ID: 1172376292

View in Genome Browser
Species Human (GRCh38)
Location 20:34443680-34443702
Sequence TTTACGTTGTTAGTTGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172376292 Original CRISPR TTTACGTTGTTAGTTGCTGC CGG Intronic
912074284 1:105852476-105852498 TTTTAGTTGTTTATTGCTGCAGG - Intergenic
912536063 1:110372513-110372535 GTTTCTTTGGTAGTTGCTGCTGG + Intronic
924250935 1:242132539-242132561 TTTATATTCTGAGTTGCTGCAGG + Intronic
1064711379 10:18129765-18129787 TTTATGTTGTGAGTTGCAGAGGG - Intergenic
1072690073 10:97566966-97566988 TTTTCTTTGTCAGATGCTGCAGG + Intronic
1072800239 10:98387803-98387825 TTTATGTTTTTAGTAGCTACGGG + Intronic
1080992106 11:37549283-37549305 GGTACGTAGTTAATTGCTGCCGG - Intergenic
1083934708 11:65864202-65864224 TGTACCTTGGTACTTGCTGCTGG + Intronic
1088733551 11:112706147-112706169 CTTACTTTGTTAGTTCCTGTGGG - Intergenic
1092368904 12:7900146-7900168 GTTACGTTTTTAGTTGGGGCGGG + Intergenic
1096675200 12:53222346-53222368 TTTTTGTTGTTGTTTGCTGCTGG - Intronic
1098199477 12:68039525-68039547 TTTATGTTTTTAGTTGATACGGG - Intergenic
1101391271 12:104302804-104302826 TATACTTTGCTATTTGCTGCTGG + Intronic
1105573927 13:21631964-21631986 TTGAAGTTGTTTGTTTCTGCTGG + Intergenic
1107084290 13:36409024-36409046 ATTTTGTTGTTATTTGCTGCTGG - Intergenic
1107208153 13:37820560-37820582 TTTACGTTTTTATGTGCTGCTGG - Intronic
1118649957 14:67880759-67880781 TTTACGTTGTTGGTGGGTGCTGG + Intronic
1120452987 14:84694770-84694792 TTTACTTTGTTTTTAGCTGCAGG - Intergenic
1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG + Intergenic
1122504039 14:102220279-102220301 TTTACATACTTAGTGGCTGCAGG - Intronic
1138836132 16:60437310-60437332 TTTACGGTGGTATTTGCTGAAGG - Intergenic
1150435594 17:65151936-65151958 TTTCTGTTGTTGTTTGCTGCTGG - Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1158538119 18:58326692-58326714 TTTCCTTTGTGAGTTGCTCCTGG - Intronic
1159789090 18:72754162-72754184 TTTACTTTCTTAGTTGCTTTAGG - Intronic
1165221423 19:34319858-34319880 TTTAGGTTGTGGGTTGCTGTTGG - Intronic
932942210 2:76180891-76180913 TTTTCATTGTTACTTGCTGTGGG + Intergenic
937168200 2:119840946-119840968 TTTAAGTTCTTTGTAGCTGCTGG + Intronic
945919257 2:215738676-215738698 TTTAAGTTATTAGTTGCTTTGGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1174961497 20:55162243-55162265 TTTGACTTTTTAGTTGCTGCTGG + Intergenic
1177307815 21:19343032-19343054 TTTATGTTGCTAGTGGCTTCAGG - Intergenic
950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG + Intronic
950690721 3:14654513-14654535 TTTACCTTGTTAGTTGTTTTTGG - Exonic
951930528 3:27961975-27961997 TTTACGTTGTTAGTTTTTAAGGG + Intergenic
957718765 3:83968215-83968237 TTTATGTAATTAGTTGCTGAAGG - Intergenic
963664144 3:148160932-148160954 ATTAGGTTGTTGGTTGCTGAAGG - Intergenic
965700798 3:171458226-171458248 TCTACGCTGGGAGTTGCTGCCGG - Intronic
966470521 3:180283771-180283793 TTTACTCTGCTAGTTGCAGCAGG - Intergenic
973586677 4:52399878-52399900 TAGATGTTGTTAGTTGATGCTGG + Intergenic
977303010 4:95289391-95289413 TTCATGTTGTTATCTGCTGCTGG + Intronic
979143191 4:117204575-117204597 TTAACTTTTTTATTTGCTGCTGG - Intergenic
979559457 4:122085663-122085685 TTTTAGTTGTTAGATGCTGAAGG - Intergenic
984492129 4:180447749-180447771 ATTGCATTGATAGTTGCTGCTGG - Intergenic
987005484 5:13705643-13705665 ATCACGTTGTTAGGTGCTGGGGG - Intronic
989565035 5:42893741-42893763 TTTACCTTGCTAATTGCTTCAGG - Intergenic
990942655 5:61218830-61218852 TTTGTGTTGTTTGTTTCTGCTGG + Intergenic
994629139 5:102260963-102260985 TTTACATTGTTATTTGCAGCAGG - Intronic
995919279 5:117291804-117291826 TTTACATTCTGAGTTGTTGCTGG - Intergenic
997908555 5:137845053-137845075 TTGAAGTTGTTTGTTGCTTCTGG + Intergenic
1003675576 6:8201505-8201527 TTTCCTTGGCTAGTTGCTGCAGG + Intergenic
1004719339 6:18252876-18252898 TTTGCCTTGTTTGTTTCTGCTGG - Intronic
1009759206 6:67981349-67981371 TTTAAGTTGTTAGGTGATGCAGG - Intergenic
1021856087 7:24857795-24857817 TTTGTGTTGTTTTTTGCTGCAGG + Intronic
1023902094 7:44489775-44489797 TTTACACTCTTAGTTGCCGCAGG - Intronic
1028823769 7:95245218-95245240 TTTACGTTATTAGTTTATACTGG + Intronic
1030840721 7:114350642-114350664 TTTGCCTTCTTAGTTGCTACTGG - Intronic
1036287050 8:7452150-7452172 TGTATGTTGTTAGTGGATGCAGG - Intronic
1036334431 8:7859372-7859394 TGTATGTTGTTAGTGGATGCAGG + Intronic
1036476067 8:9094672-9094694 TTTACAATGTGAGTTCCTGCTGG + Intronic
1036758459 8:11488787-11488809 TTTTCCTTAGTAGTTGCTGCAGG + Intergenic
1038311157 8:26447397-26447419 TTTACGTTTTTAGTGGAGGCGGG + Intronic
1041321268 8:56615511-56615533 ATTATGTTTTTAGTAGCTGCAGG + Intergenic
1043351942 8:79372269-79372291 TTTAAGTTGTTTGTAGCTTCTGG - Intergenic
1045791907 8:105993429-105993451 TTTACTTTGTTATTTACTTCTGG + Intergenic
1048569724 8:135641890-135641912 CTTTTGTTGTTAGTTTCTGCTGG + Intronic
1048636519 8:136301599-136301621 TTAACGTTCTTAGGTGCTGTCGG - Intergenic
1048727311 8:137400960-137400982 TTCACGTTGGCTGTTGCTGCTGG + Intergenic
1051902095 9:22054763-22054785 TTTACTTTATTTGTTGTTGCTGG + Intergenic
1053219147 9:36297248-36297270 TTTACATTGTTAATTCCTGCAGG - Intronic
1056405760 9:86273269-86273291 TGTACATTGTTAGTTGCCGATGG - Intronic
1057442037 9:95090155-95090177 GTGACGTTGCTAGTGGCTGCAGG - Intergenic
1059398360 9:114053150-114053172 ATTAAGCTGTTAGTTGCAGCAGG - Exonic
1189387769 X:40551320-40551342 TGCACATTGTTAGGTGCTGCTGG - Intergenic
1197235866 X:124062057-124062079 TATACTTTTTTAGTTGCTGCAGG + Intronic
1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG + Intergenic