ID: 1172364437

View in Genome Browser
Species Human (GRCh38)
Location 20:34338152-34338174
Sequence CCTCAGCCTCCTGAGTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 708363
Summary {0: 2930, 1: 105244, 2: 210342, 3: 240613, 4: 149234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172364437_1172364448 28 Left 1172364437 20:34338152-34338174 CCCAGTTACTCAGGAGGCTGAGG 0: 2930
1: 105244
2: 210342
3: 240613
4: 149234
Right 1172364448 20:34338203-34338225 GAGATTGCAGTGAGCTGTGATGG No data
1172364437_1172364444 6 Left 1172364437 20:34338152-34338174 CCCAGTTACTCAGGAGGCTGAGG 0: 2930
1: 105244
2: 210342
3: 240613
4: 149234
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data
1172364437_1172364442 0 Left 1172364437 20:34338152-34338174 CCCAGTTACTCAGGAGGCTGAGG 0: 2930
1: 105244
2: 210342
3: 240613
4: 149234
Right 1172364442 20:34338175-34338197 TTAGAGGATCACGTGACCCCGGG No data
1172364437_1172364443 3 Left 1172364437 20:34338152-34338174 CCCAGTTACTCAGGAGGCTGAGG 0: 2930
1: 105244
2: 210342
3: 240613
4: 149234
Right 1172364443 20:34338178-34338200 GAGGATCACGTGACCCCGGGAGG No data
1172364437_1172364441 -1 Left 1172364437 20:34338152-34338174 CCCAGTTACTCAGGAGGCTGAGG 0: 2930
1: 105244
2: 210342
3: 240613
4: 149234
Right 1172364441 20:34338174-34338196 GTTAGAGGATCACGTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172364437 Original CRISPR CCTCAGCCTCCTGAGTAACT GGG (reversed) Intergenic
Too many off-targets to display for this crispr