ID: 1172359298

View in Genome Browser
Species Human (GRCh38)
Location 20:34301224-34301246
Sequence CAGCCGGGCCCCTCCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172359298_1172359304 -9 Left 1172359298 20:34301224-34301246 CCCTCCTGGGAGGGGCCCGGCTG 0: 1
1: 0
2: 2
3: 27
4: 291
Right 1172359304 20:34301238-34301260 GCCCGGCTGTATGGGACAATGGG 0: 1
1: 0
2: 0
3: 0
4: 45
1172359298_1172359303 -10 Left 1172359298 20:34301224-34301246 CCCTCCTGGGAGGGGCCCGGCTG 0: 1
1: 0
2: 2
3: 27
4: 291
Right 1172359303 20:34301237-34301259 GGCCCGGCTGTATGGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172359298 Original CRISPR CAGCCGGGCCCCTCCCAGGA GGG (reversed) Intronic
900146434 1:1160829-1160851 CAGCCCTGAGCCTCCCAGGATGG - Intergenic
900149166 1:1170787-1170809 CAGCCAGGCGCCAGCCAGGAGGG + Intergenic
900164630 1:1239800-1239822 GGGCATGGCCCCTCCCAGGATGG + Intergenic
900179181 1:1303855-1303877 CAGCCCAGCCCCTCCCAGATGGG + Intronic
900323248 1:2095270-2095292 CACAAGGGCCCCTGCCAGGAGGG - Intronic
900408408 1:2502373-2502395 CTGCCGGGCCCCTCCTGGGCTGG - Exonic
900644341 1:3702276-3702298 TAGCTGGGCCCCCTCCAGGAGGG - Intronic
901109864 1:6785705-6785727 CCGCCGGCCCCCTCCCCGGCCGG - Intronic
901237871 1:7677213-7677235 TACCCGAGCCCCACCCAGGAAGG + Intronic
901462200 1:9398472-9398494 CAGCCAGGTCCCACCCACGAGGG + Intergenic
902877968 1:19352405-19352427 CTGCAGGGCCCTTCCCCGGATGG + Intronic
903891255 1:26572009-26572031 CAGCCAGCCCCGCCCCAGGATGG + Intronic
904044137 1:27600186-27600208 CAGATGGGCCCCCCCCAGGGAGG - Intronic
904469915 1:30729872-30729894 CTGCCAGGGCCCTCCCAAGAGGG + Intergenic
905043629 1:34979304-34979326 CAGCCCGTCTCCTGCCAGGATGG - Intergenic
905293497 1:36939477-36939499 CAGACGGGAGCCTCCTAGGAGGG + Intronic
905813245 1:40928576-40928598 CAGGATGGCCCCTCCAAGGAAGG - Intergenic
907401161 1:54225786-54225808 GAGCCTGTCCCCTCCCGGGAGGG - Intronic
909047461 1:70727843-70727865 CAGGGAGGCCCCACCCAGGAAGG + Intergenic
909318605 1:74253766-74253788 CAGCCTCGGCCATCCCAGGAAGG + Intronic
912433647 1:109643478-109643500 CAACCGTGCACCTCCCAGGTAGG - Intergenic
912508715 1:110174127-110174149 CAGCCAGCCCTGTCCCAGGAAGG + Intronic
914171830 1:145232870-145232892 CAGCCGGGCCCCTCAGCGGTCGG + Intergenic
915479409 1:156174923-156174945 CAGCTGGCCCCCACCCAGGTGGG + Exonic
916606095 1:166343450-166343472 CAGCCTGGGCCAGCCCAGGAAGG + Intergenic
918789917 1:188813029-188813051 CAGCCTCGGCCATCCCAGGAAGG - Intergenic
919799825 1:201346948-201346970 CAGCCCTGCCCCCCCCAGAAAGG + Intergenic
923497018 1:234534574-234534596 CTGCAGGGCCCCTCCCCTGAAGG - Intergenic
924539627 1:244969849-244969871 CAGCCGGGCCGCTTCCCGGCGGG + Exonic
1062857829 10:788226-788248 CGGCTGGGGCCCTCCAAGGATGG - Intergenic
1066049173 10:31619173-31619195 CAGCCCAGCCCCACCCATGAGGG - Intergenic
1066629675 10:37446802-37446824 CAGCTGGGTCCCACCCAGGTTGG - Intergenic
1067549493 10:47223958-47223980 CAGCCGGGGAGCTCTCAGGATGG + Intergenic
1069593810 10:69657558-69657580 CAGACAAGCCTCTCCCAGGACGG + Intergenic
1070280081 10:75042285-75042307 CTGCCAGGCCCCTTCCATGAAGG + Intronic
1070593861 10:77819193-77819215 TAGCCAGTCCCCTCCCAGGCAGG + Intronic
1072429270 10:95356520-95356542 GAGCTGGGCCCCAGCCAGGAGGG - Intronic
1073123330 10:101134893-101134915 CAGCCGGTCCCTACCCTGGAAGG + Intronic
1074815065 10:117136944-117136966 CAGCCGAGGCCCCCCCAGGCCGG - Intronic
1075175748 10:120159193-120159215 CAGATAGACCCCTCCCAGGAGGG + Intergenic
1075655053 10:124155865-124155887 CAGCCAGGCCACTGCCCGGAAGG + Intergenic
1076404902 10:130205153-130205175 CAGCCGGGCCCAGCCAGGGATGG + Intergenic
1076634767 10:131875171-131875193 CTGCCGGGACCATGCCAGGAAGG + Intergenic
1076820839 10:132938833-132938855 CTCCGGAGCCCCTCCCAGGAGGG + Intronic
1077380667 11:2235554-2235576 CATCCTGGGCCCTCCCAGGGTGG - Intergenic
1077478726 11:2803147-2803169 CAGCCGGGCCCCCCCCCCCACGG + Intronic
1077487823 11:2847159-2847181 CTGCTGGGCCACTTCCAGGAGGG - Intronic
1078171053 11:8929474-8929496 CAGCCAGGCCCCTGCCATGCTGG + Exonic
1080588435 11:33700867-33700889 CAGCCCGGCCCCTAACAGGCGGG + Intronic
1083639295 11:64136672-64136694 CACCCGGGTCCCTCACAGGTCGG - Intronic
1083721793 11:64607142-64607164 CCTCCCGGGCCCTCCCAGGAGGG + Exonic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1083856055 11:65393741-65393763 CAGCCAGGGCCCTGCCAGCAAGG + Intronic
1083922574 11:65788457-65788479 CAGCCCAGCCCCTCCGAGGGGGG + Intronic
1084240745 11:67818035-67818057 CAGCCTCGGCCATCCCAGGAAGG + Intergenic
1084275727 11:68050079-68050101 CAGCCGTCCCACCCCCAGGAAGG - Intronic
1084358887 11:68657024-68657046 CTGCTGGGACCCTCCCAGAAGGG + Intergenic
1084672657 11:70616364-70616386 CATCCAGGCCCCTCCCAGGCTGG - Intronic
1086414159 11:86571913-86571935 CAGCCCAGCTCCTCCAAGGAAGG + Intronic
1088470729 11:110185751-110185773 CAGACTTGCCCCTCCCAGGTGGG + Intronic
1089461849 11:118658437-118658459 CTGCCCTGCCTCTCCCAGGAGGG - Exonic
1089466223 11:118688181-118688203 CTGCCCTGCCTCTCCCAGGAGGG - Intergenic
1090382435 11:126336796-126336818 CCTCCAGACCCCTCCCAGGAAGG + Intronic
1098574352 12:72024216-72024238 CAGCAGGGCCCTTGACAGGAAGG - Intronic
1101782068 12:107845568-107845590 CAGCCTCGCTCCTCCTAGGACGG - Intergenic
1101886736 12:108670420-108670442 CAGCGGGCTCCCTTCCAGGATGG + Intronic
1104580709 12:130008980-130009002 CAGCGGGGTCCCTCCAGGGAAGG - Intergenic
1104961113 12:132489254-132489276 CAGGCGGGCCCCTCCGAGCTCGG + Intergenic
1104975938 12:132552008-132552030 CAGCCCTGCCCCTTCCAGGCCGG - Intronic
1105604180 13:21913250-21913272 CAGCCAGGCCCCAGCCAGGAGGG + Intergenic
1105605206 13:21921075-21921097 CAGCCTCGGCCATCCCAGGAAGG + Intergenic
1105704514 13:22960926-22960948 GACCCCTGCCCCTCCCAGGAAGG + Intergenic
1106801069 13:33256291-33256313 CAGCAGGAGCCCTCTCAGGAAGG - Intronic
1107198486 13:37683579-37683601 CAGCCGTGCACCCCTCAGGAGGG + Intronic
1107548922 13:41457564-41457586 CAGCCGCGCCGCTCCCAGCACGG - Exonic
1108312517 13:49209951-49209973 CAGCAGTGCCACTACCAGGAAGG - Intergenic
1110264611 13:73523151-73523173 CAGCAGGGCAGCTCCCAGGCTGG + Intergenic
1111006630 13:82258041-82258063 CCGGCCGGCCCCTCCCAGTACGG - Intergenic
1113765765 13:112880338-112880360 CAGCAGGGCCGCTCCCATGAGGG - Intronic
1114178252 14:20343191-20343213 CCGCCGGGCCCCTCCCCGAAGGG + Intergenic
1114621584 14:24099317-24099339 CAGCCTGGCACCTGGCAGGAGGG - Intronic
1115409903 14:33062091-33062113 CTGCCAGGGCTCTCCCAGGATGG - Intronic
1118778071 14:68986282-68986304 CAGCCTGGGCCCTCCAAGGAGGG + Intergenic
1119539380 14:75428436-75428458 CTGCCGGGCGCCTCGCGGGAGGG - Intronic
1119781614 14:77279839-77279861 CAGCCGTGCCCCTCTCTGCATGG + Exonic
1119905448 14:78297967-78297989 CAGCCTGGCCCAGCGCAGGAAGG - Intronic
1120132693 14:80825156-80825178 CAACCGGGTCCCTCCCACAACGG + Intronic
1121528892 14:94638858-94638880 CAGCCTGGGCCCTGCCTGGAAGG - Intergenic
1122136984 14:99639107-99639129 CAGCCGGGCCCCTGCCTTCAGGG + Intergenic
1122235892 14:100330453-100330475 CAGCCCCACACCTCCCAGGACGG - Intergenic
1122417482 14:101557377-101557399 CAGACCTGCCCCTCCCAGGCTGG - Intergenic
1123020282 14:105394703-105394725 CAGCTGGGCCCCTCACAGCATGG - Exonic
1123036184 14:105472915-105472937 GAGGCAGGCCCCTCCCAGGGTGG - Intergenic
1123123665 14:105929607-105929629 CAGACGGGAGCCTCACAGGATGG - Intronic
1126670527 15:51111502-51111524 CAGCCTGGCCCCTGCCATCATGG + Intergenic
1127720208 15:61691790-61691812 CAGCAGGGGTCCTCCCAGGCAGG - Intergenic
1128285156 15:66430378-66430400 CAGCCTTGCCTCTGCCAGGAGGG - Intronic
1128322118 15:66701480-66701502 CGGCCGGGCCCCCTCCAGGCCGG - Intergenic
1128982261 15:72196708-72196730 GAGCCTGGCCCCTGCAAGGAGGG + Intronic
1129699575 15:77759951-77759973 CAGCCAGGGCCCACCCCGGAGGG + Intronic
1129803885 15:78438297-78438319 CCGCTGGCCCCCTCCCCGGAGGG + Exonic
1129892646 15:79081731-79081753 CAGCAGGGGCCCTCCCTGGAGGG - Intronic
1130093229 15:80838286-80838308 CAGCAGGGTCCCTGCCAGGAAGG - Intronic
1130997585 15:88912542-88912564 CAGCTGGGCCCCTTGCAGGCTGG - Intronic
1131030291 15:89180651-89180673 CAGCCGGGCCTCTGGGAGGAGGG - Intronic
1131060274 15:89400115-89400137 CTGCTGGGCCCCGCCCGGGAGGG - Intergenic
1131433230 15:92403031-92403053 AAGCCTGGCCCCTCCCCGAAGGG - Intronic
1131467189 15:92665082-92665104 CAGCCTGTCCCCCTCCAGGATGG - Intronic
1132630309 16:914159-914181 CACCCCGACCCCTCCTAGGAGGG + Intronic
1133008333 16:2896799-2896821 CAGCTCGGCACCTCCCAGGGTGG + Intronic
1133267086 16:4591803-4591825 CAGCAGGACCCCTACCAGGAGGG - Intronic
1134677041 16:16098052-16098074 CACCCTGGACCCTCCCAGGCTGG - Intronic
1136016079 16:27402098-27402120 CAGCTGGGCTCCTCCTGGGAGGG - Intergenic
1136932900 16:34435205-34435227 CAGCCAGTCTACTCCCAGGAAGG - Intergenic
1136971672 16:34976609-34976631 CAGCCAGTCTACTCCCAGGAAGG + Intergenic
1138588431 16:57986066-57986088 CAGCTCGCGCCCTCCCAGGAGGG - Intronic
1141261123 16:82454652-82454674 CAGCCAGGCCTACCCCAGGAAGG - Intergenic
1141428365 16:83957753-83957775 CAGCGGAGCCCCTCCCTGGCTGG - Intronic
1142218973 16:88843676-88843698 CAGCCGGGCCCCTCCCCCTCAGG - Intronic
1142403319 16:89872564-89872586 CGGCCTGGCCCCTCCCAGGATGG - Intergenic
1145047595 17:19630165-19630187 CAGCCAGGCCCCTCTAAGGTGGG - Intergenic
1146283918 17:31561631-31561653 CAGCCGGTCCCCTCCAGGGTGGG - Intergenic
1147151430 17:38516964-38516986 CCACCGGGCCCATCCCAGAATGG + Intergenic
1147183529 17:38701886-38701908 CAGCGGGTCCCCGCCCAGGCGGG + Intergenic
1147585314 17:41651158-41651180 CAGGTGGGCCTCTCCCAGGTGGG - Intergenic
1147884705 17:43676777-43676799 CAGCCTGACCCCTCCAAGGTGGG - Intergenic
1148462995 17:47848735-47848757 GAGTTGGGCCACTCCCAGGATGG + Intronic
1148741339 17:49894815-49894837 CTGGCAGGGCCCTCCCAGGATGG + Intergenic
1148760480 17:49997214-49997236 GGGCCGGCTCCCTCCCAGGATGG + Intergenic
1148847647 17:50538622-50538644 CAGCTGGGCCTCACACAGGAGGG + Intronic
1149563132 17:57623672-57623694 CAGCCTGGCCCCTCCCACACTGG - Intronic
1150643738 17:66965620-66965642 CGGCCGGCCCCGCCCCAGGATGG - Intronic
1150675984 17:67245925-67245947 CAGCCCGGACGCTCCCAGGGTGG - Intronic
1151599033 17:75094995-75095017 CCACCGGGCCCCTCCGAGGCCGG - Intronic
1151642442 17:75405783-75405805 CAGCCGGGCCCCTGCGGGTAGGG + Intergenic
1152554728 17:81047106-81047128 CCACCTGGCCTCTCCCAGGAGGG - Intronic
1152713422 17:81886432-81886454 CAGCCAGGCCCATCCCAGCGTGG + Intergenic
1152722597 17:81930177-81930199 CAGGCAGGGCCCTCCCAGGGTGG + Intergenic
1152760233 17:82103757-82103779 CAGCCAGGGTCCTCCCAGCAGGG - Intronic
1152813040 17:82391192-82391214 CGGCCGTCCCCCTCCCGGGAAGG + Intronic
1153922528 18:9804244-9804266 CAGCCTGTCCCCACCAAGGAGGG - Intronic
1157733860 18:50029306-50029328 CAGCCCGGAGCATCCCAGGAAGG + Intronic
1157990900 18:52495092-52495114 CAACTGGGCCCCTCCCCTGATGG + Intronic
1159656260 18:71032124-71032146 CAGCCTTGGCCATCCCAGGAAGG + Intergenic
1160523099 18:79520178-79520200 CCTCCGGGCCCCTCACGGGAGGG + Intronic
1160529941 18:79556929-79556951 CAGCAGCTCCCCTCCCAGCACGG + Intergenic
1160609178 18:80072915-80072937 CTGCTGGTCACCTCCCAGGAGGG + Intronic
1160894378 19:1395799-1395821 GAGTCAGGGCCCTCCCAGGAAGG - Intergenic
1161241813 19:3227139-3227161 CAGCCAGGCCCCACGCAGGTGGG - Intronic
1161249936 19:3275242-3275264 CAGCCCAGCCCCACCCAGCAGGG + Intronic
1161366339 19:3881831-3881853 CAGCCAGGCCCTTCCCGCGAGGG - Intronic
1161458075 19:4379977-4379999 TAGCCAGGCTCCTCCCAGGGTGG + Intronic
1162384644 19:10353716-10353738 CAGCAGAGCCCCTCCAAGGTCGG + Intronic
1162567408 19:11451837-11451859 GAGCCTGGCCCCCCCCAGGGTGG + Exonic
1163483464 19:17572620-17572642 CAACCTGGCACCTCCCAGGGCGG - Intronic
1163756831 19:19111331-19111353 CAGGCGGACCCTGCCCAGGATGG + Exonic
1164955793 19:32382912-32382934 CAGTCTGGCCCCTCCTAGCATGG + Exonic
1165749465 19:38251364-38251386 CAGCCAAGCCCCTCCCACGACGG - Exonic
1166071928 19:40393006-40393028 CACTCTGGCCCCACCCAGGAAGG - Intergenic
1166422871 19:42652396-42652418 CAGCAGGGTCCCTCCCAGCCTGG + Intronic
1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG + Exonic
1166931354 19:46303531-46303553 CAGCCAGCCCCCTCCCAGCAGGG + Intronic
1167269927 19:48500943-48500965 CTGCCGCACCCCACCCAGGATGG - Intronic
1167562602 19:50234742-50234764 CAGCAGGGCAGCTGCCAGGAGGG - Intronic
1168258356 19:55179407-55179429 CAGCCGGGCTCCTCTCAAGCGGG + Intronic
1168642401 19:58038911-58038933 CAGCAGGGCCCCAGCAAGGAGGG + Intronic
924969245 2:109138-109160 CTGCTGGGTCCCACCCAGGACGG + Intergenic
926097434 2:10091344-10091366 CGGCCTCGCCCGTCCCAGGAAGG - Intergenic
926150843 2:10424860-10424882 CAGCCAGGCACCTTCCAGGGTGG - Intronic
928190155 2:29157703-29157725 CAGAGGGTCCTCTCCCAGGATGG + Intronic
929576368 2:43055284-43055306 AAGCCGGGCCCTTGGCAGGAAGG - Intergenic
929966864 2:46542889-46542911 CAGCGGCTCCCCTCGCAGGAGGG - Exonic
934149739 2:89134927-89134949 CAGCTGGGCCACTCCAAGCAGGG + Intergenic
936020775 2:108993347-108993369 CAGCTGAGCCCAGCCCAGGAAGG + Intergenic
936484044 2:112911417-112911439 CAGCCTGCTCTCTCCCAGGAGGG + Intergenic
936514423 2:113172948-113172970 CAGCCGCACCCCTCCCTGCAGGG - Intronic
937059249 2:118969313-118969335 CAGCTGGGCCCCTCAGATGAAGG + Intronic
938195037 2:129319433-129319455 CAGCAGGAGCCCTCCTAGGAGGG - Intergenic
939178680 2:138780461-138780483 TTGCCGGCCCCCTCCGAGGAGGG - Intergenic
939898852 2:147826803-147826825 CAGCCTCGGCCATCCCAGGAAGG - Intergenic
946338495 2:219054336-219054358 GAGCCAGGCCTCTCCGAGGAGGG + Intergenic
946422025 2:219570673-219570695 CAGCCGGGCCGCGCCGAGGACGG - Exonic
947010250 2:225558078-225558100 CAGCCAGACCACTCCCTGGAGGG - Intronic
948789073 2:240367972-240367994 CAGCTGGGCCCCTTCCAGCTGGG - Intergenic
948869867 2:240792416-240792438 GAGCTGGGCCCCTCCAAGGCCGG + Intronic
1172100612 20:32482700-32482722 CACCCCGTCCCCTCCCGGGAGGG + Intronic
1172359298 20:34301224-34301246 CAGCCGGGCCCCTCCCAGGAGGG - Intronic
1175416566 20:58805130-58805152 GAGCCCAGCCCCTCCCTGGATGG + Intergenic
1175518261 20:59583063-59583085 CAGCCGGGGGCATACCAGGATGG + Intronic
1177738177 21:25119137-25119159 GAGGCGGGCCACTCCCAAGATGG - Intergenic
1178441647 21:32603349-32603371 CAGCTGAGCCCCTCCCAGCAGGG + Intronic
1178697678 21:34808349-34808371 CAGCCTGCCACCTCCCAGGCTGG - Intronic
1179279307 21:39920890-39920912 GGGCTGTGCCCCTCCCAGGATGG + Intronic
1179553875 21:42160295-42160317 GAGGCGGGGGCCTCCCAGGATGG - Intergenic
1179886202 21:44315233-44315255 CATCCAGGCCACTTCCAGGAGGG - Intronic
1181116518 22:20635359-20635381 CAGCTGGGCCACTCTCAGGCTGG - Intergenic
1181921745 22:26326189-26326211 CAGCAGGTCCCCTCCCAAGTAGG - Intronic
1183282127 22:36937630-36937652 CAGCCGGAGCCCCCACAGGAGGG + Exonic
1183382740 22:37498543-37498565 CAGCCGCGCCCTCCCCAGGCTGG - Intronic
1183477980 22:38046446-38046468 CAGCGGGGCCCCTCCCTCCAAGG + Intergenic
1183479833 22:38057450-38057472 CAGCCGGGTCCCGGCCAGGCTGG - Exonic
1183489260 22:38108079-38108101 CTGCCGGGCTGCTCCCAGGCTGG - Intronic
1183642225 22:39099703-39099725 CAGCCGGTGCCCTCCCAGGTGGG + Intronic
1183725884 22:39589569-39589591 CACACGGGCACCTTCCAGGAAGG + Intronic
1184673075 22:46025850-46025872 CAGGCGACCGCCTCCCAGGAAGG + Intergenic
1184772835 22:46607919-46607941 CAGCCGGCACCAGCCCAGGAAGG - Intronic
1185171339 22:49296331-49296353 GTGCAGGGCCCATCCCAGGACGG - Intergenic
1185193157 22:49451667-49451689 CAGCCAGGCCCCTCCTGGGCAGG + Intronic
950016436 3:9757779-9757801 CAGCTGGGCACCAGCCAGGAGGG - Exonic
950264301 3:11562954-11562976 CAGCCAGGCCCATTCCAGGCTGG + Intronic
950711678 3:14817691-14817713 CAGCCTGGCTCCTAACAGGAGGG - Intergenic
953753881 3:45630486-45630508 CTGCAGGGCCCCTCACAGAAGGG + Intronic
954237504 3:49268023-49268045 GGGCCTGGCCCCTCCCAGGTGGG - Intergenic
954717197 3:52532852-52532874 CAGCCGGCCCCCTCCAAGAAGGG + Intronic
954882706 3:53846436-53846458 CCGCTGGCCCCCTCCCAGGCTGG - Intergenic
959598518 3:108153394-108153416 CAGCCTGGCCCCCTCCCGGAAGG + Intergenic
961298175 3:125903875-125903897 CAGCCTCGGCCATCCCAGGAAGG - Intergenic
961545681 3:127631226-127631248 CTGCAGGGCCCCTCCCATGTTGG + Intronic
964751802 3:160060466-160060488 CAGCCTCGGCCATCCCAGGAAGG - Intergenic
966904772 3:184514076-184514098 GAGTCAGCCCCCTCCCAGGAGGG + Intronic
968472179 4:787188-787210 CAGCAGGGCCACTCCCTGGCAGG + Intronic
968549225 4:1213842-1213864 CATCAGGGCTCCTCCCACGAGGG - Intronic
968576240 4:1367565-1367587 CAGCCTGGGCCCTCCCTGGGCGG - Intronic
968699358 4:2047366-2047388 CGGCCGCTCCGCTCCCAGGAAGG + Intergenic
968980347 4:3845295-3845317 CCACCGGGTCCCTCCCACGAGGG + Intergenic
969255133 4:5996238-5996260 GATCCAGGCCCCTCCCAAGAAGG - Intergenic
969276277 4:6137884-6137906 CTGCCAGGCCCATGCCAGGAAGG - Intronic
969325811 4:6443196-6443218 CGGCCGGGCACCTGCCTGGAAGG - Intronic
969422309 4:7104492-7104514 CAGCAGGGAGCCACCCAGGATGG - Intergenic
969442136 4:7223728-7223750 AAGCCCAGCCCTTCCCAGGAAGG - Intronic
969455071 4:7295826-7295848 CAGCCTGGCCAATCCCAGGTGGG - Intronic
969676327 4:8616429-8616451 GAGCAGGGGCTCTCCCAGGAGGG - Intronic
971372303 4:26028899-26028921 CTGCCGGGCGCCACCCAGGAGGG + Intergenic
976224019 4:82781034-82781056 CAGCAGGGCCCCCCAGAGGAGGG + Intronic
978207243 4:106092809-106092831 CAGCCTCGGCCATCCCAGGAAGG + Intronic
982096774 4:151930552-151930574 CAGCCTGGCTCCTAACAGGAAGG - Intergenic
984426764 4:179597384-179597406 CAGCCAGCCTCCTCCCAGGAAGG - Intergenic
984952840 4:185019587-185019609 CTTGCGGGCCCCTCCCAGGCGGG + Intronic
985571248 5:646699-646721 CGGCCCTGCCCCTCCCATGAGGG - Intronic
985952712 5:3235885-3235907 GAGCATGGCCCCTCCCAGGAAGG - Intergenic
986051006 5:4090301-4090323 CAGGCGAGGCCCTCCCAGGGAGG - Intergenic
986848175 5:11780042-11780064 GAGTGGGGTCCCTCCCAGGAAGG - Intronic
991927462 5:71719322-71719344 CAGCAGGGCGGCGCCCAGGAGGG - Exonic
992209844 5:74468004-74468026 CAGCAGTGACCTTCCCAGGAAGG - Intergenic
998038786 5:138937777-138937799 CACCCATGCCTCTCCCAGGATGG + Intergenic
998610998 5:143688102-143688124 AAGCAGGGCCTCTCTCAGGAAGG - Intergenic
999194584 5:149773497-149773519 CAGCCTGGCCCCTGCCTGGCTGG + Intronic
999282423 5:150374414-150374436 CAGCCAGGCCCGTCCCCAGAAGG + Intronic
1001695766 5:173668576-173668598 CAGACGCTGCCCTCCCAGGAAGG - Intergenic
1001798284 5:174520310-174520332 CAGGCAGGCCCCACCCAAGAAGG + Intergenic
1001843511 5:174901464-174901486 CAGCCTCGGCCATCCCAGGAAGG - Intergenic
1001992947 5:176133101-176133123 CAGCTGGGCCAGGCCCAGGAAGG + Intergenic
1002163870 5:177332776-177332798 CAGTGGGCCCCATCCCAGGATGG - Intronic
1002327824 5:178420996-178421018 CCGCAGGGCCCAGCCCAGGAGGG + Intronic
1002474680 5:179457792-179457814 CAGCGGGGCCACTCCCTGGAAGG - Intergenic
1003005476 6:2377098-2377120 CATGCGCGCCCCTCCGAGGACGG + Intergenic
1004094792 6:12542340-12542362 CAGCCGGGCCTGTTGCAGGATGG - Intergenic
1006101538 6:31688969-31688991 CAGCCCACCCCTTCCCAGGAAGG + Intronic
1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG + Exonic
1007622377 6:43222950-43222972 CAGCCCGGCCCCTCCCAGACAGG + Intronic
1008254023 6:49275385-49275407 CAGCCTTGGCCATCCCAGGAAGG - Intergenic
1013514518 6:110874094-110874116 AAGCCGGGGCCCTCCAAGGCTGG + Intronic
1018065431 6:160122284-160122306 CCGCTGGGTCCCTGCCAGGATGG + Exonic
1018580205 6:165301814-165301836 CAGGAGGGCCCCGTCCAGGAGGG + Exonic
1018752667 6:166821320-166821342 CAACCAGGCCCCTCCCCAGAGGG - Intronic
1018961758 6:168454508-168454530 CAGTCTGGCCCTACCCAGGATGG - Intronic
1019287941 7:232941-232963 GATCTGGGCCCCTCTCAGGAAGG - Intronic
1019383154 7:738863-738885 CTGCGGGGCCCCACCCAGGACGG - Intronic
1019712776 7:2525023-2525045 CAGCCCAGCCCCTTCCAGGGCGG - Intronic
1020073663 7:5243511-5243533 CAGCCTGGGCGCTCCCACGAAGG - Intergenic
1022123093 7:27329021-27329043 CAGTGTGGCCACTCCCAGGATGG + Intergenic
1022489393 7:30805146-30805168 CAGCAGGGCCCCTGCCGGGAAGG + Intronic
1023862520 7:44224961-44224983 CTGCCCAGCCCCTCCCAGGAGGG + Intronic
1023862778 7:44225939-44225961 CAGCCTGGCTCCTCCCTGGCCGG + Intronic
1023984315 7:45086060-45086082 CCGCCGGTCCCCTCCCAGGATGG + Exonic
1024022820 7:45387086-45387108 CTGCCGACCCCCTCCCAGGTAGG - Intergenic
1026947935 7:74328116-74328138 CAGACGGACCCCTCCCTGGTCGG + Intronic
1028392612 7:90334364-90334386 CGGCCTCGCCCATCCCAGGAAGG - Intergenic
1032344445 7:131106190-131106212 GAGCCGGGCGCCTCCCACGCAGG - Intergenic
1032669784 7:134072435-134072457 CAGCCTGGTCTCTCACAGGAGGG + Intergenic
1034635594 7:152565050-152565072 CAGCCTGGCACCTCTGAGGAAGG + Intergenic
1035225356 7:157429582-157429604 CAGCTTGGACCTTCCCAGGATGG + Intergenic
1035225680 7:157430895-157430917 CAGCTTGGACCTTCCCAGGATGG + Intergenic
1035269142 7:157709758-157709780 CAGCCCGGCCCATCCACGGATGG + Intronic
1036723640 8:11200718-11200740 CAGCCGGGGCCCCCCCATGATGG - Exonic
1038026852 8:23598549-23598571 CTGCCTTGCCCCTCCTAGGAAGG - Intergenic
1039422331 8:37453638-37453660 CTGCCAGGCCCTTCCAAGGATGG - Intergenic
1039964120 8:42271478-42271500 CACCCGGGCCGCACCCACGAGGG - Intronic
1041746394 8:61212770-61212792 CAGCCGGGCTGCTGCCAGCAGGG + Intronic
1043871586 8:85438955-85438977 CAGCCGCGACCCGGCCAGGAAGG + Intronic
1044821044 8:96155988-96156010 CAGCCGGGCTATTCCCAGAATGG + Intronic
1047124678 8:121947979-121948001 CAGCCTCGGCCATCCCAGGAGGG - Intergenic
1048970333 8:139641756-139641778 CAGCTGGTCCTCCCCCAGGAGGG - Intronic
1049192438 8:141295831-141295853 CAGCCCTGCACCGCCCAGGATGG + Intronic
1049239121 8:141528007-141528029 CCGCTGGGCCTCTCCCAAGATGG + Intergenic
1049476818 8:142800723-142800745 CATGCGGGCACCTCCCAGGAGGG + Intergenic
1049646768 8:143739096-143739118 CAGCCAGCCCCCAGCCAGGATGG - Intergenic
1049712833 8:144074008-144074030 CAGAAGTGCCCCTCCCTGGAAGG - Intergenic
1052903659 9:33816742-33816764 CGACCAGGCCCGTCCCAGGATGG + Intergenic
1056761533 9:89418993-89419015 CACCCAGGCCCCTCACTGGACGG + Intronic
1057490622 9:95516987-95517009 GGGCAGGGCGCCTCCCAGGAAGG - Intronic
1057885740 9:98828219-98828241 CAGCTGGGTCACACCCAGGAAGG - Intronic
1059335313 9:113565187-113565209 CAGCTGGGCCCCTCGCGGGGTGG + Intronic
1060518972 9:124283165-124283187 CAGCCCTGACCCTCTCAGGAAGG + Intronic
1061042073 9:128146116-128146138 CAGCCCAGCTCCTCTCAGGAGGG + Intergenic
1061178064 9:129009219-129009241 CAGCCTGGCCCCTCCGGGGGAGG - Exonic
1061859396 9:133460303-133460325 CTGCCGGGCGCCTCCCGGGGCGG + Intronic
1061928693 9:133820974-133820996 CAGCCCGGCCCCTCCCCTGTGGG - Intronic
1062030443 9:134359753-134359775 CAGCCCCGCCCCTCCCAGCAAGG + Intronic
1062147037 9:134995306-134995328 CATCAGGGCCCTTCCCAGGCAGG - Intergenic
1062216886 9:135394073-135394095 CTGCCTTGCCCGTCCCAGGATGG + Intergenic
1062556644 9:137115862-137115884 CTGCCGGGGCCCCCGCAGGACGG + Intergenic
1203740121 Un_GL000216v2:171315-171337 CAGCCTGGGCCCGCTCAGGAGGG + Intergenic
1186533184 X:10317971-10317993 CAACCGGCCCCATCTCAGGACGG + Intergenic
1189333809 X:40158147-40158169 CAGCCGGGGCCCGTCCAGGTAGG + Intronic
1189470327 X:41308945-41308967 CAGCCGTGCCCCTACCATGCTGG + Intergenic
1190233156 X:48597777-48597799 CACCCGGGCGCTGCCCAGGAAGG + Intronic
1190440221 X:50469494-50469516 GCGCCGGGCACCTCCCTGGAGGG + Intronic
1194384320 X:93235673-93235695 CAGCCTCGGCCATCCCAGGAAGG - Intergenic
1201763493 Y:17561122-17561144 CAGCCGGTTTCCTCCCATGATGG - Intergenic
1201838060 Y:18344868-18344890 CAGCCGGTTTCCTCCCATGATGG + Intergenic