ID: 1172372857

View in Genome Browser
Species Human (GRCh38)
Location 20:34408784-34408806
Sequence ACTTCCAAGCTTACACTGTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172372857_1172372858 14 Left 1172372857 20:34408784-34408806 CCTTACAGTGTAAGCTTGGAAGT 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1172372858 20:34408821-34408843 TGTTTTGTTTAGTAGATGATTGG 0: 1
1: 0
2: 0
3: 30
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172372857 Original CRISPR ACTTCCAAGCTTACACTGTA AGG (reversed) Exonic
902304582 1:15526447-15526469 ACTTCCAATCTGACGCTCTAAGG + Intronic
903393495 1:22981823-22981845 AGGTCCAAGCTTAGACTCTAGGG + Intergenic
905331644 1:37206237-37206259 ACTTCCAAGCTCACTTTATAGGG + Intergenic
906647218 1:47483826-47483848 GCTTCCAACCTGGCACTGTAGGG - Intergenic
910411276 1:86947993-86948015 ACTTCCAAATTTAAACTGTTGGG + Intronic
910497697 1:87851408-87851430 AGTTCCCAGCTTCCAGTGTAAGG + Intergenic
913147873 1:116010240-116010262 AATTCCAACCTTACACTTTTTGG - Intronic
917706946 1:177644633-177644655 ACTTCCAGCCCTACACTGTGGGG + Intergenic
918580074 1:186116176-186116198 ACTTGAAAGTATACACTGTATGG + Intronic
919111758 1:193228694-193228716 ACTTAAAAGCTGAAACTGTAAGG + Intronic
920056992 1:203199945-203199967 ACTTCCACACTTCCACTGTTTGG + Intergenic
920299177 1:204977917-204977939 ACTTCCGAGCTCACCCTGTAAGG - Intronic
922309525 1:224375133-224375155 AGTTCCAAGCTTTTACCGTAGGG - Intronic
1064650913 10:17508450-17508472 ACTTCCAAACTTAGACCGTATGG + Intergenic
1070058961 10:72963282-72963304 ACTTCCAAACTTATTCTTTAAGG - Intergenic
1074647346 10:115473583-115473605 ACTTCCGAACTTATGCTGTAAGG - Intronic
1074850547 10:117436118-117436140 AGTTTCAACCTTACACTGGAAGG - Intergenic
1079869366 11:25777783-25777805 ACTTCCAGGCTTACCCAGTTGGG - Intergenic
1080697296 11:34613594-34613616 GCTTCCATGTTTCCACTGTAAGG + Intergenic
1083514722 11:63246299-63246321 ACTCCCAAGCAGAAACTGTATGG - Intronic
1087571331 11:99930353-99930375 ACATCCAGGCATACACAGTAAGG - Intronic
1089134129 11:116235622-116235644 ACTTCCAAGCCTACATTGGCAGG + Intergenic
1090320386 11:125838123-125838145 ATTTCCAACTTCACACTGTAGGG + Intronic
1091925055 12:4339529-4339551 ACTTCCAAACTTATTCTGTGAGG + Intronic
1100007292 12:89909693-89909715 ACTCCCAAGTTTGCACTGCAGGG - Intergenic
1100085298 12:90903039-90903061 ACTTCCATTCTTCCAATGTATGG + Intergenic
1100123113 12:91392542-91392564 ACTTCCAAACTTATTCTGTGAGG - Intergenic
1100342552 12:93693963-93693985 ACTTCCAAGCTTATTTTGTAAGG + Intronic
1103103600 12:118203178-118203200 ATTTTCAAGCATACACTATACGG - Intronic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1105923647 13:24987129-24987151 ACATCCCACCTTACACTGCAAGG + Intergenic
1106851285 13:33795549-33795571 CCTTCCAAGCTTACAGTGGTGGG - Intergenic
1107643325 13:42467733-42467755 ACTTCCAAACTTATTCTGTGAGG + Intergenic
1111000975 13:82180988-82181010 ACTTCCAAGCTTGCATTCTTAGG - Intergenic
1111956939 13:94769594-94769616 ACTTCCAAGGTTAATCTGCAAGG - Intergenic
1112850526 13:103700467-103700489 ACTTCCATTTTTACACTGTGTGG + Intergenic
1115199366 14:30836394-30836416 AATTCCAACCTAACTCTGTAGGG - Intergenic
1116225172 14:42141488-42141510 ACTTCCACTCATACACTCTATGG + Intergenic
1117551613 14:56842832-56842854 ACTTCCAAGCTGGCACTTGAAGG - Intergenic
1118085089 14:62405256-62405278 ACTTCCTATCTCCCACTGTACGG - Intergenic
1118969889 14:70626177-70626199 ACTTCCAAGCTCATTCTATAAGG + Intergenic
1125272908 15:37959337-37959359 ACTTCCAAACTCATTCTGTAAGG + Intronic
1125582138 15:40793670-40793692 CTTTCCAAGCTTACAGTGTAAGG + Intronic
1126450664 15:48804938-48804960 ACTTCCCAGCTTACACTCATTGG + Intronic
1127297892 15:57626065-57626087 ATTTCCAAGCTGAGACTCTAAGG + Intronic
1127770846 15:62229478-62229500 ACTTCCCAGCTTGGACTTTAAGG + Intergenic
1128921872 15:71618304-71618326 ACTTCCAGGTATACACTTTAGGG + Intronic
1131320873 15:91389582-91389604 ACTTCCAAACTCACTCTGTGAGG - Intergenic
1131855297 15:96587085-96587107 ACTTCCCATATTTCACTGTAAGG - Intergenic
1131980495 15:97990039-97990061 ACTTCCAAGCTGACACAGAAGGG + Intergenic
1135478623 16:22801716-22801738 ACTGCCACGTGTACACTGTAAGG + Intergenic
1137851019 16:51743118-51743140 ACTTCCAAACTTATTCTGTAAGG + Intergenic
1139258311 16:65564860-65564882 ACTTCCATGATGACACTATATGG - Intergenic
1147017381 17:37503121-37503143 AGTGTCAAGATTACACTGTAGGG + Intronic
1154171926 18:12058746-12058768 ACTTCCAAACTTACTCTATGAGG + Intergenic
1154407873 18:14111902-14111924 ACTTCCAACCTTGTTCTGTAAGG + Intronic
1155594130 18:27463266-27463288 ACTTCAAAACTTATACTGTGAGG + Intergenic
1156534579 18:37850206-37850228 TCTTCCAAGATTGCACTGCATGG + Intergenic
1159990204 18:74897818-74897840 ACATCCAACCCCACACTGTAGGG - Intronic
1164729827 19:30495020-30495042 ATTTCCAAGATTACACATTATGG + Intronic
1168387117 19:55973498-55973520 ACTTCCAAGCTTTCAAGGAAAGG - Intronic
925540519 2:4961422-4961444 TCTTCCAAGCCTGCATTGTAGGG - Intergenic
926752591 2:16210059-16210081 ACTGCCACCCCTACACTGTAGGG + Intergenic
926778329 2:16444268-16444290 ACTGCCAAGCTTACATAGAAAGG + Intergenic
930294245 2:49534407-49534429 ACTTCCAAAATTATTCTGTAAGG + Intergenic
933450961 2:82451004-82451026 ACTTCCAAACTCATTCTGTAAGG + Intergenic
936000458 2:108823272-108823294 ACTTCCACACTTACTCTGTGGGG + Intronic
937736912 2:125302796-125302818 ATTTCCAAACTTACTCTGTGAGG + Intergenic
939937877 2:148314137-148314159 ACTTCCTAGTTTTCTCTGTAAGG - Intronic
940015391 2:149099353-149099375 ACTGCCCAGCTGAGACTGTAAGG - Intronic
941529209 2:166644558-166644580 ACTTCCTAGCTTATTCTGTGAGG - Intergenic
943301188 2:186203036-186203058 ACTTCCAAACTCACTCTATAAGG + Intergenic
943886241 2:193220023-193220045 ACTTACCAGTTTATACTGTAAGG - Intergenic
946619848 2:221549092-221549114 ACCTCCAATCTTTCACTGTTAGG + Intronic
1170104374 20:12737606-12737628 ACTTTCCAGCTCACACTATATGG - Intergenic
1172352177 20:34251695-34251717 ACTGCCAAGGTTATAGTGTAAGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172372857 20:34408784-34408806 ACTTCCAAGCTTACACTGTAAGG - Exonic
1176430063 21:6569955-6569977 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1176857261 21:13982809-13982831 ACTTCCAAACTTATTCTGTGGGG - Intergenic
1176867347 21:14061421-14061443 ACTTCCAAACTTATTCTGTGGGG + Intergenic
1177219227 21:18169030-18169052 ACTTCCCAACTTACTCTCTAAGG - Intronic
1177222388 21:18210912-18210934 CCTTCAAAGTTTACACTGTTTGG + Intronic
1177759627 21:25388672-25388694 ACTCCCAAACTGACAGTGTAGGG + Intergenic
1178105808 21:29317955-29317977 ATTTACAATCTTACACTGTCTGG - Intronic
1179705457 21:43177417-43177439 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
951279332 3:20728673-20728695 ACTTCCAAACTCACTCTATAAGG - Intergenic
951860609 3:27247880-27247902 ACTTCCAAACTTACACCGTGAGG - Intronic
953264647 3:41374669-41374691 ACAGCCAATATTACACTGTATGG + Intronic
954715374 3:52524205-52524227 ACTTCCATGCTTACATCGAAGGG - Exonic
956118160 3:65939365-65939387 TCTTTCATGTTTACACTGTAGGG + Intronic
956591171 3:70916423-70916445 ACATCCAAGGAAACACTGTAAGG + Intergenic
959491438 3:106993707-106993729 ACTTCCAAACTTACATTATGAGG + Intergenic
960938581 3:122918842-122918864 ACTTCAAAGCTTACAGAGCAGGG + Intronic
963745694 3:149122926-149122948 ACTTCCCAACTTACTCTGTGAGG - Intergenic
965074056 3:163953791-163953813 ACTTCCAAGCCTGCAGTGCAGGG + Intergenic
969846392 4:9923412-9923434 ACTGCCCTGCTGACACTGTACGG + Intronic
970004943 4:11401306-11401328 CCTTCCTACCTTACAGTGTAGGG - Intronic
970281781 4:14464742-14464764 ACTTCTAGGCTTAAACCGTAGGG + Intergenic
973547999 4:52001438-52001460 ACTTCTAAGATTTCACTGCAAGG - Intronic
973659033 4:53083432-53083454 ACTTCCAACCTTATTCTGTGAGG + Intronic
976354240 4:84097367-84097389 ACTGCCCTGCTGACACTGTATGG - Intergenic
976908513 4:90270151-90270173 ACTTCCAAACTCATTCTGTAAGG + Intronic
980465712 4:133177893-133177915 TCTTCCTTGATTACACTGTAAGG - Intronic
981815232 4:148823487-148823509 ACTTCCAAGGTTAAGCTGTGGGG - Intergenic
982385474 4:154796567-154796589 GTTTCCAAGTTTCCACTGTAGGG + Intronic
982910869 4:161141153-161141175 ACTTCCAAACTCACTCTATAAGG + Intergenic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
984317593 4:178146591-178146613 ACTTCAAAGCTTACATCCTATGG - Intergenic
986037747 5:3957216-3957238 ACTTCCAAGCTGTCACACTAGGG - Intergenic
986137060 5:4990304-4990326 ACTGCCCTGCTGACACTGTACGG + Intergenic
989220550 5:38956861-38956883 ACTTCCAAGCATACAACTTAAGG - Intronic
993040791 5:82812319-82812341 GTTTCAAAGCTTACACTGTGGGG - Intergenic
993308664 5:86300500-86300522 ACTTCCCAGCTTATTCTGTGAGG + Intergenic
994168218 5:96630148-96630170 TCTTCCGAGCTTACAGTCTATGG + Intronic
994685336 5:102943695-102943717 AGTTCAAATCTTACACTTTATGG - Intronic
995048905 5:107680060-107680082 AATTGCAAAATTACACTGTAAGG - Intergenic
998885189 5:146686759-146686781 ACCTCCAGGCTTACCCTGCAGGG + Intronic
1002808542 6:602830-602852 CCTTCCCATCTTGCACTGTAGGG - Intronic
1003400536 6:5786909-5786931 ACATCCCAGCTTACACCGTAAGG + Intergenic
1003748174 6:9025235-9025257 AGTTCCAGGCTTCCACAGTATGG - Intergenic
1006351316 6:33523192-33523214 TATGCCAAGCTTATACTGTAAGG + Intergenic
1008358347 6:50583991-50584013 CCTTCCATGATAACACTGTAAGG - Intergenic
1010000179 6:70940912-70940934 ACTTCCTAGCTTTCACCGTTAGG + Intronic
1010775847 6:79884520-79884542 ACTTCCAAACTCACTCTGTGAGG + Intergenic
1013909495 6:115256747-115256769 ACTTCCAAACTCATTCTGTAAGG + Intergenic
1018608474 6:165623651-165623673 ACTTCAATGCTCACACTGTGGGG + Intronic
1020747223 7:12092743-12092765 ACTGCCCTGCTGACACTGTAAGG + Intergenic
1022210524 7:28204629-28204651 ACCTCTAAACTCACACTGTAAGG + Intergenic
1022541137 7:31136298-31136320 ACTTCCAAGCTGAAACTTTAAGG + Intergenic
1026143596 7:67726703-67726725 ACATCCAAACTTACCCTATATGG - Intergenic
1029408705 7:100394305-100394327 GCTTCCAAGCTTATTCTGTGAGG + Intronic
1032448135 7:132002346-132002368 ACTTCCATGCAGACACTTTAAGG - Intergenic
1040742773 8:50600307-50600329 ACTTCCAAACTTATTCTATAAGG - Intronic
1041101056 8:54396795-54396817 ACTTCCGAGCTAACACTCCACGG - Intergenic
1044455951 8:92393451-92393473 AATTCCAAGCTTCCACAGCATGG + Intergenic
1044562024 8:93621817-93621839 ACTTCCAAGTATACATTGTAGGG + Intergenic
1044745262 8:95364980-95365002 ACTTCTCAGGTTACACTGAAGGG - Intergenic
1044776544 8:95694824-95694846 ACTTCCAAGCTAACACAGTAAGG + Intergenic
1046801068 8:118427499-118427521 ACTTGCAAGATTAACCTGTAGGG - Intronic
1047144994 8:122188533-122188555 TCTTGCAAGCTTACAGTGCATGG + Intergenic
1050578305 9:7023150-7023172 ACTTCCAAGCTCACTCCGTGAGG - Intronic
1051645501 9:19264014-19264036 ACTTCCAAACTTATTCTGTAAGG - Intronic
1057541286 9:95973860-95973882 ACTTCCATAGTTACATTGTAAGG - Intronic
1058218755 9:102269053-102269075 ACTTCCAATCTTATTCTGTGAGG - Intergenic
1059202197 9:112428700-112428722 ACTTAAAAGCTTACACTTTATGG + Intronic
1059948491 9:119437726-119437748 CCTTCCAAGCCTACAGTGTCAGG + Intergenic
1194389387 X:93297448-93297470 ACTTCCAAACTTATTCTGTGAGG + Intergenic
1194516464 X:94861669-94861691 ACTTCCAAACTCATTCTGTAAGG + Intergenic
1197048227 X:122026385-122026407 ACTTCCAAGCTCACTATGTATGG - Intergenic
1198223077 X:134620981-134621003 ACTTCAAAGCTTACACTTCTTGG + Intronic
1199820932 X:151445107-151445129 ACTTCCAATCTTACTTTCTAAGG - Intergenic