ID: 1172382853

View in Genome Browser
Species Human (GRCh38)
Location 20:34511406-34511428
Sequence TCTATCAGTCTTGGGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172382849_1172382853 -5 Left 1172382849 20:34511388-34511410 CCTTCATTTGCATGCTTTTCTAT 0: 1
1: 1
2: 3
3: 38
4: 481
Right 1172382853 20:34511406-34511428 TCTATCAGTCTTGGGTAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172382853 Original CRISPR TCTATCAGTCTTGGGTAAGG AGG Intergenic