ID: 1172364433

View in Genome Browser
Species Human (GRCh38)
Location 20:34338129-34338151
Sequence ACTACAGGCTAGTGTATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172364433_1172364438 0 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364438 20:34338152-34338174 CCCAGTTACTCAGGAGGCTGAGG 0: 2711
1: 101015
2: 206335
3: 238657
4: 153381
1172364433_1172364444 29 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data
1172364433_1172364440 7 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364440 20:34338159-34338181 ACTCAGGAGGCTGAGGTTAGAGG 0: 19
1: 1129
2: 12745
3: 29714
4: 47064
1172364433_1172364436 -6 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364436 20:34338146-34338168 TGTAGTCCCAGTTACTCAGGAGG 0: 1205
1: 46272
2: 166441
3: 223615
4: 206673
1172364433_1172364434 -9 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364434 20:34338143-34338165 GCCTGTAGTCCCAGTTACTCAGG 0: 1500
1: 78461
2: 199885
3: 240481
4: 175823
1172364433_1172364443 26 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364443 20:34338178-34338200 GAGGATCACGTGACCCCGGGAGG No data
1172364433_1172364442 23 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364442 20:34338175-34338197 TTAGAGGATCACGTGACCCCGGG No data
1172364433_1172364441 22 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364441 20:34338174-34338196 GTTAGAGGATCACGTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172364433 Original CRISPR ACTACAGGCTAGTGTATCAC AGG (reversed) Intergenic
No off target data available for this crispr