ID: 1172364444

View in Genome Browser
Species Human (GRCh38)
Location 20:34338181-34338203
Sequence GATCACGTGACCCCGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172364433_1172364444 29 Left 1172364433 20:34338129-34338151 CCTGTGATACACTAGCCTGTAGT No data
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data
1172364435_1172364444 14 Left 1172364435 20:34338144-34338166 CCTGTAGTCCCAGTTACTCAGGA 0: 1182
1: 46241
2: 165986
3: 222769
4: 206642
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data
1172364437_1172364444 6 Left 1172364437 20:34338152-34338174 CCCAGTTACTCAGGAGGCTGAGG 0: 2930
1: 105244
2: 210342
3: 240613
4: 149234
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data
1172364439_1172364444 5 Left 1172364439 20:34338153-34338175 CCAGTTACTCAGGAGGCTGAGGT 0: 563
1: 16711
2: 121803
3: 225359
4: 238090
Right 1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172364444 Original CRISPR GATCACGTGACCCCGGGAGG TGG Intergenic
No off target data available for this crispr