ID: 1172357916

View in Genome Browser
Species Human (GRCh38)
Location 20:34292510-34292532
Sequence GGAGGGTGAGTGGCACATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357907_1172357916 3 Left 1172357907 20:34292484-34292506 CCGTTTCGCCCTTCCAGGCATAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1172357905_1172357916 9 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1172357911_1172357916 -6 Left 1172357911 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 128
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1172357904_1172357916 20 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1172357913_1172357916 -10 Left 1172357913 20:34292497-34292519 CCAGGCATACACTGGAGGGTGAG 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1172357909_1172357916 -5 Left 1172357909 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357916 Original CRISPR GGAGGGTGAGTGGCACATCA GGG Intronic
900606317 1:3525203-3525225 GGATGGCGGGTGGCACTTCATGG - Intronic
904255456 1:29251727-29251749 GGGTGGTGAGTGAGACATCAGGG + Intronic
904269896 1:29343095-29343117 GCAGGGTGAGTGGCTCATCTGGG - Intergenic
913113910 1:115679582-115679604 GGAGGGTGAGAGACACAGCCAGG + Intronic
915824337 1:159058664-159058686 GGTGGGTGAGTTGCAAACCAAGG - Intergenic
915899082 1:159833638-159833660 GGAGGCTGGGTGGGAAATCATGG - Intronic
915902690 1:159857696-159857718 CGGGGGTGAGTGGAAGATCAGGG - Intronic
916495127 1:165339784-165339806 GAAGGGTGAGGGGCACATCTGGG - Intronic
918771510 1:188567104-188567126 TGAGGGTGACTGGCATATAATGG + Intergenic
919943838 1:202306046-202306068 GGAGGGACAGGGTCACATCAGGG + Intronic
920136242 1:203771528-203771550 GGAGGGTGAGAGGCACATTCTGG - Intronic
922573062 1:226645061-226645083 GGAGGTTCAGTGACTCATCAGGG - Intronic
922763788 1:228147466-228147488 GCAGGGTGTGCGGAACATCAAGG + Exonic
1064601266 10:16995997-16996019 GGAGGGTGGGTGTCACAATAGGG - Intronic
1067414229 10:46091574-46091596 GGAGGGTGACAGTCACAGCAGGG - Intergenic
1067581660 10:47450306-47450328 GGAGGGTGACAGTCACAGCAGGG + Intergenic
1068406541 10:56597429-56597451 GGAGGGTGAGAGGAATATGAGGG - Intergenic
1069959346 10:72070434-72070456 AGAGGGTGGGGGGCACACCAGGG + Intronic
1070282957 10:75063122-75063144 GTGGGGAGTGTGGCACATCAGGG + Intergenic
1072097653 10:92198172-92198194 GGATGGTGAGTGGCAGAGCCAGG + Intronic
1073018436 10:100420778-100420800 GCAGGGTGTGTGGCACATAGTGG + Intergenic
1074133855 10:110609817-110609839 GGAGAGTGAGTGCCACATGGTGG - Intergenic
1074974638 10:118570082-118570104 GGCTGGTAAGTGGCACATCCAGG - Intergenic
1075062249 10:119265302-119265324 CGCAGGTGAGTGGCAGATCAAGG + Intronic
1075550047 10:123385684-123385706 GGAGGATGAGAGGCACATGGAGG - Intergenic
1075696206 10:124437480-124437502 GGAGGGTGAGTGGAGGATGAGGG - Intergenic
1075777939 10:125000040-125000062 GGTGGGTGGGTGGCACAAAAAGG + Intronic
1076150804 10:128160484-128160506 GGAGGGTTTGTGGCACAGAAGGG + Intergenic
1077236344 11:1483749-1483771 GGAGGCCGACTGGCACGTCATGG - Intronic
1077343035 11:2034495-2034517 TGTGGGTGAGTGGCACAGCTGGG + Intergenic
1078384997 11:10882364-10882386 AGTGGGAGAGTTGCACATCATGG - Intergenic
1078568718 11:12439355-12439377 GGAAGGTCAGTGGCAAATGAAGG - Intronic
1079251217 11:18789612-18789634 GGGGGGTGAGCAGCTCATCATGG - Intronic
1079765387 11:24386089-24386111 GAAGGGTGAGTGGAACATAGAGG - Intergenic
1080222706 11:29924469-29924491 GGAGGTTGATTGGCTCATCCTGG - Intergenic
1082847700 11:57739900-57739922 GCACGGTGATTGGCACATAATGG + Intronic
1083045105 11:59727390-59727412 AGAGGGTGAGCTGCACATGAGGG + Intronic
1084661610 11:70549642-70549664 GGAGCTTGAGTGGGACACCAGGG + Intronic
1086082813 11:82922883-82922905 GGGGGGAGAGTATCACATCAAGG - Intronic
1088886498 11:114011628-114011650 GGAAAGGGTGTGGCACATCATGG - Intergenic
1091074355 11:132601230-132601252 GGAGGCTGAGGGGCAGACCAGGG - Intronic
1091235178 11:134017149-134017171 GGATGTTGAGTGGCACTGCAGGG + Intergenic
1091366237 11:135022931-135022953 GGAGGGTGAGGGCCACATGTTGG + Intergenic
1202826021 11_KI270721v1_random:89684-89706 TGTGGGTGAGTGGCACAGCTGGG + Intergenic
1092086596 12:5768021-5768043 GAAGGGTGAGGGACACATCTCGG - Intronic
1092129121 12:6096231-6096253 GGAGGGAGAAAGGCACATGAAGG - Intronic
1092762981 12:11826272-11826294 AGAGCATGAGTGGCTCATCATGG - Intronic
1093494761 12:19743330-19743352 TGAGGGTAAGAGGCACATGAGGG + Intergenic
1096753663 12:53780835-53780857 GCAGGGTGAGTGGAACTGCATGG + Intergenic
1097955048 12:65475943-65475965 GGAGGGTGAGAGGCAGGTGAGGG - Intronic
1098472744 12:70864601-70864623 AGAGAGTGACTGGCACATAATGG - Intronic
1099724896 12:86412859-86412881 GGAAGGTGATTGGATCATCAGGG + Intronic
1102237300 12:111301837-111301859 GGTGGGTGAGACCCACATCATGG - Intronic
1102412004 12:112728188-112728210 GGTGGGAAAGTGGCAAATCATGG + Intronic
1102748261 12:115269059-115269081 GGAAGGTAAGTGGCCTATCAAGG + Intergenic
1103057798 12:117835329-117835351 GGAGGGAGGGTGGTATATCACGG + Intronic
1104095110 12:125550044-125550066 GGACAGTGTGGGGCACATCAGGG + Intronic
1104230925 12:126883253-126883275 AGAGGGTGCCTGGCACTTCAGGG + Intergenic
1104788439 12:131466751-131466773 GGAGGGTGACTGGCTCTTCCTGG - Intergenic
1104802830 12:131566385-131566407 GGTGGGTGAGTGTCCCAGCAAGG + Intergenic
1105356692 13:19665440-19665462 GGAGGGTGAGAGGCCCTTCTGGG - Intronic
1105785974 13:23749744-23749766 GGAGGGTGAGTGTGATATCAAGG - Intronic
1106095534 13:26640009-26640031 GGAGTGTGAGAGCCACATCGAGG + Intronic
1108042598 13:46353087-46353109 GGAGGAGGAGTGGGACATGATGG - Intronic
1108551299 13:51547746-51547768 GGAGTTGCAGTGGCACATCATGG - Intergenic
1108763938 13:53603946-53603968 GAAGGGTAACTGGGACATCATGG - Intergenic
1111002634 13:82205468-82205490 GGAGGATGAGGGGAACATGAAGG + Intergenic
1113066401 13:106377374-106377396 GGGAGGTGAGTGGCTCATGAGGG + Intergenic
1114907480 14:27148828-27148850 GGAAGGGTAGTGGCAGATCAAGG - Intergenic
1115461647 14:33667759-33667781 GGAGGGTCAGTGGTTAATCATGG + Intronic
1116826344 14:49676964-49676986 GGAGGATGACTGAGACATCATGG + Intronic
1118385175 14:65250305-65250327 GGAGGAACAGTGGCATATCAGGG + Intergenic
1119085181 14:71732795-71732817 GGGGTGTGAGGGGCACATCAAGG - Intronic
1121282548 14:92709749-92709771 TGATGGTGAGAGGCACATCAGGG + Exonic
1121839328 14:97119588-97119610 GGAGGGTGAGAGACACATACAGG - Intergenic
1124345340 15:28918397-28918419 GGAGGGGGCGTTGCGCATCAAGG - Intronic
1125028470 15:35053575-35053597 GGAGAAGGAGTGGCACAACATGG + Intergenic
1125719758 15:41839628-41839650 GGAGGGGAAGTAGCACATCAGGG - Intronic
1127781250 15:62318743-62318765 GGAGGGTGAGAGGAGCATCCTGG - Intergenic
1127963916 15:63909907-63909929 GGAGGATGAGTGGCAGATGGTGG - Intronic
1128520991 15:68374799-68374821 GGAGGCTGTGAGGCCCATCAGGG - Intronic
1128801113 15:70497767-70497789 GGAGGGTTGGTGGCAAGTCAAGG - Intergenic
1132730130 16:1356981-1357003 GATGGGTGAGGGACACATCAGGG + Intronic
1133738535 16:8633650-8633672 AGAGGGTGAGTGGCAGATGCGGG - Intronic
1135834875 16:25816148-25816170 GGAGGGTGAGTAGTAAATCATGG - Intronic
1135839283 16:25859907-25859929 GGAAGGTGAGTGGCAGATAAGGG + Intronic
1136025172 16:27464238-27464260 GGAAGGTGTGAGGCCCATCAGGG + Intronic
1138263282 16:55640964-55640986 GGAGGGTGCTCGGCTCATCAGGG + Intergenic
1140003983 16:71056619-71056641 TGACGGTGAGTGCCACATCTGGG + Intronic
1140685686 16:77432362-77432384 GGTGGGGGAGTGTCAGATCAGGG + Intronic
1141203541 16:81915169-81915191 GGAGGGTGAGTAGCTCTCCAGGG + Intronic
1142434877 16:90050013-90050035 GGAGGGAGAATGGCAGACCAAGG + Intergenic
1144921197 17:18766049-18766071 GGTGGGTGGGTGGCAGAACAGGG - Intronic
1146489167 17:33267792-33267814 GTGGGGTGAGTAGCACATGAGGG + Intronic
1149541624 17:57472071-57472093 CGAGGGTGAGAGGCTCAGCAGGG + Intronic
1151814630 17:76465667-76465689 GGAGGGTGAGGGGCCCAACAGGG - Intronic
1152602788 17:81273355-81273377 GGCTGGTGAGTGGCAGAGCAAGG - Intronic
1152643141 17:81457506-81457528 GGAGGGTGAGGGCCCCAGCACGG - Exonic
1156464026 18:37337283-37337305 GGAGGGTGTGAGGCTCACCATGG - Intronic
1158183855 18:54748976-54748998 GGAAGGTGAGGGGCAGAACACGG + Intronic
1159900302 18:74038900-74038922 GGGGTGTGAGAGGCAGATCAAGG + Intergenic
1160970701 19:1766572-1766594 GGAGGGTGAGTGGAAAAGGAGGG + Intronic
1162806653 19:13140735-13140757 GGAGGGTGAATGGCAGGGCAAGG - Exonic
1163105395 19:15120200-15120222 GGTGGATGAGTGACACCTCAGGG + Intronic
1165220270 19:34310598-34310620 GGAGGGTGGGTGGCTCAGCTGGG - Intronic
1165993660 19:39830272-39830294 CTAGGGTGAGTGGCCCAGCATGG + Intronic
1167129008 19:47572532-47572554 GGAGGGGGAGGGGCATGTCAAGG + Intergenic
1167427381 19:49436465-49436487 GGTGGGTGAGTGTGACGTCATGG + Intronic
1167762943 19:51460805-51460827 GGAGGGCGTGTGGGACACCACGG + Intergenic
925157697 2:1660194-1660216 GAAGGGTCAGGGACACATCATGG + Intronic
926624496 2:15079743-15079765 GGATGGTGAGTGGCACAAGGAGG - Intergenic
927049803 2:19316176-19316198 GGAGGGTGAGAGGGGCATGAGGG - Intergenic
932715689 2:74099669-74099691 GGAGGGTGCGTGGAAGAGCAGGG - Intronic
933966399 2:87432948-87432970 GGAGGGTGCATGGCAGAGCAGGG - Intergenic
934299602 2:91769179-91769201 AGAGGGTGAGTGGCGCCTCTGGG - Intergenic
934589939 2:95539176-95539198 GGAGAGTGAGTGACACATCGAGG + Intergenic
934988026 2:98901263-98901285 AGAGGCTCAGTGGCCCATCATGG - Intronic
935324729 2:101925718-101925740 GGAAGGTGACTGGCACATGGGGG + Intergenic
936327396 2:111517537-111517559 GGAGGGTGCATGGCAGAGCAGGG + Intergenic
937232593 2:120406780-120406802 GGAGAGGGTGTGGCACAGCAGGG + Intergenic
937464290 2:122116767-122116789 GAAGGGTGAGTGGAACAGGAGGG - Intergenic
942728740 2:179040159-179040181 GGAGGGAGACTGGCACATTGTGG + Intronic
946208636 2:218129466-218129488 TGAGGGTGAGGGGCCCACCAAGG - Intronic
947549240 2:231034712-231034734 GGAGGGTGGGTGGCAGAGCCAGG - Intergenic
948363775 2:237441264-237441286 GAAGTGTGAGTGCCACATCAGGG + Intergenic
948382948 2:237563794-237563816 GAACGGTGAGTTGCACATCCAGG + Intergenic
1169055488 20:2617269-2617291 GGAGGGTGGGAGGGACATGATGG - Exonic
1169146312 20:3254784-3254806 GGAGGCTGGGAGGCTCATCAAGG + Intronic
1172357916 20:34292510-34292532 GGAGGGTGAGTGGCACATCAGGG + Intronic
1173283942 20:41653945-41653967 GGAAGGTGGATGCCACATCAGGG - Intergenic
1174704163 20:52638985-52639007 GGAGGGAAAGAGGCATATCAAGG - Intergenic
1175172492 20:57090363-57090385 GGAGGGTCAGAGTCACACCAAGG + Intergenic
1175290112 20:57869944-57869966 GGAGGGAGAGGAGCACACCAAGG - Intergenic
1175707311 20:61190005-61190027 GGAGGCTGAATGGCCCATGATGG + Intergenic
1175737306 20:61396235-61396257 GGAGGGTGAGGGCCACATCCTGG + Intronic
1175955948 20:62609555-62609577 GGAGGATGTGTGTGACATCAGGG + Intergenic
1176056995 20:63154334-63154356 GGAGGGTGAGTCGCACACCTCGG + Intergenic
1177029927 21:15969711-15969733 GGAGAGTGTGTGGTACATGATGG + Intergenic
1178178456 21:30132180-30132202 GGAGGGTGAGTGGATCATGGGGG - Intergenic
1179514428 21:41897131-41897153 GCAGGGTGGGTGACACAGCAAGG + Intronic
1180599739 22:17008088-17008110 GGAGGGTGAGGGGGACGGCAGGG + Exonic
1181857301 22:25791208-25791230 GGAGGAGGAGAGGCATATCAGGG + Intronic
1182630819 22:31683876-31683898 GAAGAGTGAGTGGCACGTCCTGG - Exonic
1182727691 22:32461077-32461099 GGAAGTTGAGTGCCAGATCATGG + Intronic
1183735400 22:39642220-39642242 GGAGGGTGGGTGGCCGCTCAGGG + Intronic
1184302170 22:43568008-43568030 TGAGTGTGCCTGGCACATCATGG - Intronic
949251611 3:1991634-1991656 GGATGGTGAGTGGTGCAGCAGGG - Intergenic
950133597 3:10564674-10564696 GGTGTGTAAGTGGCACATAAAGG - Intronic
954155136 3:48681263-48681285 TGAGGGTGGGCGGCACAGCAGGG - Intronic
957515832 3:81249951-81249973 GAAGGGTCAGTGAGACATCAAGG - Intergenic
961474933 3:127140543-127140565 GGAGGGGGAGTGAGACAGCAGGG + Intergenic
962969160 3:140382866-140382888 GGAAGGTGACTGGGACATAAGGG - Intronic
963051246 3:141145886-141145908 GGAGGGTTAAAGGCACATAAGGG - Intronic
964120420 3:153177756-153177778 AGGGGGTGAGTATCACATCAAGG - Intergenic
965806388 3:172546686-172546708 GGAGGGTGACTGGATCATGATGG - Intergenic
966767877 3:183478921-183478943 GCAGGGTAAGTGGCACCTCCAGG - Intergenic
971097847 4:23428280-23428302 GGATGGAGAGTGACACATGATGG - Intergenic
971260760 4:25054668-25054690 GGAGTGGAGGTGGCACATCACGG + Intergenic
972457941 4:39272522-39272544 GGAGGGTCAGTGACACATCGAGG - Intronic
972575685 4:40349188-40349210 GGAGGGTGAATGTGACATCCGGG - Exonic
983175619 4:164585199-164585221 GGAGGGAGAGTACTACATCAAGG - Intergenic
985968205 5:3353671-3353693 GGAGGATGAGGAGCACCTCAAGG - Intergenic
994055187 5:95406631-95406653 GGGAGCTGGGTGGCACATCACGG + Intronic
994243566 5:97452097-97452119 GAAGTGTGAGTGTGACATCAGGG + Intergenic
994255803 5:97594631-97594653 GGAGGGGGAGGGGCAGGTCATGG + Intergenic
995763367 5:115587922-115587944 GCAGGGTGAGGGGCCCATAACGG + Intronic
997250620 5:132386074-132386096 GGAGAGTAAGCCGCACATCATGG + Intronic
997509949 5:134447197-134447219 GGAGGAGGAGGGGCAAATCAGGG + Intergenic
998559091 5:143154548-143154570 GGAAGGTGAGTGGGACAGCCTGG - Intronic
999106459 5:149075364-149075386 GGAGAGGAAGTAGCACATCATGG - Intergenic
999775738 5:154811794-154811816 GGAGAGTGAGTGGCCAATGAAGG + Intronic
1000930286 5:167243328-167243350 TGAGGGTGAGTGGGGCCTCATGG + Intergenic
1001288218 5:170438794-170438816 GGAGGGGGAATGGGGCATCAGGG - Intronic
1001421107 5:171587900-171587922 GGAGGGAGCCTGGAACATCAAGG + Intergenic
1001762939 5:174222754-174222776 GCAGGGTGAGTGGGCCATGAGGG + Intronic
1003204134 6:3991690-3991712 GGAGGGTGAGGGGCAGTTCCAGG - Intergenic
1007091920 6:39190102-39190124 GGAGGGAGAGTAGCAGAGCATGG - Exonic
1007171318 6:39865429-39865451 GCAGGGTGAGTGCCCCATCCAGG + Intronic
1008866494 6:56217365-56217387 GGAGGGTGAGAGCCACATTTGGG - Intronic
1010628426 6:78167853-78167875 GGAAGGTGATTGGATCATCAGGG - Intergenic
1013603935 6:111730905-111730927 GGAAGGTCAGTGTCACATCTGGG + Intronic
1017166489 6:151412893-151412915 GGGGGGTGACTGGATCATCAGGG - Intronic
1017920279 6:158866196-158866218 GCAGTGTGTGTTGCACATCAGGG - Intergenic
1018976037 6:168566839-168566861 GTAGAGTGGGTGGCACATGACGG + Intronic
1019176226 6:170160692-170160714 GGCAGGTGAGTGGCCCTTCAGGG + Intergenic
1021119801 7:16786121-16786143 GGAGGATGAGTTTCAGATCAGGG + Intergenic
1024290914 7:47803228-47803250 GGGGAGTGAGTGGCGCATCATGG + Exonic
1024531714 7:50399179-50399201 GGAGGGTAGGAGGCACAGCAAGG - Intronic
1024923597 7:54587833-54587855 GGAGGTTAAGTGGCTCATCACGG - Intergenic
1026946178 7:74317663-74317685 GGAAGGTACGTGGCACACCAAGG + Exonic
1029192737 7:98783347-98783369 GGTGGGTGTGTGGCATAACAAGG + Intergenic
1031090340 7:117347402-117347424 AGAGGGAGACTGCCACATCAAGG - Intergenic
1031989806 7:128190117-128190139 AGAGGGTGAGTGGCACATGGGGG + Intergenic
1032947692 7:136871040-136871062 GGAGGGTGTGTGGCACAGCGTGG - Intronic
1034464485 7:151218500-151218522 TTAGGGTGAGTGGCAGCTCATGG - Intronic
1034788866 7:153949902-153949924 GGAGGGTGAGTGGCTACTCTAGG + Intronic
1035245965 7:157562106-157562128 GGAGGCAGAGTGGCCCACCAAGG + Intronic
1036387336 8:8293966-8293988 GGAGGGTGGGTGGTGCTTCAGGG + Intergenic
1036556169 8:9862254-9862276 GGAGCCTGAATGGCACTTCATGG - Intergenic
1041227854 8:55717648-55717670 AGAGGGAGAGTGCTACATCAAGG + Intronic
1041641449 8:60207086-60207108 GGCGGTCGAGTGACACATCAAGG - Intronic
1041862390 8:62529468-62529490 GGAAGGTGATTGGGACATGAGGG + Intronic
1044840003 8:96329362-96329384 GGAGGGTGAGCGGTAGAGCAGGG - Intronic
1048089026 8:131218621-131218643 TGAGGGTGACAGGAACATCAGGG + Intergenic
1049333664 8:142070183-142070205 GCGTGGTGTGTGGCACATCAGGG - Intergenic
1049580069 8:143407120-143407142 GGAGGGTCAGTGGCACAGCCTGG - Intergenic
1051707151 9:19892805-19892827 AGATGGTAAGTGGCACATCAGGG + Intergenic
1052790828 9:32874127-32874149 GGAAGGAGAGTGGTACAACATGG - Intergenic
1056002566 9:82232449-82232471 GGAAGGTGATTGGAACATGAGGG - Intergenic
1060396362 9:123319556-123319578 TGAGGGTCTGTGGCACAGCATGG - Intergenic
1062042033 9:134408625-134408647 TGGGGGTCAGTGGCACAACACGG - Intronic
1062059478 9:134487291-134487313 GGAGGGTGAGTGACCCAGCTGGG - Intergenic
1062396519 9:136355018-136355040 CGAGGGTGAGTGACACGTCCTGG + Intronic
1062589461 9:137266867-137266889 GCAGGGTGTGTGTCACGTCAGGG + Intronic
1186208101 X:7220889-7220911 GGAGATTCAGTGGCATATCAAGG - Intronic
1186693012 X:11999273-11999295 TTAGATTGAGTGGCACATCATGG - Intergenic
1188230837 X:27660829-27660851 GGAGAATGTTTGGCACATCAGGG - Intronic
1189884643 X:45528955-45528977 GGAGGGTGAGAGTCTCATAAGGG - Intergenic
1192152824 X:68722642-68722664 GGAAGGTGAGTGCCACACCACGG + Exonic
1192500874 X:71651117-71651139 GGAGGGGCAGTGCCACGTCAAGG - Intergenic
1192527255 X:71858223-71858245 GGAGGGGCAGTGCCACGTCAAGG - Intergenic
1192809913 X:74538299-74538321 GGAGGGTGAGGAGCAGCTCATGG + Intergenic
1193006672 X:76626548-76626570 AGAGGGAGAGTACCACATCAAGG + Intergenic
1193951251 X:87802053-87802075 GGAGGAAGAGTGGCACAGGAAGG + Intergenic
1195065301 X:101234077-101234099 GGAAGGTTTGTGGCACATCTGGG - Intronic
1196017016 X:110950092-110950114 TGTGGGGGAGTGGCACAGCATGG + Intronic
1197143430 X:123142356-123142378 GGATGGTGAGGGGAACATAATGG + Intergenic
1197872271 X:131071449-131071471 GGAGGGCGAGGGCCTCATCATGG + Intronic
1198818315 X:140616995-140617017 GGAAGGTGATTAGCTCATCAGGG - Intergenic
1200226499 X:154420545-154420567 GGGGAGTGTGTGGCACAGCAGGG + Intronic