ID: 1172357917

View in Genome Browser
Species Human (GRCh38)
Location 20:34292515-34292537
Sequence GTGAGTGGCACATCAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357907_1172357917 8 Left 1172357907 20:34292484-34292506 CCGTTTCGCCCTTCCAGGCATAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1172357911_1172357917 -1 Left 1172357911 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 128
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1172357913_1172357917 -5 Left 1172357913 20:34292497-34292519 CCAGGCATACACTGGAGGGTGAG 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1172357905_1172357917 14 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1172357904_1172357917 25 Left 1172357904 20:34292467-34292489 CCACAGGTACTCCTCGTCCGTTT 0: 1
1: 1
2: 2
3: 4
4: 35
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1172357909_1172357917 0 Left 1172357909 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357917 Original CRISPR GTGAGTGGCACATCAGGGCC TGG Intronic
900502177 1:3011737-3011759 GGGTGGGGCACATCAGGGGCTGG - Intergenic
900948806 1:5846019-5846041 GTGAGTGTCAAATAAGGTCCTGG + Intergenic
900963052 1:5937951-5937973 GTGAGAGCCACAGCAGGGACAGG + Intronic
901259565 1:7861639-7861661 GTGAGTGGCAGAGCCGAGCCTGG + Intergenic
902405463 1:16181076-16181098 GTGAGTGGGAGAGCTGGGCCTGG + Intergenic
902957307 1:19934378-19934400 TTAAGTGGCACAGCTGGGCCTGG + Intergenic
903291508 1:22317224-22317246 GTGAGTGGCAGAGCTGGGCCTGG + Intergenic
903574265 1:24328641-24328663 GTCAGTGGCAGGTCTGGGCCTGG - Intronic
904992328 1:34603095-34603117 GTGGGAGGCACGTCAGGGGCTGG + Intergenic
905196810 1:36286267-36286289 GTGAATGACACATAAGGGCAGGG + Intronic
906280082 1:44547065-44547087 GTGCCTGGCACATTAGGCCCTGG + Intronic
907498297 1:54860046-54860068 GTGAGGGTCTCATCATGGCCTGG - Intronic
912462741 1:109847435-109847457 GTGAGTGACAGAGCAGTGCCAGG + Intergenic
913328940 1:117651401-117651423 GTGAGTGAGACCTCAGGGCAGGG + Intergenic
914329576 1:146654311-146654333 GTGAGTGCCACATCTGGGAAGGG - Intergenic
915107423 1:153543115-153543137 GTGGGTGGCAGGACAGGGCCTGG + Intergenic
915592196 1:156876863-156876885 GTGTGTGGCACACAAAGGCCAGG + Intronic
920045489 1:203129608-203129630 GAGGGTGGCACAACAGGGGCAGG + Intronic
920053540 1:203177510-203177532 GGGAGTGGCAGTGCAGGGCCTGG + Intergenic
920227980 1:204451590-204451612 GTGAGTGGCAGAACCGGGACTGG - Intronic
920533708 1:206723591-206723613 ACGAGTGGCACATCAGGCCCTGG + Intronic
922865185 1:228853830-228853852 TTAAGTGGCACATCAGGTCAAGG - Intergenic
923837062 1:237623685-237623707 AAGAATGGCACAGCAGGGCCGGG - Intronic
1064428443 10:15251020-15251042 GTGAGTGGCAGATCTGGTACTGG - Intronic
1065948201 10:30626416-30626438 ACGAGGGGCACATCAGGGGCTGG + Intronic
1066457638 10:35585662-35585684 GTGAGTGGCACATGTGGGCATGG - Intergenic
1067247431 10:44558362-44558384 GTGTGCGACACATCAGGGCTTGG + Intergenic
1067716787 10:48696383-48696405 GGGAATGCCACATCAGGGCCAGG - Intronic
1067851674 10:49758824-49758846 GAGTGTGGCACAGCAGGGCTGGG - Intronic
1069797734 10:71063930-71063952 GGGAATGGCACAAGAGGGCCTGG - Intergenic
1069993456 10:72328870-72328892 GTGAGAGGCCCAAAAGGGCCAGG + Intergenic
1070313854 10:75293273-75293295 GTGAGAGGCTCATCTGGGCCAGG + Intergenic
1071112504 10:82176382-82176404 GTGATTGGCACATCACATCCTGG + Intronic
1076720483 10:132390174-132390196 GTGAGTGGGAGGTCAGGGTCGGG + Intergenic
1077305218 11:1865896-1865918 GTGGGAGGCTCCTCAGGGCCAGG + Intronic
1077359502 11:2134408-2134430 GGAAGTGGCACTGCAGGGCCTGG - Intronic
1077613843 11:3661160-3661182 GGGAGTGGGCCATCAGAGCCAGG - Intronic
1078338597 11:10483298-10483320 GTGGGGGACACATAAGGGCCTGG + Intronic
1078513715 11:12006423-12006445 GTAAGTGGCAGAGCAGGGACTGG + Intronic
1080093060 11:28372494-28372516 GTGAGTTGCACATCAAGTTCTGG + Intergenic
1081535738 11:43995055-43995077 GTGAGTGGCATGTCCTGGCCAGG + Intergenic
1084697328 11:70763425-70763447 GTGGGTGAAGCATCAGGGCCTGG + Intronic
1087292338 11:96333607-96333629 GTGAGAGCCACATCAAGGCATGG + Intronic
1089310115 11:117552399-117552421 GTGAGTGTCAAATGAGGGCCTGG - Intronic
1089538636 11:119175840-119175862 GTGAGTGGCACAGCTGAGCGAGG + Intronic
1091690039 12:2589659-2589681 GTGAGTCGGACATCAGGTCAGGG - Intronic
1092230550 12:6773414-6773436 GGGAGTGACACCTCAGGGCAGGG - Intronic
1093494762 12:19743335-19743357 GTAAGAGGCACATGAGGGACTGG + Intergenic
1094329986 12:29280812-29280834 GTGATAGGCACTTCTGGGCCTGG - Intronic
1094494532 12:30981064-30981086 GGGAGTGGCAGGTCAGGGCCAGG + Intronic
1096718567 12:53505263-53505285 GTGAGTGGCTCATGTGGGCCGGG + Intronic
1097763786 12:63499753-63499775 GTGGGTGCGAGATCAGGGCCAGG - Intergenic
1101150534 12:101878630-101878652 CTGAGGGGCACTTCAGTGCCAGG + Intronic
1101268565 12:103118352-103118374 GTGAGGGGAACATCAAGCCCTGG + Intergenic
1101815777 12:108145049-108145071 GTGAGTAGCAGAGCTGGGCCTGG - Intronic
1103152129 12:118649913-118649935 TTGAGTGGCACAACCGAGCCTGG - Intergenic
1103930819 12:124449881-124449903 GAGAGAAGCACATCAGAGCCTGG + Intronic
1104095112 12:125550049-125550071 GTGTGGGGCACATCAGGGGAAGG + Intronic
1105388995 13:19958522-19958544 GGGAGTGGAACGGCAGGGCCGGG + Intergenic
1106658632 13:31775111-31775133 GTGTGTGCAACACCAGGGCCAGG - Intronic
1107192806 13:37609986-37610008 TTGAGTTCCACATCAGGGCATGG - Intergenic
1109624601 13:64958454-64958476 ATGAGGGGCACATCAGGGCTGGG + Intergenic
1112479306 13:99758987-99759009 GTGAGGGGCACAAGAGGGGCTGG + Intronic
1121048913 14:90807226-90807248 GTGAGTGGGTAAGCAGGGCCTGG - Intronic
1121282550 14:92709754-92709776 GTGAGAGGCACATCAGGGCTGGG + Exonic
1121492812 14:94372131-94372153 GGCAGTGGCACAGCAGAGCCAGG - Intergenic
1121685938 14:95835130-95835152 GGAAGTGGCACAGCAGGGACAGG + Intergenic
1121699221 14:95939549-95939571 GTGAGTGGCTCATCATGTACAGG - Intergenic
1121735998 14:96218559-96218581 GTCAGTGGCAGAGCAGGGCCTGG - Intronic
1122425212 14:101601746-101601768 GTGAGTGGTCCCTCAGGGCAGGG + Intergenic
1124622274 15:31280443-31280465 GTGTGTGGCAGATGAGGCCCTGG - Intergenic
1127009215 15:54604046-54604068 GTCAGAGGCAGATCAAGGCCTGG - Intronic
1129233809 15:74211770-74211792 GAGAGTGGCATACCAGGGACAGG - Intronic
1131585171 15:93684892-93684914 GTGAGGGGGACATCATGGTCCGG - Intergenic
1132793957 16:1709336-1709358 GTGTGTGGCTCCTGAGGGCCGGG - Intronic
1133171333 16:3984317-3984339 TTAAGTGGCACATCATCGCCTGG + Intronic
1133206955 16:4239708-4239730 GTGACAGGCACACCCGGGCCAGG - Intronic
1135328641 16:21543596-21543618 GTCAGTCCCACATCAGGGCCCGG + Intergenic
1136338991 16:29629569-29629591 GTCAGTCCCACAGCAGGGCCCGG + Intergenic
1137556680 16:49474697-49474719 GTGAGTGGCAGCTCAGCCCCAGG + Intergenic
1137674956 16:50299574-50299596 GTGTGGGGCAGAGCAGGGCCCGG + Intronic
1139381606 16:66535974-66535996 GTGGGTGGCTCATGAGGGTCAGG + Intronic
1140003985 16:71056624-71056646 GTGAGTGCCACATCTGGGAAGGG + Intronic
1140662255 16:77198705-77198727 GGAATTGGCACTTCAGGGCCAGG + Exonic
1141625206 16:85257964-85257986 GTGATTGGGAGCTCAGGGCCTGG + Intergenic
1141628313 16:85273184-85273206 GTGATGGGGACACCAGGGCCCGG - Intergenic
1141932873 16:87217356-87217378 GTGAGTGGCACAGCTGAGCTCGG + Intronic
1142041663 16:87898135-87898157 GTCAGTCCCACAGCAGGGCCCGG + Intronic
1142147119 16:88497371-88497393 GTGGCTGGAACATCAGGGCCCGG + Intronic
1142692736 17:1616727-1616749 GTGGGCGGCACAGCAGAGCCGGG - Exonic
1143001738 17:3799003-3799025 GAGAGTGGAAGGTCAGGGCCAGG + Intronic
1144863652 17:18321310-18321332 ATGCCTGGCACATCAGAGCCAGG - Intronic
1145960067 17:28882042-28882064 GTGTGTGGCACATTAGAGGCTGG + Intronic
1147004106 17:37387865-37387887 ATGAGATGCACATTAGGGCCAGG + Intronic
1147315169 17:39616769-39616791 GTGAGTGGCAGAGCTGGGACTGG + Intergenic
1147760562 17:42795235-42795257 GTGAGGGGGACAGCAGGGACTGG - Exonic
1147986778 17:44311615-44311637 GTGGGTGGCAGAGCAGGGGCGGG - Intronic
1148107751 17:45128351-45128373 GTGAGGGGGACCACAGGGCCTGG + Intronic
1149228369 17:54502282-54502304 GTGAATGTGACATCAGGGACAGG - Intergenic
1151597003 17:75084407-75084429 GTGAGTGGCTCCTGTGGGCCAGG + Intergenic
1152209770 17:78996933-78996955 GGGAGTGGGAGCTCAGGGCCTGG - Intronic
1152515870 17:80824625-80824647 GTCAGTGCCACATCAGATCCTGG + Intronic
1152887611 17:82861540-82861562 GTGCGCGGCACACCGGGGCCGGG - Intronic
1153130537 18:1851182-1851204 GTGAAGGGCACAGCAGGGCATGG + Intergenic
1153497421 18:5713925-5713947 GTGAGTTGAACAGCAGGGGCAGG + Intergenic
1155674482 18:28413139-28413161 GTGATTTGCACAGCAGGGCCAGG - Intergenic
1158350279 18:56557834-56557856 GTGAGTGGCATTTAAGGGCAGGG + Intergenic
1160119128 18:76111643-76111665 GTGGCTGGAACAGCAGGGCCTGG + Intergenic
1160708227 19:539754-539776 GGGGGTGGCACAGCAGGGCCAGG - Intronic
1163023318 19:14495429-14495451 GTAACTGGCACATCTGGGACTGG - Intronic
1163364527 19:16868665-16868687 TGGAGGGGCACATCAGGGGCCGG + Intronic
1165357065 19:35310825-35310847 GTCAGGGGCACACCAGGGCCTGG + Intronic
1166117675 19:40665746-40665768 GTGAGAGCCACCTCAGTGCCCGG + Intergenic
1166442434 19:42826597-42826619 CTGAGTGGCACATCGTGTCCTGG + Intronic
1166461876 19:42994914-42994936 CTGAGTGGCACATCATGTCCTGG + Intronic
1167586369 19:50377813-50377835 GTGCCTGGGACATCAGGGTCCGG - Exonic
927462716 2:23312958-23312980 CAAAGTGGCACATCAGGGCCTGG + Intergenic
929762914 2:44820822-44820844 GTGAGAGGCACATGGGTGCCGGG - Intergenic
934561248 2:95314671-95314693 GTGAGGGGCCCAGCATGGCCAGG + Intronic
935186028 2:100733764-100733786 GTCAGTGGCACAATAGGGCTTGG + Intergenic
937258197 2:120569350-120569372 GTTAGTGGCACACCTGGGCCTGG + Intergenic
944208451 2:197182268-197182290 GTTAATGGCATACCAGGGCCTGG - Intronic
945239883 2:207666764-207666786 TTGAGTTGCCCATAAGGGCCAGG - Intergenic
946837505 2:223787007-223787029 GTGACTGGATCATCAGGGTCTGG + Intronic
948368511 2:237473649-237473671 GAGAGAGGCACATGAGGGCTCGG - Intergenic
948903280 2:240966634-240966656 GTGGGTGTCACAGCAGGGCCTGG - Intronic
949069339 2:242013961-242013983 GAGAGAGGCAGGTCAGGGCCTGG + Intergenic
1170703986 20:18728288-18728310 GTCAGTGGCACAGCAAGACCTGG + Intronic
1170982249 20:21225719-21225741 GTGTGTGGCAATTCAGGCCCAGG - Intronic
1172357917 20:34292515-34292537 GTGAGTGGCACATCAGGGCCTGG + Intronic
1174145278 20:48448821-48448843 CTGGCTGGCATATCAGGGCCAGG + Intergenic
1175942060 20:62541966-62541988 GTGAGTGGAAGAGCAGGGTCAGG - Intergenic
1177562395 21:22773230-22773252 GTGAGAGTCAGATCAGTGCCCGG - Intergenic
1178776404 21:35555300-35555322 GTGAATGGCACTTCAGGGAAAGG - Intronic
1180987298 22:19912458-19912480 GTGAGGTGCAGAGCAGGGCCGGG + Intronic
1182620160 22:31614439-31614461 GTGAGGAGCACAGCAGGGACCGG - Intronic
1182658438 22:31907896-31907918 CTGAGTGGCAGCTCAGGGCCTGG - Intergenic
1183281615 22:36935516-36935538 GGGAGCGGCAGAGCAGGGCCTGG - Intronic
1184333804 22:43841600-43841622 GTGGGTGACACATCAGCGTCAGG - Intronic
1184929810 22:47672695-47672717 GTGGTTGGCACACCAGGCCCTGG + Intergenic
1185212301 22:49577207-49577229 GGGAGTTGGACACCAGGGCCAGG - Intronic
950269353 3:11601240-11601262 GTCAGTGGCAGATCAAGGACTGG + Intronic
954449524 3:50564115-50564137 GTGGATGGCCCATCATGGCCTGG - Intronic
954845040 3:53547977-53547999 AAGAGTGGCACATCAGGCCAGGG + Intronic
955234883 3:57130677-57130699 GTGAGTGTCACCCCTGGGCCGGG - Intronic
955235482 3:57135318-57135340 GGAAGTGGCACATCCTGGCCTGG - Intronic
955489287 3:59466174-59466196 GTGGGTGGGACATCAGGGAATGG + Intergenic
956400377 3:68873134-68873156 GTGTGTGACACATCAGAACCTGG - Intronic
958526723 3:95269998-95270020 GTGAGAGGGACATCTGGGCATGG + Intergenic
959594515 3:108114651-108114673 GTGAGTGGCAGATAAGGGGGCGG - Intergenic
962888408 3:139649670-139649692 GTGAGTTGCACACCAGGGAGGGG + Intronic
967011643 3:185440628-185440650 TTGACAGGCACATCAGGGCAGGG + Intronic
967851188 3:194083797-194083819 GAGAGAGGCACATCAGAGTCGGG + Intergenic
969075310 4:4573700-4573722 GAGTGTGCCACATCATGGCCTGG - Intergenic
969709147 4:8832692-8832714 CTGAGTGGCTAATCAGGGCTTGG - Intergenic
972796115 4:42421408-42421430 GTTAGTGACAGATCTGGGCCTGG - Intronic
975100287 4:70504934-70504956 GTGAGTGGCTAAACAGTGCCTGG + Intergenic
976703930 4:88002206-88002228 GTGAGTGGCACATAAGCTCCTGG - Intergenic
977541917 4:98328480-98328502 GTGATTCGTACATCAGGCCCAGG + Intronic
978861697 4:113457902-113457924 GTGCTTGGCACACCTGGGCCAGG - Intronic
988361354 5:30240031-30240053 GTGACTCCCACAGCAGGGCCAGG + Intergenic
990355361 5:54961275-54961297 CTAAGAGGCACATGAGGGCCTGG + Intergenic
992009826 5:72515123-72515145 GTCTGTGGCACACCAGGGACAGG + Intergenic
992271110 5:75063723-75063745 GTGACTGGGTCATGAGGGCCAGG - Intergenic
992774665 5:80078976-80078998 GTGAGTGGCAACTGAGGCCCTGG - Intronic
997320144 5:132971261-132971283 GTGTGTGGCACAGCTGGGCATGG + Intergenic
997519220 5:134511932-134511954 GTGGGAGGCAGATCAAGGCCAGG + Intergenic
1000253552 5:159517338-159517360 GTGAATGGGGCATGAGGGCCAGG - Intergenic
1002702847 5:181138205-181138227 GTGCGTGGCAGATGGGGGCCCGG + Intergenic
1002818495 6:700211-700233 GTGTGTGGCACATCAGTGTGTGG + Intergenic
1003034662 6:2632472-2632494 GTGAGTGGGACGCCAGGGCTGGG - Intronic
1003287533 6:4747471-4747493 AGGAGTGGGACATGAGGGCCAGG - Intronic
1005385603 6:25281243-25281265 GTGAGTGACACATCCGGTTCTGG + Intronic
1006300108 6:33189425-33189447 GGGAGGGGAACCTCAGGGCCCGG + Exonic
1006442834 6:34062794-34062816 TTGAGAGGCACATCTGGGGCTGG - Intronic
1009355684 6:62740766-62740788 GGCAGTGGCACAGCAGGGGCGGG - Intergenic
1010176292 6:73031990-73032012 GTGAGAGGCAGGTCAGGGCTGGG - Intronic
1010226654 6:73495973-73495995 GTGAGTGGCAGAGCTGGGACTGG + Intronic
1015117164 6:129662308-129662330 GTGAAGGGCCCATCAGGGCATGG + Intronic
1016713871 6:147203020-147203042 CTGAGTGGCTCATCAGCGTCAGG + Intergenic
1017852235 6:158314651-158314673 GTCAGTGGGACATCAGGGGTGGG - Intronic
1019095224 6:169574515-169574537 GTGAGTGCCACATCCGCCCCAGG + Intronic
1019796555 7:3054221-3054243 GAGAGTGGCTCATAGGGGCCTGG + Intergenic
1034442544 7:151093784-151093806 GTTAGTGGCAGAGCAGGGACGGG - Intronic
1034830205 7:154302452-154302474 CTGAGTGGCACAACCTGGCCTGG + Intronic
1035409721 7:158629723-158629745 GTGAGTGCCACAGCAGGGGTAGG + Intergenic
1037828443 8:22174083-22174105 GTGAGTGGCAGAGCTGGGACTGG + Intronic
1038583580 8:28770615-28770637 GTGGGTGGCACTTCAGCTCCAGG - Intronic
1039391339 8:37183246-37183268 GTGAGTGGAAGATCAGGGACTGG + Intergenic
1041262321 8:56032432-56032454 GTGAAATGCAAATCAGGGCCGGG + Intergenic
1042466900 8:69138683-69138705 GTGAGGGGCACAACAGGAGCAGG - Intergenic
1043380842 8:79700487-79700509 GTGAGTATGTCATCAGGGCCAGG - Intergenic
1047338438 8:123957652-123957674 GTGAGTCTTACATCAGAGCCTGG + Intronic
1047926473 8:129687714-129687736 GTGAGTGGCAGAGCTGGGCTGGG - Intergenic
1048255122 8:132899920-132899942 GTGAGAGGCAGGTCAGGTCCAGG - Intronic
1049204698 8:141358345-141358367 GTCAGTGGCACAGCTGGGGCTGG - Intronic
1049664584 8:143837311-143837333 GTGGGAGGCACATGAGGGGCTGG + Intronic
1050012984 9:1204209-1204231 GAGAGTTGCAGGTCAGGGCCTGG + Intergenic
1053295582 9:36910767-36910789 GTCAGTTCCACATCAGGGCTTGG - Intronic
1054798488 9:69324904-69324926 GTGGGAGGCACCTCACGGCCAGG - Intronic
1055596084 9:77865653-77865675 GTGACTGGCAGAGCTGGGCCTGG - Intronic
1057279506 9:93699731-93699753 GTGGGTGACAAAGCAGGGCCAGG + Intergenic
1057542987 9:95993221-95993243 GTAAGTGGCAAAGTAGGGCCTGG + Intronic
1057942622 9:99298136-99298158 GGGCGTGGCAAATCAGGGCCTGG + Intergenic
1060823580 9:126674793-126674815 GTGAGAGGCACAGCGGGTCCTGG - Intronic
1061913051 9:133734979-133735001 GGTAGTGGCACAGCAGGGCAGGG + Intronic
1062132617 9:134907945-134907967 GCCAGTCCCACATCAGGGCCTGG - Intronic
1187948500 X:24449624-24449646 GTTAGTGGCAGATCTAGGCCTGG + Intergenic
1196423462 X:115545700-115545722 TTGAGGGGCACAACAGGTCCTGG + Intergenic
1196745199 X:119065582-119065604 TTGAGAGGCACCTCAGGTCCAGG - Intergenic
1197172477 X:123449862-123449884 GTCAGGGGCACGTGAGGGCCTGG - Intronic
1198131254 X:133697568-133697590 GTGAGTGCCAAATCAGAGCTAGG - Intronic
1198167973 X:134076330-134076352 GTGTGTGGCACATTACTGCCAGG + Intergenic
1200099875 X:153685091-153685113 GTGAGTAGAACACAAGGGCCTGG + Intronic
1200226501 X:154420550-154420572 GTGTGTGGCACAGCAGGGCCGGG + Intronic