ID: 1172357918

View in Genome Browser
Species Human (GRCh38)
Location 20:34292528-34292550
Sequence CAGGGCCTGGACTTCCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172357909_1172357918 13 Left 1172357909 20:34292492-34292514 CCCTTCCAGGCATACACTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1172357918 20:34292528-34292550 CAGGGCCTGGACTTCCCAACTGG 0: 1
1: 0
2: 1
3: 25
4: 176
1172357905_1172357918 27 Left 1172357905 20:34292478-34292500 CCTCGTCCGTTTCGCCCTTCCAG 0: 1
1: 1
2: 2
3: 3
4: 49
Right 1172357918 20:34292528-34292550 CAGGGCCTGGACTTCCCAACTGG 0: 1
1: 0
2: 1
3: 25
4: 176
1172357907_1172357918 21 Left 1172357907 20:34292484-34292506 CCGTTTCGCCCTTCCAGGCATAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1172357918 20:34292528-34292550 CAGGGCCTGGACTTCCCAACTGG 0: 1
1: 0
2: 1
3: 25
4: 176
1172357911_1172357918 12 Left 1172357911 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 128
Right 1172357918 20:34292528-34292550 CAGGGCCTGGACTTCCCAACTGG 0: 1
1: 0
2: 1
3: 25
4: 176
1172357913_1172357918 8 Left 1172357913 20:34292497-34292519 CCAGGCATACACTGGAGGGTGAG 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1172357918 20:34292528-34292550 CAGGGCCTGGACTTCCCAACTGG 0: 1
1: 0
2: 1
3: 25
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172357918 Original CRISPR CAGGGCCTGGACTTCCCAAC TGG Intronic
900599760 1:3497956-3497978 CAGGGCCTGGTCCACCCAGCGGG - Intronic
901670396 1:10852606-10852628 CAGGGCCTGGACTCTCCAGGTGG - Intergenic
902435749 1:16397295-16397317 CATGCCCTGGGCTTCCCAAATGG + Exonic
903268891 1:22175525-22175547 CCGCGCCTGGCCTTCCCAGCAGG + Intergenic
903554787 1:24185655-24185677 CAGCTTCTGGACTTCCTAACGGG + Intronic
904428656 1:30447794-30447816 CATGGCCTCTACTTCCCAACAGG + Intergenic
912305406 1:108561175-108561197 CAGGGCCTGGGCTCCCCATCTGG - Intronic
920742091 1:208590605-208590627 CAGTGCCTGGTATTCCAAACTGG - Intergenic
920850038 1:209622535-209622557 CAGGTCCGGGACTTCCTAACAGG - Exonic
921322344 1:213954079-213954101 CAGCGCCTGGATTTCCAATCTGG - Intergenic
922928490 1:229370800-229370822 CAGGGACTGAACTTCCCCATGGG + Intergenic
924624619 1:245688306-245688328 CAGGGCGTGTGCTTCCCACCGGG - Exonic
1062955227 10:1535783-1535805 CAGGGCCTGCACTGCTCACCAGG - Intronic
1068157610 10:53222203-53222225 CTGGGTCTGGGCTTCCCAAAGGG + Intergenic
1075261260 10:120965460-120965482 CAAGGCCTGGGGTTTCCAACTGG - Intergenic
1076121645 10:127941139-127941161 CAGGGCCTCCACCTCCCACCAGG - Intronic
1076335981 10:129706667-129706689 CAGGGCCAGGGCTTCCCACGGGG + Intronic
1076627169 10:131829254-131829276 CAGGGCATGGACTTCCCACCTGG + Intergenic
1078091243 11:8266023-8266045 CAGGGCCCTGACTCCCCAAAGGG - Intronic
1078531356 11:12139172-12139194 CAGGCCCTGGACTTCCTGTCTGG + Intronic
1079487453 11:20950247-20950269 TAGGGCCTGCTCTTCCCATCAGG + Intronic
1081613925 11:44579396-44579418 CAGGGCCTGCACTTCCAGGCCGG + Intronic
1081669499 11:44935140-44935162 CAGGTCCTGTGCTTCCCACCTGG - Intronic
1083319002 11:61833941-61833963 CAGGTGCAGGCCTTCCCAACTGG + Intronic
1083481216 11:62948959-62948981 CAGGGCCTGGGTTTCCCCAGGGG + Intronic
1083679475 11:64344543-64344565 CAGGGCCTGGACCTGGCCACGGG + Exonic
1083899597 11:65637173-65637195 CAGGGCCTGGGCTCCCCAGATGG + Exonic
1084172644 11:67408011-67408033 CAGGGCCTGACCTGCCCACCTGG + Intronic
1085510429 11:77085282-77085304 CAGGGCCTCCACTTCCTCACAGG + Intronic
1085710516 11:78824921-78824943 CAGGGCCAGTACATTCCAACTGG + Intronic
1085885830 11:80520668-80520690 CATGGTCTGAATTTCCCAACTGG - Intergenic
1086242096 11:84707474-84707496 CAGGTCCTGGACTTCTGAAGTGG + Intronic
1087049503 11:93871147-93871169 CAGGGCCTGGCATTACCATCAGG - Intergenic
1089255183 11:117190361-117190383 CAGGGCCAGGCCTGCCCAAAAGG - Intronic
1090033533 11:123228510-123228532 CTGGTCCTGGACTTCCCAGAGGG - Intergenic
1090352342 11:126115404-126115426 CAGGGTCAGGACTTCCCAGCTGG - Intergenic
1090608879 11:128452411-128452433 CAGGGCCAGGATTTACCACCTGG + Intergenic
1091713609 12:2760468-2760490 CAGGGCGTGGATTTCCCTGCTGG - Intergenic
1095397397 12:41776532-41776554 CACGGCCAGGACTTTGCAACTGG - Intergenic
1102491663 12:113293070-113293092 CAGGGCCTGGGCTCCTCACCTGG - Exonic
1102608390 12:114088861-114088883 GAGGGCTTTGACTTCCCAGCAGG - Intergenic
1102623839 12:114218728-114218750 CAGAGCCTGTACTTCCCACATGG + Intergenic
1105812596 13:24008362-24008384 CAGGGCCTGGCCATTCCAGCTGG - Intronic
1106971337 13:35145384-35145406 CAGGGCCCAGACTTCTAAACTGG - Intronic
1109470727 13:62800108-62800130 CTAGGCCTGGACTTCCCAAAGGG - Intergenic
1110159673 13:72360383-72360405 CAGGGTCTGGACTACCCCACTGG + Intergenic
1112341458 13:98556152-98556174 CATGGCCTGGATTCCCCAACAGG + Intronic
1114553221 14:23546252-23546274 CAGGCCTTGGAATTCCCAGCAGG - Intronic
1114568403 14:23648799-23648821 CTGGGCCTGGGCTTCTCACCTGG - Intergenic
1115430309 14:33309884-33309906 CAGGGCCAGGACTTCTCACGAGG - Intronic
1115618906 14:35121859-35121881 TAGGGCCGGGCCATCCCAACGGG + Intronic
1116789921 14:49329453-49329475 CTGGGTCTGGACTCCCCAAAGGG + Intergenic
1118284390 14:64458221-64458243 CAATGCCTGGACTCCCCACCCGG + Exonic
1123037497 14:105477426-105477448 CGGGGCCTGGCCTTCCCATGAGG + Intronic
1125718239 15:41831944-41831966 CTGGGTCTGGACTCCCCAAAGGG - Intronic
1128142130 15:65309688-65309710 CTGGGCCTGGGCTTCTCTACTGG + Intergenic
1131511831 15:93053422-93053444 CAGAGGCTGGACCTCCCAGCTGG - Intronic
1132816322 16:1829039-1829061 CAGCAACTGTACTTCCCAACCGG + Intronic
1134242699 16:12517611-12517633 CAGCGCCTGGAGATCCCAAGAGG - Intronic
1135303927 16:21353038-21353060 CAGGGCCTGGCCTTGACAAAGGG - Intergenic
1136300661 16:29332175-29332197 CAGGGCCTGGCCTTGACAAAGGG - Intergenic
1136316541 16:29457811-29457833 CTGGGCCTGGATTGCACAACTGG - Intronic
1136431118 16:30197153-30197175 CTGGGCCTGGATTGCACAACTGG - Intronic
1137480466 16:48848311-48848333 CAGGCCCTGGTCTTCTCATCAGG + Intergenic
1141254369 16:82386825-82386847 GATGGCCTGGAATTTCCAACTGG + Intergenic
1141809529 16:86365728-86365750 CAGAGCCTGGACCTCCCAAGAGG + Intergenic
1141835523 16:86536540-86536562 CAAGGCCTGCATCTCCCAACAGG + Intronic
1142314413 16:89334585-89334607 CAGGGTCTGGCCTACCCACCTGG - Intronic
1142380822 16:89730931-89730953 CAGGCCCTGGCCTTCCCCTCTGG - Intronic
1145263773 17:21369670-21369692 CAGGGTCTGGTCTTCCAAGCGGG - Intergenic
1147141551 17:38463376-38463398 CAGGGGCTGGACTCACCAGCTGG - Exonic
1147263095 17:39220050-39220072 CAGGGCTTTGGCCTCCCAACTGG - Intronic
1147806507 17:43135512-43135534 CTAGGCCTGGACTTCTCCACCGG - Intergenic
1150197327 17:63313951-63313973 CACAGCCTGGCCTTTCCAACAGG + Intronic
1150206797 17:63415241-63415263 CTGGACCCTGACTTCCCAACTGG - Intronic
1151139246 17:71975862-71975884 CAGACCCTGGACTCCACAACTGG + Intergenic
1152121335 17:78420423-78420445 CAGGGCCTGGACTGCACTCCGGG + Intronic
1152491922 17:80640739-80640761 AAGGGCCTGGACTTTCCAAGGGG + Intronic
1152557300 17:81059843-81059865 AAGAGCCTGGAGTTCCCCACGGG - Intronic
1152929189 17:83101284-83101306 CAGGGTCTGGACTTCTGCACGGG + Intergenic
1156352428 18:36312449-36312471 CTCGTCCTGGACGTCCCAACAGG + Intronic
1158000097 18:52608399-52608421 GAGGACCTGGCCTTCCCAAAGGG + Intronic
1160048478 18:75409212-75409234 CACTACCTGTACTTCCCAACAGG - Intronic
1160607677 18:80064676-80064698 CGTGGCCTGGACTTACCACCTGG + Intronic
1160608330 18:80068756-80068778 CAGGGCAGGGCCATCCCAACAGG - Intronic
1161057841 19:2199620-2199642 CTGGGCCTGGCCTCCCCAAGCGG + Intronic
1162123968 19:8489533-8489555 CAGGGCGTTAACTTCACAACAGG - Intergenic
1162537683 19:11273228-11273250 CAGGACTTGGGCTTCCCAGCTGG - Intergenic
1162689052 19:12413864-12413886 CAGGACCCAGACTTCCCTACGGG - Intronic
1163480858 19:17555582-17555604 CGGGGCCTGGACTTCACGCCCGG + Exonic
1163815915 19:19464380-19464402 CCCGGCCTCGACGTCCCAACAGG - Intronic
1164506370 19:28864570-28864592 CATGGCCTTGACTCCCCACCAGG - Intergenic
1164553569 19:29232669-29232691 CAGGGCTTGGATTTGCAAACTGG - Intergenic
1166050582 19:40256628-40256650 CAGGCCTTGGAGTCCCCAACTGG - Intronic
1168129895 19:54311532-54311554 CAGGGCCTGGAACTGCCCACTGG + Exonic
1168584652 19:57583159-57583181 CAGAGCATGGACTTCCCCTCGGG + Intronic
925076250 2:1018633-1018655 CAGGGCGTGAACTTCTCACCTGG + Intronic
925935833 2:8758452-8758474 CTGAGCCTGGACTTCCACACTGG + Intronic
926360398 2:12081408-12081430 GAGGGCCTGGAATTCCCAAAAGG + Intergenic
935654350 2:105409125-105409147 CTGGGCCTGCTCCTCCCAACTGG - Intronic
941925403 2:170889306-170889328 CAGGGCCTGGACCTGTCAACAGG + Intergenic
945507395 2:210658207-210658229 CAGGGCCTGTACCTCCCAGCAGG + Intronic
946459550 2:219856927-219856949 CAGGGCACAGTCTTCCCAACAGG - Intergenic
948694706 2:239727369-239727391 CAGGGCCTGGCCCTCCCAGCAGG - Intergenic
948832532 2:240605204-240605226 CAGGGCCTGGCCTTTCCATGGGG + Intronic
1168766953 20:388260-388282 CAGGCCCTGCACTGCCCTACAGG + Exonic
1168831115 20:845699-845721 CTGGGCCTGGAATTCGCCACAGG + Exonic
1172357918 20:34292528-34292550 CAGGGCCTGGACTTCCCAACTGG + Intronic
1172880022 20:38193837-38193859 CAGGGCCTGGCCTTCCCTGGGGG - Intergenic
1173691638 20:44965666-44965688 CAGGGCCTGCACCACCAAACTGG - Intergenic
1174037326 20:47676384-47676406 CAGGGCCAGGGCCTCCCAACGGG - Intronic
1174056626 20:47802692-47802714 CAGGGCCTGGACTTCTTGTCTGG - Intergenic
1174304824 20:49607764-49607786 CTGGGCCTCAGCTTCCCAACAGG - Intergenic
1174780693 20:53386056-53386078 CAGGGCCTGGCCTTCTCCAGTGG - Intronic
1176294954 21:5066777-5066799 CAGGGCGGGGGCTTCCCAGCTGG + Intergenic
1179862095 21:44195350-44195372 CAGGGCGGGGGCTTCCCAGCTGG - Intergenic
1180065697 21:45411147-45411169 CAGGGCTGGGACTTCGCCACAGG - Intronic
1181514885 22:23404752-23404774 CTGGGCCTCCACTTCCCCACAGG + Intergenic
1182397343 22:30046006-30046028 CACAGCCTGGACATGCCAACAGG + Intergenic
1182520246 22:30880984-30881006 CAGGGCCTGGACTCCCCAGGTGG + Intronic
1182529571 22:30944852-30944874 CAGAGCCTGGGCCTCTCAACTGG + Intronic
1183827616 22:40400821-40400843 CAGGGGCTGGACTTGGAAACGGG + Intronic
1184033427 22:41907701-41907723 CAGGTCCTGTGCTTCCCAGCTGG + Intergenic
1184657421 22:45948736-45948758 CAGGGCCTCAGCTTCCCCACTGG - Intronic
1184910432 22:47528736-47528758 CAGGCCAAGGACTTGCCAACAGG + Intergenic
1184984702 22:48121882-48121904 AAGGGCCTGGCCTTCCCAGATGG - Intergenic
1185057291 22:48587653-48587675 CAGGGCCTGGCCTACCCCACAGG - Intronic
1185127231 22:49018005-49018027 CAGGGCCTGCACTTCCCATGGGG - Intergenic
952943022 3:38457735-38457757 CAGGGCCTGCACTTCCTGATGGG - Intronic
954408570 3:50359139-50359161 CCGGGCCTGGGCCTCCCATCGGG - Exonic
954692320 3:52402165-52402187 CAGGGCCTGGACTCTCCAGCTGG + Exonic
955860977 3:63329987-63330009 CAGGGTCTGGACATCCCTGCAGG + Intronic
956017822 3:64902370-64902392 AAAGGAATGGACTTCCCAACTGG - Intergenic
961203360 3:125061718-125061740 CAGGGCCTGGACTTCCCTCTGGG + Intergenic
961324846 3:126103962-126103984 CTGGGCCTCGACTTCTCACCTGG - Intronic
961778194 3:129305120-129305142 CAGGGCAGAGACTTCCCAGCTGG - Exonic
962368118 3:134798986-134799008 CAGGGCCAGGACTTCACTATAGG - Intronic
962599424 3:136979774-136979796 CTGAGCCTGTACTTCCCACCTGG + Intronic
965121081 3:164558534-164558556 CTGGGGCTCCACTTCCCAACAGG + Intergenic
969710949 4:8843118-8843140 CAGGGCCTGGACCTGGCATCTGG - Intergenic
971243352 4:24908275-24908297 CAGGGCCAAGACTTCCCCCCAGG + Intronic
973605146 4:52579557-52579579 CAGGGTCTAGAATTTCCAACTGG - Intergenic
975195976 4:71524047-71524069 CAGGGTCTGCACTTGCCATCTGG + Intronic
980701943 4:136442619-136442641 CTGGGCCTGGGCTGCCCATCCGG + Intergenic
986120035 5:4826662-4826684 CTGAGCCTGGAGCTCCCAACTGG + Intergenic
986622065 5:9686415-9686437 CATGGGCTGGATTTCCCATCTGG - Intronic
987930127 5:24391248-24391270 GAGGGCCTGGACTTCAGAAGTGG - Intergenic
995478572 5:112572468-112572490 CAGGGCCTAGGCTTCCACACTGG + Intergenic
998252821 5:140564159-140564181 CAGCTCCTGGTCTTCCCACCGGG + Intronic
1000978157 5:167787525-167787547 CAGGGCCTGCATTTCCCACCTGG + Intronic
1001665478 5:173430223-173430245 CAGAGCCTGGAATTCTCAAGGGG - Intergenic
1002171795 5:177378796-177378818 CAGAGCCTGGAGTTCCTAGCCGG + Intergenic
1002434484 5:179222378-179222400 CAGGGCCTTTCCTCCCCAACCGG + Intronic
1003218237 6:4135155-4135177 CCGGGCCTGCACTTCCCAGCCGG - Intronic
1003646618 6:7917857-7917879 CAGCACCTGGACTTCATAACAGG + Intronic
1004688059 6:17966920-17966942 CTGGACCTGCACTTCCCAGCTGG - Intronic
1006264887 6:32912645-32912667 CAGGGCCTACATTTCCCAACAGG + Intergenic
1006586327 6:35116728-35116750 CAGGGTCTGCACCTGCCAACTGG + Intergenic
1011195175 6:84773530-84773552 TTGGGCCTGGGCTTTCCAACAGG - Intergenic
1016723325 6:147328277-147328299 CAGGGCCTGTCCTGCCCAACTGG + Intronic
1017295668 6:152790605-152790627 CAGGCCCAGCACTTCCCAATAGG - Intergenic
1021269941 7:18573869-18573891 CTGGGCCTGGGCTCCCCAAAGGG + Intronic
1021858105 7:24877841-24877863 CAGGGCCTTGATTTCCCCAAGGG - Intronic
1022588083 7:31634820-31634842 TGGGGCCTTGACTTCCCACCTGG - Intronic
1023028915 7:36076312-36076334 CATGCCCTGGACCTCCCACCAGG + Intergenic
1025607134 7:63047543-63047565 CAGGGCCTGAGCTTGCCAAGAGG + Intergenic
1026435287 7:70391486-70391508 GAGGGCCTGAACTCCACAACGGG - Intronic
1026915919 7:74120470-74120492 CTGGGCCTGGACCTCCCGGCCGG + Intronic
1028399800 7:90412753-90412775 CAGGGACTCTGCTTCCCAACTGG + Exonic
1029649686 7:101882826-101882848 GGAGGCCTGGACTTCCCCACTGG + Intronic
1030464126 7:109878181-109878203 CAGGGCTTGGAATTTCCAACAGG + Intergenic
1034237650 7:149585232-149585254 CAGGTTCTGGATTTCCCATCTGG + Intergenic
1034240731 7:149608891-149608913 CAGGTTCTGGATTTCCCATCTGG + Intergenic
1036618033 8:10403849-10403871 CAGGACCTAGGCTTCCCATCTGG + Intronic
1036777794 8:11625482-11625504 CAGGGCCTGAGCTTGCCAAGAGG - Intergenic
1038271693 8:26080913-26080935 CAGCGCGGGGACTCCCCAACAGG - Intergenic
1038778639 8:30552438-30552460 CTGGGTCTGGCCTTCCCCACCGG - Intronic
1039468514 8:37799762-37799784 CTGGCTCTGGACTTCCCCACAGG + Intronic
1039749274 8:40462120-40462142 CAGAGCCTGGAATTCCCACCTGG - Intergenic
1039974192 8:42346229-42346251 CAGGACCTGGACTACTCAAAAGG - Intronic
1040436895 8:47399596-47399618 CATGACCACGACTTCCCAACAGG - Intronic
1045509665 8:102805082-102805104 CAGGCCACGGACTTCCCAAAGGG + Intergenic
1049956513 9:698102-698124 CAGGGCCTGAATTGGCCAACAGG - Intronic
1052085244 9:24256912-24256934 CAGGGCCTCTACTTTGCAACTGG - Intergenic
1052394124 9:27916952-27916974 TAGGGTCTGCACTTCCCAAGAGG - Intergenic
1052544328 9:29854066-29854088 CAGTTCTTGGACTTCCCTACTGG + Intergenic
1053610082 9:39704282-39704304 CAGAGCCAGGAGTTCCCAAAAGG - Intergenic
1053868148 9:42462506-42462528 CAGAGCCGGGAGTTCCCAAAAGG - Intergenic
1054088171 9:60766865-60766887 CAGAGCCAGGAGTTCCCAAAAGG + Intergenic
1054243442 9:62638113-62638135 CAGAGCCAGGAGTTCCCAAAAGG + Intergenic
1054557566 9:66672634-66672656 CAGAGCCAGGAGTTCCCAAAAGG + Intergenic
1055120776 9:72658423-72658445 CAGGGCCTGCACTGCAAAACAGG - Intronic
1056765811 9:89443757-89443779 CAGGGCCTGCAGTTACCCACTGG - Intronic
1059676042 9:116540668-116540690 CAGGGACAGGACTTTCCAAAAGG + Intronic
1060593259 9:124832792-124832814 CAGGGCCTGGGCTCCCCACATGG - Intergenic
1061839517 9:133349679-133349701 CAGGCCCTGGACCGCCAAACAGG + Exonic
1062483128 9:136761768-136761790 CAGGGCCTGGAGAACCCACCTGG + Exonic
1062527751 9:136985156-136985178 CGGGGCCTGGCCCTCCCAGCAGG - Exonic
1062527764 9:136985188-136985210 CAGGGCCTGGCCCTTCCAGCAGG - Exonic
1187251028 X:17598086-17598108 CAGGGCCTGCCCTACCCAGCAGG + Intronic
1191098757 X:56702267-56702289 AAAGGCCTGGACTTCAGAACAGG + Intergenic
1192573130 X:72222442-72222464 CACAGACTGGACTTACCAACAGG + Intronic
1192893554 X:75416208-75416230 CAGGGCCTGGATAATCCAACTGG + Intronic