ID: 1172367970

View in Genome Browser
Species Human (GRCh38)
Location 20:34363930-34363952
Sequence GACGTCCGCCACCGTCGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172367950_1172367970 26 Left 1172367950 20:34363881-34363903 CCTTCCATTGTCCCCCCGGCGTG No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367956_1172367970 14 Left 1172367956 20:34363893-34363915 CCCCCGGCGTGGTGGTCCCGGCT No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367961_1172367970 -2 Left 1172367961 20:34363909-34363931 CCCGGCTCCGGCGCCCTCCCCGA No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367959_1172367970 11 Left 1172367959 20:34363896-34363918 CCGGCGTGGTGGTCCCGGCTCCG No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367955_1172367970 15 Left 1172367955 20:34363892-34363914 CCCCCCGGCGTGGTGGTCCCGGC No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367957_1172367970 13 Left 1172367957 20:34363894-34363916 CCCCGGCGTGGTGGTCCCGGCTC No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367949_1172367970 29 Left 1172367949 20:34363878-34363900 CCTCCTTCCATTGTCCCCCCGGC No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367962_1172367970 -3 Left 1172367962 20:34363910-34363932 CCGGCTCCGGCGCCCTCCCCGAC No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367958_1172367970 12 Left 1172367958 20:34363895-34363917 CCCGGCGTGGTGGTCCCGGCTCC No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367952_1172367970 22 Left 1172367952 20:34363885-34363907 CCATTGTCCCCCCGGCGTGGTGG No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data
1172367963_1172367970 -9 Left 1172367963 20:34363916-34363938 CCGGCGCCCTCCCCGACGTCCGC No data
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172367970 Original CRISPR GACGTCCGCCACCGTCGTGG CGG Intronic