ID: 1172360759

View in Genome Browser
Species Human (GRCh38)
Location 20:34311425-34311447
Sequence GACCGGGACCTGCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172360759 Original CRISPR GACCGGGACCTGCTTCTGCC TGG (reversed) Intronic
900342968 1:2197349-2197371 GACCCCGCCCTGCTTCTGCTCGG - Intronic
901301013 1:8200255-8200277 GGCCGGGCCCTGCGTCTCCCCGG + Intergenic
901440266 1:9273424-9273446 GACCTTGCCCTGCTTCTGCGTGG - Intergenic
901914036 1:12484197-12484219 GGCAGGGACCTGCTTGGGCCAGG + Intronic
902845344 1:19106030-19106052 GAAAGAGCCCTGCTTCTGCCTGG + Intronic
904362936 1:29990223-29990245 GACTGGGGCCTGCTTCTGATTGG + Intergenic
905091394 1:35433894-35433916 GACCGGCACCTGCTGCTTCGGGG - Exonic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
906256579 1:44355159-44355181 GAGCTGGCCCTGCCTCTGCCTGG - Exonic
906841247 1:49141941-49141963 GACCAGTACCTGTTTGTGCCTGG + Intronic
912241559 1:107915471-107915493 GATTGGGACCTGCCTCTGTCTGG - Intronic
912472454 1:109914964-109914986 GACAGCAACCTGATTCTGCCTGG - Intronic
914958897 1:152189014-152189036 GACCGGGCCCAGCAGCTGCCTGG - Intergenic
915599019 1:156910691-156910713 GAACGGGACCTGCTACTGCCTGG + Exonic
915734493 1:158076114-158076136 GACCCAGACCCGCTTCAGCCAGG + Exonic
915949281 1:160177418-160177440 GGCTGGGACTTGCTTCTGGCTGG - Intronic
917150803 1:171942804-171942826 CACTGGCTCCTGCTTCTGCCTGG - Intronic
920366158 1:205449426-205449448 GATCAGGCCCTGCCTCTGCCAGG + Intronic
1067348922 10:45458034-45458056 GCCTGGGTCCTGCCTCTGCCTGG - Exonic
1070694628 10:78552734-78552756 TACCGGGAGCTGCTTCTGTCAGG - Intergenic
1074531274 10:114300495-114300517 GACCTGGGCCTGAGTCTGCCGGG + Exonic
1076979708 11:197955-197977 GACCTGGACCTTTCTCTGCCAGG + Intronic
1077605740 11:3610368-3610390 GACTGGAACCTGGTTCTGCATGG - Intergenic
1083998085 11:66282105-66282127 GACCAGGCCCTGCTCCTCCCTGG + Intronic
1084756886 11:71245597-71245619 GACCGGTGCCTTCTTCTGCACGG + Intronic
1085014939 11:73167740-73167762 GAGCTGGACCTGCTGCTGCAGGG + Intergenic
1085033130 11:73284554-73284576 GCCCTGGGGCTGCTTCTGCCTGG - Intronic
1088777581 11:113100467-113100489 GCACGTGACCTGCTTCTTCCTGG - Intronic
1090557360 11:127890830-127890852 GACCAGGGCCTGCTGCTGACTGG - Intergenic
1091004279 11:131938488-131938510 GGCAGGGACCGGCTTGTGCCAGG + Intronic
1093805637 12:23430035-23430057 GAACAGGGGCTGCTTCTGCCAGG - Intergenic
1096584565 12:52611418-52611440 GACCTGGACCCACCTCTGCCAGG - Intronic
1097086616 12:56473462-56473484 TAGGGGGACCAGCTTCTGCCAGG - Exonic
1101131791 12:101697755-101697777 GGCCGGGTCCTGCGACTGCCGGG - Exonic
1102919274 12:116779663-116779685 CCCCGGGACCTGCTTCTCCCAGG + Intronic
1104770197 12:131356721-131356743 GGTCGGGACCTGCTTCTCCTTGG - Intergenic
1104970444 12:132528436-132528458 GACCGGCACCTGCCTCACCCCGG + Intronic
1106035158 13:26037553-26037575 GACTGGTACCAGCTGCTGCCAGG - Intergenic
1116870761 14:50067474-50067496 GACCTGTCCCTGGTTCTGCCAGG + Intergenic
1116932283 14:50702449-50702471 GCCGGGGTACTGCTTCTGCCTGG + Intergenic
1117377621 14:55129943-55129965 CACCGGGACCAGCTGCGGCCGGG + Intronic
1118317411 14:64733626-64733648 CCCCGGGTCCTGCTTCTGCTCGG - Intronic
1122775042 14:104113355-104113377 GGGCGGGCCCTGCTGCTGCCCGG + Exonic
1125518055 15:40333940-40333962 GAAGGGCACTTGCTTCTGCCAGG + Exonic
1125977412 15:43967031-43967053 GACATGGACTTGCTTCTGGCTGG + Intronic
1127279576 15:57477596-57477618 TACAGGGACCTCTTTCTGCCTGG + Intronic
1129388389 15:75208145-75208167 GTCTGTGACCTGCTTCAGCCTGG + Exonic
1129539411 15:76338493-76338515 GCCCGCGGCCTGCATCTGCCCGG + Exonic
1132793324 16:1706029-1706051 GGCCGGGAGCTCCCTCTGCCCGG + Intergenic
1133769349 16:8858797-8858819 GCCTGAGACCTGCATCTGCCAGG + Intronic
1136003495 16:27313599-27313621 CTCCAGGACCTGCTCCTGCCTGG - Intergenic
1136536450 16:30902504-30902526 GACCTGGGCCAGCTGCTGCCCGG + Exonic
1137691318 16:50430027-50430049 GACTGGTACCTGCTTCTGAAAGG + Intergenic
1141038921 16:80654998-80655020 GACCGTGCCCTGGATCTGCCTGG - Intronic
1141462040 16:84183462-84183484 GCCCGGGACCTGCTTTTCCGCGG - Exonic
1143787296 17:9265433-9265455 GCCCGGGACCTGCCTGAGCCAGG - Intronic
1145239634 17:21232914-21232936 GACTGGAACCTGGGTCTGCCTGG - Intergenic
1147880220 17:43648609-43648631 GACCGGATTCTGTTTCTGCCAGG + Intronic
1150478911 17:65494665-65494687 AACCTGGACCTGCTTGTCCCAGG + Intergenic
1150699355 17:67434033-67434055 GAACGGGACCTGGTTCTCCAGGG + Intronic
1151993529 17:77593928-77593950 CTCAGGGACCTGATTCTGCCGGG + Intergenic
1152037640 17:77883255-77883277 GGCGGGGACCTGCTTTTCCCAGG + Intergenic
1152284853 17:79406447-79406469 GACAGCCACCTGCTTCTCCCTGG + Intronic
1155240293 18:23857967-23857989 GACCGGGGCTTGCCTCTGCAAGG + Exonic
1156488927 18:37485235-37485257 GAGCGGGAGCTGCCTCCGCCGGG - Intronic
1161061101 19:2215375-2215397 CACCAGCACCTGCCTCTGCCTGG - Intronic
1161128729 19:2575273-2575295 GACAGGGACTTGCTGTTGCCAGG + Intronic
1162572202 19:11480229-11480251 GATCGGGCCCTGCGTTTGCCTGG + Intronic
1162722904 19:12673015-12673037 CACCTGCACCTGCTTCAGCCGGG + Exonic
1163483475 19:17572693-17572715 CACAGGGACTTGCATCTGCCTGG - Intronic
1166609778 19:44180807-44180829 GACTTAGACCTGCTTCTGTCAGG + Intergenic
1167035894 19:46994772-46994794 TACGGGGACCCGCTCCTGCCTGG - Intronic
1168364692 19:55776027-55776049 GACAGGGTCTTGCTGCTGCCTGG + Intergenic
1168411999 19:56146182-56146204 GATGGTGACCTGCTGCTGCCAGG + Intronic
926804087 2:16688532-16688554 GACGGGGACCTGACCCTGCCTGG - Intergenic
927498495 2:23565995-23566017 GGCAGGGGCCGGCTTCTGCCAGG + Intronic
936618486 2:114072238-114072260 GACTGGTACCTGCTTCTTGCAGG + Intergenic
938069450 2:128300698-128300720 GACTGGGCCCAACTTCTGCCCGG + Intronic
946386277 2:219386302-219386324 GACCGTGACCTGACTCTGGCTGG - Exonic
946766157 2:223042874-223042896 GAATGGTCCCTGCTTCTGCCTGG - Intergenic
947712298 2:232323193-232323215 GACTGGCACCTGGTTCTGCTTGG + Intronic
948473705 2:238203358-238203380 GCACGGGGCCTGCTCCTGCCTGG - Intronic
948643796 2:239391439-239391461 GCCCGGGGCCTGCTGCTGACCGG - Intronic
949058649 2:241943718-241943740 GACCGGCTCCAGCTTCTGCCAGG - Intergenic
1169100709 20:2946153-2946175 CACTGGTAACTGCTTCTGCCTGG - Intronic
1170210318 20:13840852-13840874 AGCCGGGACCTGCTTCAGCCTGG - Intergenic
1171484304 20:25476457-25476479 GCCCGGGAGCTGCCTCTGCTGGG - Exonic
1172159105 20:32853052-32853074 GTACGGGAACTGCTTCAGCCTGG - Intergenic
1172360759 20:34311425-34311447 GACCGGGACCTGCTTCTGCCTGG - Intronic
1173522938 20:43712523-43712545 GCCCTGGACCTGCTTCTGTGAGG + Intronic
1173640858 20:44601030-44601052 CACAGGCACCTGCTACTGCCGGG - Intronic
1176001025 20:62831251-62831273 GGCCGTGCCCCGCTTCTGCCCGG - Intronic
1176059988 20:63168302-63168324 GACCAGGAGGTGCTGCTGCCTGG - Intergenic
1178581032 21:33838926-33838948 GTCTGGGATCGGCTTCTGCCTGG + Intronic
1180468130 22:15635252-15635274 GTCCGGGAGCTGCAGCTGCCTGG + Intergenic
1183082819 22:35467777-35467799 GACCCTGCCCTCCTTCTGCCAGG - Intergenic
1185108162 22:48885797-48885819 GCCCAGGACCTGCTGCTCCCTGG + Intergenic
953541946 3:43828269-43828291 CACCTGGAGCTGCATCTGCCAGG + Intergenic
954035747 3:47850115-47850137 GACTGAGCCCTGCTTCTGCTGGG + Exonic
954406040 3:50345551-50345573 GACCTGGAACTGCTGCTGCCCGG - Exonic
956235970 3:67071185-67071207 GACCGGGAAATGCTTCTCTCAGG - Intergenic
959579740 3:107971266-107971288 TGCCTGGAGCTGCTTCTGCCTGG - Intergenic
961647139 3:128398616-128398638 GGCAGGGACCTGCCCCTGCCGGG + Intronic
962702519 3:138013234-138013256 GACCTGGTCCTCCTCCTGCCTGG + Intronic
966946259 3:184779119-184779141 GACCCGCACCCGCTTCTGCGGGG - Intergenic
969479691 4:7441356-7441378 TACAGAGGCCTGCTTCTGCCTGG + Intronic
976095344 4:81502523-81502545 CACCGTGAACTGCTTCTGCATGG + Intronic
982260499 4:153489996-153490018 CACCAAGACCTGCTTCAGCCTGG - Intronic
983576838 4:169270333-169270355 GGCCGCGACCGGCTCCTGCCGGG - Intronic
983904712 4:173170118-173170140 GACCCTGACCTGCTTCCCCCCGG + Intronic
995837716 5:116414915-116414937 CACCGGCACCTGCATATGCCAGG - Intergenic
1001307279 5:170584632-170584654 CACTGTGACCTGCCTCTGCCGGG - Intronic
1002541129 5:179907415-179907437 GACCGGCGGCGGCTTCTGCCCGG - Intronic
1007043717 6:38750217-38750239 GAACTGGACCTGCTTCTAACAGG - Intronic
1011079315 6:83472234-83472256 GACTGGTACTTGATTCTGCCTGG - Intergenic
1017905878 6:158757239-158757261 CACCGAGACCTGCAGCTGCCGGG - Exonic
1018793021 6:167163922-167163944 CACGGGGACTTGCTGCTGCCTGG - Intronic
1019225785 6:170506907-170506929 GACCGTGGACTGCTTCTGGCCGG - Intergenic
1019480640 7:1265172-1265194 CACAGGGAGCTGCTTCGGCCAGG + Intergenic
1020187542 7:5970548-5970570 GACTGGGTCCTGCTCCTTCCCGG - Intronic
1020295376 7:6754222-6754244 GACTGGGTCCTGCTCCTTCCCGG + Intronic
1025859463 7:65312905-65312927 GACAGGGCCCTGCTTCTCCCAGG + Intergenic
1028741054 7:94276039-94276061 GACTGGGACCAGCTGCTGACAGG + Intergenic
1030991617 7:116307963-116307985 GACCAGGACCTGCTCTTGCCTGG + Intronic
1035168176 7:157003739-157003761 GCCCAGCAGCTGCTTCTGCCCGG + Intronic
1036689939 8:10939056-10939078 TCCCAGGACCTGCTTCTCCCAGG + Intronic
1045905268 8:107337666-107337688 GACCTGGAAATACTTCTGCCAGG + Intronic
1052903950 9:33817639-33817661 GACCGGGGCCCGGTGCTGCCCGG + Exonic
1053662520 9:40293619-40293641 GACTGGGTCCAGGTTCTGCCTGG - Intronic
1053912973 9:42923794-42923816 GACTGGGTCCAGGTTCTGCCTGG - Intergenic
1054374649 9:64439844-64439866 GACTGGGTCCAGGTTCTGCCTGG - Intergenic
1054522091 9:66082665-66082687 GACTGGGTCCAGGTTCTGCCTGG + Intergenic
1056587698 9:87939058-87939080 CAGCGGGAGCTTCTTCTGCCGGG - Intergenic
1056609172 9:88113881-88113903 CAGCGGGAGCTTCTTCTGCCGGG + Intergenic
1056796428 9:89662031-89662053 CACAGGAACCTGCTTCTGCCTGG + Intergenic
1058764539 9:108168614-108168636 AACCAGGACCTGCTGCTGCCAGG + Intergenic
1062597515 9:137305909-137305931 GACCGGGATCTGCTTCCGGGAGG - Intergenic
1192266876 X:69544583-69544605 GACCAGGATCTACTTCTGCCAGG - Intergenic