ID: 1172379938

View in Genome Browser
Species Human (GRCh38)
Location 20:34481524-34481546
Sequence CTTTATCAGCAGCAGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6138
Summary {0: 1, 1: 42, 2: 1555, 3: 1793, 4: 2747}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172379938_1172379940 -7 Left 1172379938 20:34481524-34481546 CCACTTTCCTGCTGCTGATAAAG 0: 1
1: 42
2: 1555
3: 1793
4: 2747
Right 1172379940 20:34481540-34481562 GATAAAGACATATCCAAGACTGG 0: 145
1: 1682
2: 3696
3: 5822
4: 7203
1172379938_1172379943 14 Left 1172379938 20:34481524-34481546 CCACTTTCCTGCTGCTGATAAAG 0: 1
1: 42
2: 1555
3: 1793
4: 2747
Right 1172379943 20:34481561-34481583 GGGCAATTTATAAAAAAAAGAGG 0: 2
1: 297
2: 6900
3: 12374
4: 10232
1172379938_1172379944 22 Left 1172379938 20:34481524-34481546 CCACTTTCCTGCTGCTGATAAAG 0: 1
1: 42
2: 1555
3: 1793
4: 2747
Right 1172379944 20:34481569-34481591 TATAAAAAAAAGAGGTTTAATGG 0: 4
1: 284
2: 2113
3: 2752
4: 4838
1172379938_1172379941 -6 Left 1172379938 20:34481524-34481546 CCACTTTCCTGCTGCTGATAAAG 0: 1
1: 42
2: 1555
3: 1793
4: 2747
Right 1172379941 20:34481541-34481563 ATAAAGACATATCCAAGACTGGG 0: 212
1: 2632
2: 4567
3: 7849
4: 9114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172379938 Original CRISPR CTTTATCAGCAGCAGGAAAG TGG (reversed) Intronic
Too many off-targets to display for this crispr