGGG - Intergenic
1067414230 10:46091575-46091597 TGGAGGGTGACAGTCACAGCAGG - Intergenic
1067581659 10:47450305-47450327 TGGAGGGTGACAGTCACAGCAGG + Intergenic
1067736249 10:48853293-48853315 TGAAGTGTCAGTGGCACAGCGGG - Intronic
1068224382 10:54087804-54087826 TGGAAGGTGATTGGCTCATGGGG + Intronic
1071137539 10:82469422-82469444 TTAAAGGTGAGTGGCACTTCAGG + Intronic
1074280785 10:112049567-112049589 TAAAGGGTTAGTGGCACATTTGG + Intergenic
1076076564 10:127538078-127538100 TGGGTGATGGGTGGCACATCAGG + Intergenic
1076150803 10:128160483-128160505 TGGAGGGTTTGTGGCACAGAAGG + Intergenic
1076894305 10:133302376-133302398 TGCAGGGTGAGCGCCACCTCTGG - Intronic
1076894312 10:133302406-133302428 TGCAGGGTGAGCGCCACCTCTGG - Intronic
1076894328 10:133302466-133302488 TGCAGGGTGAGCGCCACCTCTGG - Intronic
1077343012 11:2034400-2034422 TTGTGGGTGAGTGGCACGGCTGG + Intergenic
1077343024 11:2034447-2034469 TTGTGGGTGAGGGGCACAGCTGG + Intergenic
1077343034 11:2034494-2034516 TTGTGGGTGAGTGGCACAGCTGG + Intergenic
1077343046 11:2034541-2034563 TTGTGGGTGAGGGGCACAGCTGG + Intergenic
1077343060 11:2034588-2034610 TTGTGGGTGAGGGGCACAGCTGG + Intergenic
1077466356 11:2735489-2735511 GGGTGGGTGAGGGGCACTTCAGG - Intronic
1079954219 11:26842712-26842734 TGGAGGGAGATTTTCACATCTGG - Intergenic
1080383744 11:31798625-31798647 TGGGGGGTGATTGTCACCTCAGG - Intronic
1080394795 11:31880106-31880128 GGGAGGGTGAGTCTCCCATCAGG + Intronic
1080576115 11:33600631-33600653 GGGTGGGTGAGTGGGGCATCTGG - Intronic
1082859120 11:57837065-57837087 TGGATGGTGATTGGCTCATGGGG + Intergenic
1084508270 11:69584731-69584753 TGGAAGGTGATTGGATCATCGGG - Intergenic
1084533809 11:69745399-69745421 TGGAGGGCGAGTGACAGATAGGG + Intergenic
1084966288 11:72746363-72746385 TGGTGGGTCAGAGGCACAGCTGG - Intronic
1085389790 11:76176521-76176543 TGGAGACTGAGTGGCACTGCTGG - Intergenic
1085393468 11:76194426-76194448 AGGATGGTGCGAGGCACATCAGG + Intronic
1085467783 11:76735926-76735948 TGGAGGGTACGAGGCACAACAGG + Intergenic
1085811211 11:79682957-79682979 TGGGGGGTGATTGGATCATCGGG + Intergenic
1089577852 11:119459484-119459506 GGGAGGGTCACTGGCACATCAGG + Intergenic
1091235177 11:134017148-134017170 TGGATGTTGAGTGGCACTGCAGG + Intergenic
1202825998 11_KI270721v1_random:89589-89611 TTGTGGGTGAGTGGCACGGCTGG + Intergenic
1202826010 11_KI270721v1_random:89636-89658 TTGTGGGTGAGGGGCACAGCTGG + Intergenic
1202826020 11_KI270721v1_random:89683-89705 TTGTGGGTGAGTGGCACAGCTGG + Intergenic
1202826032 11_KI270721v1_random:89730-89752 TTGTGGGTGAGGGGCACAGCTGG + Intergenic
1202826046 11_KI270721v1_random:89777-89799 TTGTGGGTGAGGGGCACAGCTGG + Intergenic
1093494760 12:19743329-19743351 TTGAGGGTAAGAGGCACATGAGG + Intergenic
1094089457 12:26631948-26631970 TGGATGCTGGGTGGCACATCCGG + Exonic
1096542284 12:52314570-52314592 TGGTGGGGCAGTGGCACGTCTGG + Exonic
1099724895 12:86412858-86412880 TGGAAGGTGATTGGATCATCAGG + Intronic
1099915066 12:88882712-88882734 TGGAAGGTGATTGGCTCATGGGG + Intergenic
1100326338 12:93543289-93543311 TGGAGGGTGATTGGTACCTGTGG + Intergenic
1101141249 12:101798053-101798075 TGAAGGGTGAGTGGGAAAGCAGG - Intronic
1101486044 12:105161392-105161414 TGGAGGGAGAGTGTCATATTTGG + Intronic
1101508521 12:105371394-105371416 TGGATGGTTAGTGGGATATCTGG + Exonic
1102219961 12:111187673-111187695 AGGAGACTGAGTGGCACCTCAGG - Intronic
1102929004 12:116848513-116848535 TGGAGGGTGAGGGGTGCATATGG - Intronic
1104061179 12:125269905-125269927 TGGAATGTGGGAGGCACATCTGG - Intronic
1105239407 13:18596930-18596952 TGAAGGGTGATGGGCACCTCAGG + Intergenic
1105356693 13:19665441-19665463 GGGAGGGTGAGAGGCCCTTCTGG - Intronic
1105874307 13:24539842-24539864 TGGAGGGTGCTGGCCACATCAGG + Intergenic
1108042304 13:46350365-46350387 CGGAGGGTGAGTGCCACACCTGG + Intronic
1109147016 13:58791398-58791420 TGGAGGGTGATTGGATCATGGGG + Intergenic
1109211219 13:59538087-59538109 TGAAGGGTGAGTGCCAGCTCTGG - Intergenic
1109685866 13:65819057-65819079 TGGAAAGTGAGTGCCACACCAGG + Intergenic
1113066400 13:106377373-106377395 TGGGAGGTGAGTGGCTCATGAGG + Intergenic
1114064779 14:19052000-19052022 TGAAGGGTGATGGGCACCTCAGG + Intergenic
1114097482 14:19348002-19348024 TGAAGGGTGATGGGCACCTCAGG - Intergenic
1114229752 14:20769832-20769854 TGGAGGGTGATTGGCTCCTCAGG + Intronic
1115808481 14:37079267-37079289 TGGAGGGTGTGTGGGATACCAGG - Intronic
1116585113 14:46693815-46693837 AGGAGTGTGATTAGCACATCAGG + Intergenic
1118385174 14:65250304-65250326 TGGAGGAACAGTGGCATATCAGG + Intergenic
1119170085 14:72528360-72528382 TGAAGGTGGAGTGGCTCATCGGG + Intronic
1121282547 14:92709748-92709770 ATGATGGTGAGAGGCACATCAGG + Exonic
1123042004 14:105494120-105494142 GGAAGGGTGAGTGGCCCATGAGG - Intronic
1123491833 15:20787158-20787180 TGAAGGGTGATGGGCACCTCAGG - Intergenic
1123548339 15:21356253-21356275 TGAAGGGTGATGGGCACCTCAGG - Intergenic
1125105694 15:35968375-35968397 TGGAGGGTATGTGGCACTTAGGG - Intergenic
1125719759 15:41839629-41839651 GGGAGGGGAAGTAGCACATCAGG - Intronic
1127973867 15:63983179-63983201 GGGAGGGTGAGTGGGACAGATGG - Intronic
1128718320 15:69926707-69926729 TGGAGTGTGAATGGCACAGCAGG + Intergenic
1129709792 15:77814936-77814958 AGGAGGGTGGCTGGCACAGCTGG + Intronic
1131225942 15:90624463-90624485 AGGAGGGAGGGTGGCACATGGGG - Intronic
1131336917 15:91558069-91558091 TGGGAGGTGAGTGGATCATCGGG - Intergenic
1202956670 15_KI270727v1_random:83483-83505 TGAAGGGTGATGGGCACCTCAGG - Intergenic
1132655151 16:1038778-1038800 TGAAGGCTGAGTGGCTCTTCCGG - Intergenic
1133346923 16:5077513-5077535 TGGCGGATAACTGGCACATCAGG + Exonic
1133738536 16:8633651-8633673 GAGAGGGTGAGTGGCAGATGCGG - Intronic
1135669365 16:24362002-24362024 TGGAGGGTGAGGGGAAAATGTGG - Exonic
1135839282 16:25859906-25859928 TGGAAGGTGAGTGGCAGATAAGG + Intronic
1140003982 16:71056618-71056640 CTGACGGTGAGTGCCACATCTGG + Intronic
1140685685 16:77432361-77432383 TGGTGGGGGAGTGTCAGATCAGG + Intronic
1141101795 16:81202878-81202900 TGGAAGGTGATTGGCTCATAGGG + Intergenic
1141203540 16:81915168-81915190 TGGAGGGTGAGTAGCTCTCCAGG + Intronic
1143018778 17:3905444-3905466 TGGTGGCTCAGAGGCACATCTGG - Intronic
1143688680 17:8541126-8541148 AGGAGGAGCAGTGGCACATCGGG - Intronic
1144133311 17:12268471-12268493 TGGAGGGGCAATGTCACATCTGG + Intergenic
1146489166 17:33267791-33267813 TGTGGGGTGAGTAGCACATGAGG + Intronic
1147446012 17:40475711-40475733 GGGAGGGAGTGTGGCACACCTGG + Intergenic
1150964000 17:69947060-69947082 TGGAGAGTCAGTAGCACACCTGG - Intergenic
1151814631 17:76465668-76465690 AGGAGGGTGAGGGGCCCAACAGG - Intronic
1151904564 17:77039220-77039242 TGAAGGGTGAGTAGCATATCAGG + Intergenic
1152467382 17:80473975-80473997 TGGTGGGTCAGAGGCACATCTGG - Intronic
1154449381 18:14461691-14461713 TGAAGGGTGATGGGCACCTCAGG - Intergenic
1157258957 18:46162340-46162362 TGGAGGGTGAGCTGCAAATCTGG - Intergenic
1157524317 18:48367890-48367912 TGGAGGGAGAGTGGGAAACCTGG + Intronic
1159732341 18:72044495-72044517 TGGAGGGTGAGAGGAAGATTAGG + Intergenic
1160837349 19:1131191-1131213 TGGAGGGTGGGTGGGTCATGTGG - Intronic
1162099787 19:8332980-8333002 GGGAGGGTGGGTGGGACACCAGG - Intronic
1164706801 19:30325847-30325869 TGGAGGATAGGTGGCACAGCCGG - Intronic
1164866233 19:31606602-31606624 TGGGTGGTGAGTGGCTCATGGGG + Intergenic
1165004777 19:32795942-32795964 TGGGGGGTGATTGGCTCATGGGG - Intronic
1165220271 19:34310599-34310621 AGGAGGGTGGGTGGCTCAGCTGG - Intronic
1165565768 19:36726460-36726482 TAGAAGGTGAGTGGGAAATCTGG - Intronic
1166581484 19:43903765-43903787 TGGAGGCTGAGTGGGAAATCTGG + Intergenic
925170345 2:1746291-1746313 TAGAGTGTGAATGGCACCTCCGG - Intergenic
926316242 2:11712288-11712310 TGCAGGGTGAGTGGGAACTCTGG - Intronic
927167028 2:20333819-20333841 TGGAGGGTGACTGGATCATGGGG + Intronic
927735172 2:25514249-25514271 ATGAGGATGAGGGGCACATCAGG + Intronic
929123992 2:38506428-38506450 TGGAAGGTGATTGGCTCATGGGG + Intergenic
934299603 2:91769180-91769202 GAGAGGGTGAGTGGCGCCTCTGG - Intergenic
935239610 2:101167091-101167113 TGGAAGGTGATTGGCTCATGCGG + Intronic
935324728 2:101925717-101925739 TGGAAGGTGACTGGCACATGGGG + Intergenic
936609589 2:113988833-113988855 TGGAGGATGTGTAGAACATCAGG + Intergenic
936637153 2:114271871-114271893 TGGAGGGTGTGTGGCCCATCAGG + Intergenic
937249238 2:120512753-120512775 TGAAGGGTGGGTGGCACACGGGG - Intergenic
937511057 2:122595358-122595380 TGGTGGGTGGGTGGCACAGCTGG - Intergenic
938482055 2:131671027-131671049 TGAAGGGTGATAGGCACCTCAGG + Intergenic
943825119 2:192380708-192380730 TTGAGGGTGAGCAGCACTTCGGG + Intergenic
944443919 2:199770395-199770417 TAGTCAGTGAGTGGCACATCTGG + Intronic
948363774 2:237441263-237441285 GGAAGTGTGAGTGCCACATCAGG + Intergenic
948827397 2:240579309-240579331 AGGAGGGTGAGTGGGACATTTGG - Exonic
948933993 2:241150542-241150564 TGGAGGGTGAGCGGCCCCTGCGG + Exonic
1170018191 20:11806560-11806582 TGGAAGGTGATTGGCTCATATGG + Intergenic
1172231521 20:33339832-33339854 TGAAGGGGAAGGGGCACATCCGG - Intergenic
1172357915 20:34292509-34292531 TGGAGGGTGAGTGGCACATCAGG + Intronic
1172497064 20:35395067-35395089 TGTAGGGAGGGTGGCACACCCGG - Intronic
1173488225 20:43457293-43457315 TGGAGGGAGAGGGGAACGTCCGG + Intergenic
1175186784 20:57184222-57184244 TGGAATGTGAGTGGCACTTATGG - Intronic
1175371796 20:58497222-58497244 TGGAGGCTGAGGGGCAGATGCGG + Intronic
1176446791 21:6828683-6828705 TGAAGGGTGATGGGCACCTCAGG + Intergenic
1176824962 21:13693709-13693731 TGAAGGGTGATGGGCACCTCAGG + Intergenic
1177425106 21:20912672-20912694 TGGAAGGTGATTGGATCATCGGG - Intergenic
1178178457 21:30132181-30132203 TGGAGGGTGAGTGGATCATGGGG - Intergenic
1179303525 21:40134301-40134323 TGAAGGGTGAGTGGCAGCCCTGG - Intronic
1179545097 21:42108304-42108326 TGGAGGTTGAGTAGCACCCCAGG + Exonic
1179642394 21:42756289-42756311 TGGAGTGTGAGTGGCAAAGAGGG + Intronic
1180483267 22:15774622-15774644 TGAAGGGTGATGGGCACCTCAGG + Intergenic
1180845550 22:18979314-18979336 TGGAGGGTGAGTTCCCCAGCTGG - Intergenic
1181328937 22:22074391-22074413 TGAAGTGTGAGTGGCAAGTCAGG + Intergenic
1181691842 22:24567177-24567199 TGGAGGGTCAGAACCACATCTGG + Intronic
1182548517 22:31089163-31089185 TGGAGGGTGAGGGGCAGCCCTGG - Intronic
1182656121 22:31891468-31891490 AGAATGGTGAGTGGTACATCTGG + Intronic
1182791522 22:32957089-32957111 TGGAGTGAGACTGGCACCTCTGG + Intronic
1182794175 22:32978305-32978327 TACAGGGAGAGGGGCACATCCGG + Intronic
1185019233 22:48364123-48364145 TGGAGGTTGAGTTCCACTTCCGG + Intergenic
950927746 3:16759759-16759781 TGAAGGGTGAGTCTCAGATCAGG - Intergenic
951908495 3:27726202-27726224 TGGGGGGTGGGTGGCACATGGGG - Intergenic
953245589 3:41188441-41188463 TGGAGGGTGTGTGGAAGATATGG - Intergenic
953498037 3:43405380-43405402 TGGATGGTCAGTGGGACTTCTGG - Intronic
955441125 3:58956306-58956328 TGGAGGGTGAGTCCCAGACCAGG + Intronic
956146824 3:66198946-66198968 TGGAGGGTCAGTGCCAAGTCAGG - Intronic
960089802 3:113627795-113627817 CAGAGGGTGAGTGGAGCATCTGG - Exonic
961739252 3:129022524-129022546 TGGAGGCTGATGGCCACATCTGG - Intronic
962969161 3:140382867-140382889 TGGAAGGTGACTGGGACATAAGG - Intronic
963331831 3:143923499-143923521 TGAAGTGTGAGTGGCAGATAGGG - Intergenic
964722265 3:159779263-159779285 GGAAGGGAGATTGGCACATCAGG + Intronic
966735218 3:183181964-183181986 TGCAGGGTAAGTGGCACCTGGGG + Intronic
967159655 3:186724309-186724331 TGCAGAGTGAGTGGCACACCTGG - Intronic
967789731 3:193534161-193534183 TGGAGGTTGAGTGGGCCACCTGG + Intronic
972575686 4:40349189-40349211 AGGAGGGTGAATGTGACATCCGG - Exonic
974139952 4:57873216-57873238 TGGAAGGTGAGTGGGAAAACTGG + Intergenic
976332751 4:83850960-83850982 TGGAGGTTAAATAGCACATCTGG - Intergenic
978348720 4:107798909-107798931 TGAAGGATGAGTGGGACTTCAGG + Intergenic
978528717 4:109692979-109693001 TGGAAGGTGACTGGATCATCGGG + Intronic
980263647 4:130487390-130487412 TGGGAGGTGATTGGCACATAAGG + Intergenic
981330760 4:143506218-143506240 TGGGAGGTGACTGGCACATGGGG - Intergenic
981829125 4:148980017-148980039 TGGAGGGGGAGGGGTAAATCTGG - Intergenic
982126714 4:152190017-152190039 TGGAGGGTGACAGGCAAAGCTGG + Intergenic
986501860 5:8409371-8409393 TGGAGGATGGATGCCACATCTGG - Intergenic
987247973 5:16068676-16068698 TGCAGGGTGTGTGACAGATCTGG - Intronic
987964640 5:24855732-24855754 TGGCGGGGGTGGGGCACATCAGG - Intergenic
989489375 5:42032600-42032622 TGAAGCGTGAGTCTCACATCAGG - Intergenic
990363630 5:55047271-55047293 TGGAGGCTGAGTGGGAAACCTGG - Intergenic
990976194 5:61564002-61564024 TGGAGGGTGACTGGATCATGGGG - Intergenic
994080172 5:95699946-95699968 TGGAGTTTGAATGGGACATCTGG + Intergenic
994100015 5:95881917-95881939 TGGCTTGTGAGTGGCACAACAGG + Intergenic
994415899 5:99470142-99470164 TTGAGGGTGAGTGGTAGATGAGG + Intergenic
994464067 5:100104974-100104996 TTGAGGGTGAGTGGTAGATGAGG - Intergenic
995477926 5:112566489-112566511 TGGAGGGTGATTGGATCATGGGG - Intergenic
997047119 5:130331411-130331433 TGGAGGGTGATTGGATCATGGGG + Intergenic
1001288219 5:170438795-170438817 TGGAGGGGGAATGGGGCATCAGG - Intronic
1002858160 6:1056292-1056314 TAGAAAGTCAGTGGCACATCTGG + Intergenic
1004298573 6:14436549-14436571 TAGAGTGTCAGTGGCACATAGGG + Intergenic
1006905744 6:37532269-37532291 TGGCAGGTGAGTGGCCCAGCTGG - Intergenic
1008866495 6:56217366-56217388 TGGAGGGTGAGAGCCACATTTGG - Intronic
1010360504 6:74987553-74987575 TGGAAGGTGACTGGAACATGGGG - Intergenic
1010898328 6:81393247-81393269 TGGAGGGTGATTGGATCATGCGG + Intergenic
1012649863 6:101739445-101739467 TGGACGGTGAGTAGCACACTTGG + Intronic
1012761719 6:103310503-103310525 TGGAGGGGGAGTGACACAAGTGG - Intergenic
1012841886 6:104339312-104339334 CTGAGGGTGAATGGCATATCTGG + Intergenic
1013603934 6:111730904-111730926 AGGAAGGTCAGTGTCACATCTGG + Intronic
1014930180 6:127326166-127326188 TGGAAGGTGACTGGATCATCGGG + Intronic
1016375431 6:143415788-143415810 TGGAGGCTGAGAGACACATGGGG + Intergenic
1016452244 6:144195273-144195295 TGGTGGCTGAGAGGCACTTCAGG - Intergenic
1016599543 6:145842380-145842402 TGGAGGGTGTTTGGCATATATGG - Intergenic
1016783037 6:147980970-147980992 CGGATGGGGAGAGGCACATCAGG - Intergenic
1017013795 6:150083816-150083838 TGGTTGGTTAGTGGCACAACAGG - Intergenic
1017920280 6:158866197-158866219 TGCAGTGTGTGTTGCACATCAGG - Intergenic
1017973279 6:159331446-159331468 TGGATGGTGAGTGGGTCATGAGG - Intergenic
1020087729 7:5320571-5320593 TGGAGGGTGAGCGGGGCAACCGG - Exonic
1022080233 7:27012825-27012847 TGAAGGGTGAGTCCCACACCAGG + Intergenic
1022979733 7:35593375-35593397 TGAAGGGTCAGTGGCAAATAGGG + Intergenic
1023081126 7:36527530-36527552 TGGGGGGTGGGTTGGACATCAGG + Intronic
1024035638 7:45505704-45505726 TGGATGTTGGGTGGCACAGCGGG + Intergenic
1027390087 7:77696032-77696054 TGCAGGGTGAGAGGCACCCCAGG + Intergenic
1030311216 7:108071256-108071278 TGAAGGGTGAATGGCAGATGAGG - Intronic
1031290746 7:119930377-119930399 TGGAGGGTGAGAGGAGCATGAGG + Intergenic
1031989805 7:128190116-128190138 GAGAGGGTGAGTGGCACATGGGG + Intergenic
1032440269 7:131937455-131937477 TGGAGTGTGAATTGCCCATCAGG + Intergenic
1032909010 7:136407702-136407724 TGGAGGGTGCTGGGCATATCTGG - Intergenic
1033741311 7:144277590-144277612 TGGGGGATGAGTCTCACATCAGG + Intergenic
1033752592 7:144372024-144372046 TGGGGGATGAGTCTCACATCAGG - Exonic
1037186296 8:16067566-16067588 TGCAGGGAGAGTGACACATGTGG - Intergenic
1037244373 8:16815355-16815377 TGGGAGGTGACTGGCTCATCGGG - Intergenic
1037310003 8:17545192-17545214 AGCAGAGTGAGTGGCACAGCAGG - Intronic
1041862389 8:62529467-62529489 TGGAAGGTGATTGGGACATGAGG + Intronic
1042607103 8:70556447-70556469 TGGAGTGTGAGTGGAAAATTAGG + Intergenic
1043567366 8:81562548-81562570 TGAAGGGAGAGTTCCACATCTGG + Intergenic
1043950003 8:86298526-86298548 TGGAGGTTGAGTGGAAAATCTGG - Intronic
1048313743 8:133346737-133346759 TGGACAGGGAGTGGCACCTCAGG - Intergenic
1048841701 8:138572435-138572457 TGGAAGGTGATTAGCACATGAGG - Intergenic
1049148848 8:141021361-141021383 TGGAGGGTGAGGGGGACACAGGG + Intergenic
1049719507 8:144109126-144109148 GGGAGGCTGACTGGCAGATCCGG + Exonic
1049796725 8:144500400-144500422 TGGGGGGTGAGGGGCACACGGGG + Intronic
1051707150 9:19892804-19892826 CAGATGGTAAGTGGCACATCAGG + Intergenic
1053137942 9:35663450-35663472 TAGAGGGTGATCTGCACATCAGG - Intronic
1054991178 9:71328510-71328532 TGTAGGTTTAGTGGCAAATCTGG - Intronic
1055064339 9:72103553-72103575 TGGAGGATGAGTGTCATATAGGG + Intergenic
1055451017 9:76431554-76431576 TGGAGGCTCAGTGGGACTTCCGG - Intronic
1055751727 9:79513982-79514004 TGGAGGGTGATTGGATCATGGGG - Intergenic
1056002567 9:82232450-82232472 TGGAAGGTGATTGGAACATGAGG - Intergenic
1056984217 9:91346391-91346413 TGCTGGGTAAGTGGCACACCTGG + Intronic
1057239456 9:93395657-93395679 TGGGGGGTGATTGGCTCATGGGG - Intergenic
1060867634 9:127012652-127012674 TGGAGGCTGAGTGGCATCTGGGG + Intronic
1062059479 9:134487292-134487314 GGGAGGGTGAGTGACCCAGCTGG - Intergenic
1062219189 9:135405125-135405147 TGAAGGGTGGGTGGGACACCAGG + Intergenic
1203522400 Un_GL000213v1:55848-55870 TGAAGGGTGATGGGCACCTCAGG - Intergenic
1188644045 X:32542046-32542068 TTGAGGGAGAGTGTCACATCTGG + Intronic
1192965848 X:76175908-76175930 TGGATGGGGAGTGGCAAATAGGG + Intronic
1194698424 X:97084194-97084216 TGGCTGGTGAGTGGCAGAGCTGG - Intronic
1195065302 X:101234078-101234100 AGGAAGGTTTGTGGCACATCTGG - Intronic
1196234238 X:113261009-113261031 TGCAGGGTGAGTGGGACACTGGG + Intergenic
1198281598 X:135148253-135148275 TGGAGGGTACCTGGCACACCTGG + Intergenic
1198289361 X:135224269-135224291 TGGAGGGTACCTGGCACACCTGG - Intergenic
1198661159 X:138969057-138969079 TGGAGGGAGAGGGGCAAATTAGG + Intronic
1198818316 X:140616996-140617018 TGGAAGGTGATTAGCTCATCAGG - Intergenic
1200226498 X:154420544-154420566 TGGGGAGTGTGTGGCACAGCAGG + Intronic
1202030713 Y:20571792-20571814 TGGAAGGTGATTGGCTCATGGGG - Intergenic