ID: 1172364439

View in Genome Browser
Species Human (GRCh38)
Location 20:34338153-34338175
Sequence ACCTCAGCCTCCTGAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 602526
Summary {0: 563, 1: 16711, 2: 121803, 3: 225359, 4: 238090}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172364439_1172364443 2 Left 1172364439 20:34338153-34338175 CCAGTTACTCAGGAGGCTGAGGT 0: 563
1: 16711
2: 121803
3: 225359
4: 238090
Right 1172364443 20:34338178-34338200 GAGGATCACGTGACCCCGGGAGG No data
1172364439_1172364444 5 Left 1172364439 20:34338153-34338175 CCAGTTACTCAGGAGGCTGAGGT 0: 563
1: 16711
2: 121803
3: 225359
4: 238090
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data
1172364439_1172364441 -2 Left 1172364439 20:34338153-34338175 CCAGTTACTCAGGAGGCTGAGGT 0: 563
1: 16711
2: 121803
3: 225359
4: 238090
Right 1172364441 20:34338174-34338196 GTTAGAGGATCACGTGACCCCGG No data
1172364439_1172364442 -1 Left 1172364439 20:34338153-34338175 CCAGTTACTCAGGAGGCTGAGGT 0: 563
1: 16711
2: 121803
3: 225359
4: 238090
Right 1172364442 20:34338175-34338197 TTAGAGGATCACGTGACCCCGGG No data
1172364439_1172364448 27 Left 1172364439 20:34338153-34338175 CCAGTTACTCAGGAGGCTGAGGT 0: 563
1: 16711
2: 121803
3: 225359
4: 238090
Right 1172364448 20:34338203-34338225 GAGATTGCAGTGAGCTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172364439 Original CRISPR ACCTCAGCCTCCTGAGTAAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr