ID: 1172364435

View in Genome Browser
Species Human (GRCh38)
Location 20:34338144-34338166
Sequence TCCTGAGTAACTGGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 642820
Summary {0: 1182, 1: 46241, 2: 165986, 3: 222769, 4: 206642}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172364435_1172364444 14 Left 1172364435 20:34338144-34338166 CCTGTAGTCCCAGTTACTCAGGA 0: 1182
1: 46241
2: 165986
3: 222769
4: 206642
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data
1172364435_1172364440 -8 Left 1172364435 20:34338144-34338166 CCTGTAGTCCCAGTTACTCAGGA 0: 1182
1: 46241
2: 165986
3: 222769
4: 206642
Right 1172364440 20:34338159-34338181 ACTCAGGAGGCTGAGGTTAGAGG 0: 19
1: 1129
2: 12745
3: 29714
4: 47064
1172364435_1172364442 8 Left 1172364435 20:34338144-34338166 CCTGTAGTCCCAGTTACTCAGGA 0: 1182
1: 46241
2: 165986
3: 222769
4: 206642
Right 1172364442 20:34338175-34338197 TTAGAGGATCACGTGACCCCGGG No data
1172364435_1172364441 7 Left 1172364435 20:34338144-34338166 CCTGTAGTCCCAGTTACTCAGGA 0: 1182
1: 46241
2: 165986
3: 222769
4: 206642
Right 1172364441 20:34338174-34338196 GTTAGAGGATCACGTGACCCCGG No data
1172364435_1172364443 11 Left 1172364435 20:34338144-34338166 CCTGTAGTCCCAGTTACTCAGGA 0: 1182
1: 46241
2: 165986
3: 222769
4: 206642
Right 1172364443 20:34338178-34338200 GAGGATCACGTGACCCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172364435 Original CRISPR TCCTGAGTAACTGGGACTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr