ID: 1172381198

View in Genome Browser
Species Human (GRCh38)
Location 20:34493903-34493925
Sequence CCCTACATGCAGATGGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 2, 3: 7, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172381198_1172381201 -10 Left 1172381198 20:34493903-34493925 CCTAGAACCATCTGCATGTAGGG 0: 1
1: 1
2: 2
3: 7
4: 115
Right 1172381201 20:34493916-34493938 GCATGTAGGGATAAGACAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 214
1172381198_1172381202 2 Left 1172381198 20:34493903-34493925 CCTAGAACCATCTGCATGTAGGG 0: 1
1: 1
2: 2
3: 7
4: 115
Right 1172381202 20:34493928-34493950 AAGACAGAAGGAGATAGCCTAGG 0: 1
1: 0
2: 3
3: 23
4: 330
1172381198_1172381203 7 Left 1172381198 20:34493903-34493925 CCTAGAACCATCTGCATGTAGGG 0: 1
1: 1
2: 2
3: 7
4: 115
Right 1172381203 20:34493933-34493955 AGAAGGAGATAGCCTAGGCCAGG 0: 1
1: 0
2: 3
3: 28
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172381198 Original CRISPR CCCTACATGCAGATGGTTCT AGG (reversed) Intronic
902220581 1:14962000-14962022 TCCTAGATGCAGAGGGTTCTGGG + Intronic
902546062 1:17190993-17191015 ACCTACAGGCAGAAGGTTCAAGG + Intergenic
902834702 1:19039005-19039027 CCCCAGATGCAGAAGCTTCTGGG - Intergenic
909440939 1:75695280-75695302 CCCTAAAATCAGATGCTTCTAGG + Intergenic
915565296 1:156709620-156709642 TCCTGCATGCAAATGTTTCTGGG - Intergenic
920779047 1:208970185-208970207 CCTTTCATGCTGCTGGTTCTGGG - Intergenic
922731673 1:227951828-227951850 CCCTCCATCCAGCGGGTTCTGGG - Intergenic
923140600 1:231159153-231159175 CTCTATATGCATATGGTTCATGG + Intergenic
923567049 1:235084053-235084075 ACCTCCTTGCAGATCGTTCTAGG - Intergenic
924006108 1:239613217-239613239 CCCTACATGCAATCTGTTCTTGG - Intronic
924847361 1:247786717-247786739 CCCTTCATTCAGGGGGTTCTGGG + Intergenic
1062952953 10:1518507-1518529 CACTACATGCAGATGTTACATGG - Intronic
1068931628 10:62596227-62596249 CCCTCCATGCAGATGGTTCTGGG + Intronic
1071943001 10:90609264-90609286 CCCTTCATTCAAAGGGTTCTGGG + Intergenic
1072379862 10:94857038-94857060 GCCAACATTCAGATGGTGCTAGG - Intergenic
1073642693 10:105269237-105269259 TCCTACATGCAGATGGCTTCTGG + Intergenic
1073656865 10:105425724-105425746 CCCTTCATTCAGGGGGTTCTGGG + Intergenic
1074919641 10:117993969-117993991 ACCTACATTCAAATGGTTCAGGG - Intergenic
1075577111 10:123585392-123585414 TCCTGCTTGCAGCTGGTTCTGGG - Intergenic
1075908295 10:126102044-126102066 ACCTACAGGCAGGTCGTTCTGGG + Intronic
1078427687 11:11265129-11265151 CCCTGCATGCTGATGGGGCTGGG + Intergenic
1081608830 11:44546363-44546385 CCCTTCATTCAAAGGGTTCTGGG - Intergenic
1089501974 11:118937672-118937694 CTATACATGGAGATGATTCTTGG + Intronic
1089908855 11:122075254-122075276 CCCTGCAATCAGATGTTTCTGGG + Intergenic
1090249623 11:125242285-125242307 CCCTACAGGGAGATGCTCCTGGG - Intronic
1094102319 12:26777751-26777773 CCCTTCATTCAAGTGGTTCTAGG - Intronic
1096455548 12:51782140-51782162 CCCTTCCTGCAGATGGTTTCAGG - Intronic
1097828015 12:64194451-64194473 CCCTCCAAACAGATGTTTCTTGG + Exonic
1102205023 12:111084298-111084320 CCCTAGAAACAGATGGTACTTGG - Intronic
1102211450 12:111130191-111130213 CCCTTCATTCAAAGGGTTCTGGG + Intronic
1102674869 12:114650559-114650581 CCCAACATGTAGAAGGTTCTGGG + Intergenic
1106288406 13:28338214-28338236 CCTTACATGCAAATGATACTGGG - Intronic
1107909589 13:45092920-45092942 CCCTAGCTGCAGAGGATTCTGGG + Intergenic
1111358204 13:87139066-87139088 TCCTACATGCAGATGATTAAAGG - Intergenic
1111495382 13:89042219-89042241 CCCTACATGCACAAAATTCTTGG + Intergenic
1111904479 13:94239478-94239500 CACCACATGTAGATGATTCTTGG + Intronic
1113131956 13:107046695-107046717 CCCTTAGTGCAGAAGGTTCTTGG - Intergenic
1117790787 14:59339640-59339662 CTCACAATGCAGATGGTTCTGGG + Intronic
1122129433 14:99596584-99596606 CCTCACAGGCAGAGGGTTCTGGG - Intronic
1130763081 15:86841043-86841065 CCCTACCATCAGAAGGTTCTAGG + Intronic
1132007081 15:98237093-98237115 CCCTACATACAGATGGGCCTTGG + Intergenic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1135016846 16:18930589-18930611 CAATACTTGCAGATGGTGCTGGG - Intergenic
1135322482 16:21506442-21506464 CAATACTTGCAGATGGTGCTGGG - Intergenic
1136333960 16:29599568-29599590 CAATACTTGCAGATGGTGCTGGG - Intergenic
1136365341 16:29806814-29806836 CCCGACCTGCAGGGGGTTCTGGG - Exonic
1138070615 16:53989551-53989573 CTCTATATTCAGATGGTCCTGGG + Intronic
1140959351 16:79897218-79897240 CCCTAGCTGCAAAGGGTTCTGGG + Intergenic
1142945821 17:3426125-3426147 CCCTTCATTCAAAGGGTTCTGGG + Intergenic
1147386011 17:40082700-40082722 CTTTACATGCAGAAGGTCCTAGG - Intronic
1148819944 17:50354482-50354504 GCCTACATGCTGGTGGTTCACGG + Exonic
1152463355 17:80452589-80452611 CCCCACAGCCAGATGCTTCTGGG - Intergenic
1153131496 18:1859229-1859251 CCCTTCATTCAAAGGGTTCTGGG + Intergenic
1155797467 18:30058302-30058324 CCTGACAAGCAGATGCTTCTAGG - Intergenic
1160763020 19:795330-795352 CCCTGGCTGCAGATGGCTCTTGG + Intergenic
1161875271 19:6903664-6903686 ACCTAGATGCAGAGGGTTCTAGG + Intronic
1165382454 19:35490672-35490694 CTCTTCATGCAGATGGGGCTGGG + Intronic
925641520 2:5989970-5989992 CTGAACATGGAGATGGTTCTGGG + Intergenic
926825592 2:16902433-16902455 CCCTTCATTCAAAGGGTTCTGGG - Intergenic
932365076 2:71145904-71145926 CCCTCCTTGCAGATGTTCCTTGG + Intronic
933139634 2:78777996-78778018 CCCTACATACAAATGCTTATAGG + Intergenic
935828691 2:106976852-106976874 CCCCACATGCAGGAAGTTCTTGG + Intergenic
943032168 2:182698759-182698781 CACTACATGCAAATGTCTCTGGG - Intergenic
945806306 2:214493886-214493908 CCCTACCTGCAGATGTTTCTGGG + Intronic
1169744953 20:8934326-8934348 GCCTAGATGCAAAGGGTTCTGGG - Intronic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1172224981 20:33299452-33299474 TCCCCCATGCAGGTGGTTCTGGG - Intronic
1172381198 20:34493903-34493925 CCCTACATGCAGATGGTTCTAGG - Intronic
1175289661 20:57867311-57867333 CTCCACATGCAGAAGGCTCTTGG - Intergenic
1176929101 21:14786744-14786766 CCCAACCTGCAGATCCTTCTGGG + Intergenic
1177467462 21:21506119-21506141 TCTCACATGCAGATAGTTCTAGG - Intronic
1183991288 22:41598661-41598683 CCCTCCATCCAGGGGGTTCTGGG - Exonic
950875755 3:16271120-16271142 CCCGACCTGCTGATGGTTGTGGG + Intronic
951014748 3:17718214-17718236 TCCTAAAAGAAGATGGTTCTTGG + Intronic
951066851 3:18276859-18276881 TCCGACCTGCAGATAGTTCTGGG - Intronic
951970969 3:28443368-28443390 CCCTTCATTCAAGTGGTTCTGGG + Intronic
953808185 3:46089682-46089704 CCATACATGCACATGCATCTTGG - Intergenic
954873967 3:53788686-53788708 CCCTACAAGCAGAGGGCACTGGG - Intronic
961104704 3:124231149-124231171 GCCCACATGCAGAAGCTTCTGGG - Intronic
962324312 3:134420741-134420763 ACCTAGATGAAGCTGGTTCTAGG + Intergenic
962933591 3:140059491-140059513 AGCTACATGGAGAGGGTTCTGGG + Intronic
964733414 3:159891595-159891617 CCCTATGTGCAGATTGTTTTAGG - Intronic
967650073 3:191974735-191974757 CCTTACATACAGATGCTCCTTGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977679599 4:99784652-99784674 CCCTGCCTACACATGGTTCTTGG + Intergenic
980048587 4:128015904-128015926 CACTATATACGGATGGTTCTAGG + Intronic
982877872 4:160670951-160670973 CCCAACTTTCAGATGGTTGTGGG + Intergenic
986037250 5:3951948-3951970 CCCTTCATTCAAAGGGTTCTGGG + Intergenic
987504188 5:18748352-18748374 CCCTTCATTCAAAGGGTTCTGGG - Intergenic
989486589 5:41997885-41997907 CCCTTCATTCAAAGGGTTCTAGG + Intergenic
991428018 5:66511608-66511630 ACCTAGATGCAGAGGGTGCTGGG - Intergenic
992377214 5:76199866-76199888 CCCTTCATTCAGTTGGTTCTGGG - Intronic
996387923 5:122928359-122928381 CCTTACATGCAGAAGGGACTTGG + Intronic
996398822 5:123037387-123037409 TCCTACATGACCATGGTTCTGGG - Intergenic
997199235 5:131999736-131999758 CCCTGCATGCAGATGGAGGTGGG - Intronic
997862024 5:137426993-137427015 ACCTACATGCAGAGGGGTCTGGG - Intronic
997870945 5:137504738-137504760 ACCTACTTGCAGAAAGTTCTAGG + Intronic
1000160936 5:158597255-158597277 CCCTACAGGCACAGGGTACTGGG - Intergenic
1006020166 6:31112993-31113015 CCCAACCTGCAGGAGGTTCTGGG + Intergenic
1007461185 6:42020375-42020397 CCCAACATGCAGAAGGTTCTTGG + Intronic
1014575712 6:123069496-123069518 GTCTACTTGTAGATGGTTCTAGG - Exonic
1015082519 6:129245053-129245075 CCATTCCTGGAGATGGTTCTAGG - Intronic
1019649906 7:2151308-2151330 CCCCACCTGCCGCTGGTTCTGGG - Intronic
1019967968 7:4515705-4515727 ACATATATGCAGATGATTCTGGG + Intergenic
1021636281 7:22697199-22697221 CCCTATACAAAGATGGTTCTAGG + Intergenic
1023640586 7:42253194-42253216 CCCAAGATGCTGATGGTTGTGGG - Intergenic
1023654536 7:42406599-42406621 GCCTACATGCACATGGGTCCTGG - Intergenic
1027799605 7:82734935-82734957 CCTTTCATTCAGAGGGTTCTGGG - Intergenic
1031028635 7:116710922-116710944 CCCTGCATGCACTTGGCTCTTGG + Intronic
1035289427 7:157828105-157828127 CCCCACATGCAGATGGAGCTGGG + Intronic
1041214647 8:55587966-55587988 CTCTACAGGAAGATGCTTCTGGG - Intergenic
1043232670 8:77822427-77822449 CCCTTCATTCAAGTGGTTCTGGG + Intergenic
1057316707 9:93973915-93973937 CCCTTCATTCAGGGGGTTCTGGG - Intergenic
1059412557 9:114141899-114141921 CTCTAGAATCAGATGGTTCTAGG + Intergenic
1062169146 9:135124948-135124970 CCCAACATGGAGAAGGGTCTAGG + Intergenic
1187249931 X:17588030-17588052 GCCTGAATGTAGATGGTTCTAGG + Intronic
1188805903 X:34589931-34589953 CACTACATTCAGATTGTTCATGG + Intergenic
1188902472 X:35750799-35750821 CCCTTCATCTAGGTGGTTCTTGG + Intergenic
1190323785 X:49194136-49194158 CCCTACATGCAAGTGGCTGTGGG + Intronic
1193573893 X:83176515-83176537 CCCTTCATTCAAAGGGTTCTGGG + Intergenic
1193779256 X:85683019-85683041 CCCTTCCTGCACATAGTTCTTGG - Intergenic
1194849463 X:98853683-98853705 CCCTTCATTCAAGTGGTTCTGGG + Intergenic
1195910827 X:109887081-109887103 CCCCTCATTCAGGTGGTTCTGGG + Intergenic
1197897554 X:131331409-131331431 CCCTGCTTGCAGAAGGTTGTTGG - Intronic
1198933801 X:141886336-141886358 CCCTTCATTCAGGGGGTTCTGGG - Intronic
1200651468 Y:5846253-5846275 CCCTTCATTCAAGTGGTTCTGGG - Intergenic