ID: 1172367970

View in Genome Browser
Species Human (GRCh38)
Location 20:34363930-34363952
Sequence GACGTCCGCCACCGTCGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172367959_1172367970 11 Left 1172367959 20:34363896-34363918 CCGGCGTGGTGGTCCCGGCTCCG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367956_1172367970 14 Left 1172367956 20:34363893-34363915 CCCCCGGCGTGGTGGTCCCGGCT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367961_1172367970 -2 Left 1172367961 20:34363909-34363931 CCCGGCTCCGGCGCCCTCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 324
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367957_1172367970 13 Left 1172367957 20:34363894-34363916 CCCCGGCGTGGTGGTCCCGGCTC 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367950_1172367970 26 Left 1172367950 20:34363881-34363903 CCTTCCATTGTCCCCCCGGCGTG 0: 1
1: 0
2: 0
3: 10
4: 66
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367955_1172367970 15 Left 1172367955 20:34363892-34363914 CCCCCCGGCGTGGTGGTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 85
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367958_1172367970 12 Left 1172367958 20:34363895-34363917 CCCGGCGTGGTGGTCCCGGCTCC 0: 1
1: 0
2: 9
3: 51
4: 334
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367952_1172367970 22 Left 1172367952 20:34363885-34363907 CCATTGTCCCCCCGGCGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367963_1172367970 -9 Left 1172367963 20:34363916-34363938 CCGGCGCCCTCCCCGACGTCCGC 0: 1
1: 0
2: 0
3: 27
4: 257
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367962_1172367970 -3 Left 1172367962 20:34363910-34363932 CCGGCTCCGGCGCCCTCCCCGAC 0: 1
1: 0
2: 4
3: 28
4: 377
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1172367949_1172367970 29 Left 1172367949 20:34363878-34363900 CCTCCTTCCATTGTCCCCCCGGC 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172367970 Original CRISPR GACGTCCGCCACCGTCGTGG CGG Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG + Exonic
1077171323 11:1167457-1167479 GACATCAGCGACCCTCGTGGTGG + Intronic
1101939321 12:109088350-109088372 GACCACCGCCACCCTCCTGGAGG + Exonic
1103908716 12:124340310-124340332 TGCGTGCTCCACCGTCGTGGTGG + Exonic
1119309429 14:73633943-73633965 GACCTCCGCCAAGGTCGAGGCGG - Intergenic
1124965714 15:34432154-34432176 CACGTCAGCCACCTTCCTGGAGG + Intronic
1140982144 16:80120876-80120898 GATGTCTGCCACAGTCATGGAGG + Intergenic
1142501546 17:335937-335959 CACGTCTGCCCCCGGCGTGGAGG + Intronic
1163420644 19:17211963-17211985 GACGACGGCCTTCGTCGTGGAGG - Exonic
936277505 2:111113083-111113105 CACGTCTGCCACAGTGGTGGAGG + Intronic
1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG + Intronic
1175441302 20:58994099-58994121 GACGTCCAGCACCTGCGTGGGGG - Exonic
962608834 3:137055724-137055746 GAAGTCAGCCACGGTCCTGGGGG + Intergenic
963228681 3:142888654-142888676 GGCGTCCGCCACCCTCGGGTAGG - Intronic
999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG + Exonic
1002643128 5:180640067-180640089 GGCGTCAGCCACAGGCGTGGCGG + Intronic
1026735958 7:72948863-72948885 GGCGTGCGCCAGGGTCGTGGAGG - Exonic
1058984516 9:110198579-110198601 GAGTTCTGCCACGGTCGTGGAGG + Intronic
1203782596 EBV:108930-108952 TACGTCCGCCACAGTGGGGGTGG - Intergenic