ID: 1172385327

View in Genome Browser
Species Human (GRCh38)
Location 20:34530120-34530142
Sequence GAGTTCATGTGGAAGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172385327 Original CRISPR GAGTTCATGTGGAAGCCTGG GGG (reversed) Intronic
901012049 1:6207565-6207587 GAGTGCATGTGCAAGCATTGGGG - Intronic
902229959 1:15021586-15021608 GAGGTCACCTGGAAGCCAGGAGG - Intronic
902265179 1:15258161-15258183 GAGTTCTTGTGGATGGATGGTGG - Intronic
903659032 1:24965754-24965776 GCCTTCCTGTGGAAACCTGGTGG + Intergenic
908899452 1:68939491-68939513 CAGTTCATGTGGAGTGCTGGTGG - Intergenic
913174941 1:116264949-116264971 GAGGCCATATGGGAGCCTGGAGG + Intergenic
916429246 1:164711755-164711777 GTGTACATGTGGAAGGCTGAAGG + Intronic
916934944 1:169618019-169618041 GAGGTGCTGTGGGAGCCTGGAGG - Intronic
918143734 1:181738304-181738326 GAGCTCATGTAGTAGCCTGTTGG + Intronic
920739995 1:208571580-208571602 GAGAATATTTGGAAGCCTGGGGG + Intergenic
1063003726 10:1948235-1948257 GAGTTCATGTTGGAGCAGGGTGG - Intergenic
1064352892 10:14592927-14592949 GACTTGAGCTGGAAGCCTGGGGG - Intronic
1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG + Intergenic
1064835295 10:19521088-19521110 CAGTTCATTTGGAATCTTGGAGG + Intronic
1065607179 10:27429868-27429890 GAGTATATGTGGCATCCTGGAGG - Intergenic
1066489925 10:35884549-35884571 GAGTTTATTTGGAAAACTGGGGG - Intergenic
1067428656 10:46227833-46227855 GTGTTCATCTGGAGGCCCGGGGG - Intergenic
1069882486 10:71602484-71602506 GAGATCATGTGGAAGCAGTGTGG - Intronic
1073764013 10:106662347-106662369 GAGTTTATTTGGAAGCATGCAGG - Intronic
1074559068 10:114519112-114519134 TAGTTCAAGAGGCAGCCTGGGGG + Intronic
1075331597 10:121578069-121578091 GAGGTCTTGTGGAGGACTGGAGG - Intronic
1075795594 10:125117265-125117287 GAGGTCATGTGCAGTCCTGGGGG + Intronic
1075858938 10:125657000-125657022 GAGTGAATGAGGAAGCCTGTGGG - Intronic
1076509639 10:131003574-131003596 GAGTCCCTGTGAAGGCCTGGAGG + Intergenic
1076747055 10:132519779-132519801 CAGTTCCTCAGGAAGCCTGGAGG + Intergenic
1076774326 10:132686027-132686049 CAGTTGGTGTGGAAGCCTGATGG + Intronic
1077174721 11:1183675-1183697 GAGGTCATGTGGCAGCCTCTGGG - Intronic
1078422272 11:11222388-11222410 GATTCCATTTGGAAGCCTGTTGG - Intergenic
1078662713 11:13299893-13299915 GCCTTCAGGTGGGAGCCTGGTGG + Intronic
1078696072 11:13633201-13633223 GAGTTAATGTGGAAGACAGCTGG + Intergenic
1081362405 11:42196663-42196685 GAGAACATGTGGATGCATGGTGG - Intergenic
1083001868 11:59299577-59299599 GATGTCATTTGGAAGCCTGAAGG - Intergenic
1083331914 11:61902663-61902685 GGGTTCCTTTGGAAGCCGGGTGG - Intronic
1084791600 11:71478448-71478470 GATTTCATCTCGAAACCTGGCGG + Exonic
1087885165 11:103472111-103472133 TAGTTCATATGGAAGAATGGTGG + Intronic
1091180706 11:133601866-133601888 GAGTGTATGTGGAAGACTGGTGG + Intergenic
1093027862 12:14260872-14260894 TAGATCATGTGAAAGCCTGGAGG - Intergenic
1095234569 12:39781395-39781417 GAGGTGCTGTGGAAGGCTGGAGG - Intronic
1095741802 12:45615540-45615562 GAGTCAGTGTGGAAGCCCGGAGG - Intergenic
1096590874 12:52658534-52658556 GTGCCCATGTGGAGGCCTGGTGG - Intergenic
1100807674 12:98304633-98304655 CAGGTCTTGTGGAAGGCTGGAGG - Intergenic
1101456457 12:104836644-104836666 GAGTCCATCTGGAAACCTGAAGG + Intronic
1107115788 13:36743822-36743844 GAATCCATGTGGGAGTCTGGAGG - Intergenic
1109466792 13:62745129-62745151 GATTTCATGTGGAAGCAGGGTGG - Intergenic
1112653869 13:101428041-101428063 TAGTTCATGTGGCAGCAAGGAGG - Intergenic
1113394741 13:109936714-109936736 GAGTTCATGCTGCAGCCTTGAGG - Intergenic
1113616739 13:111685646-111685668 GAGTGCAGGTGGAGGTCTGGAGG - Intergenic
1113622269 13:111770917-111770939 GAGTGCAGGTGGAGGTCTGGAGG - Intergenic
1115307043 14:31944271-31944293 GGGGTGATGTGGAAGACTGGAGG + Intergenic
1115934247 14:38533730-38533752 GCATTCAGGTCGAAGCCTGGAGG + Intergenic
1117215944 14:53551925-53551947 GAATTTATGTGGAAGAGTGGAGG + Intergenic
1117569446 14:57031777-57031799 GGGTTGAACTGGAAGCCTGGAGG + Intergenic
1118010321 14:61604273-61604295 GAGTTCATGAGGAAAACTAGAGG - Intronic
1120928387 14:89821329-89821351 GAGTTCATAGGGAAGGCTGCCGG - Intronic
1122832411 14:104405821-104405843 GAGTTCAAATGCGAGCCTGGCGG - Intergenic
1122970883 14:105151779-105151801 GAGTGCTTGTGGAAAGCTGGGGG - Intronic
1131778122 15:95823995-95824017 GTCCTCATGTGGCAGCCTGGTGG - Intergenic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1141521174 16:84580644-84580666 GTGTTCAGGTGGAAGCCAGATGG - Intronic
1141887952 16:86905688-86905710 GAGTCCATTTGGAGGCCTTGAGG + Intergenic
1142694123 17:1623916-1623938 CGGTTCAGGTGGAAGCCTGGAGG - Intronic
1145013913 17:19384798-19384820 GATATCACGTGGCAGCCTGGCGG + Intronic
1145768377 17:27475126-27475148 GAGCTCATGTGGAAGCCAAAGGG + Intronic
1146435278 17:32840232-32840254 GAGTTCAGGAAGCAGCCTGGAGG + Intronic
1146787147 17:35730593-35730615 GAGCCCATGAGGAAGCATGGTGG - Intronic
1147232312 17:39028416-39028438 GAGTTCATCTGGAGTTCTGGAGG - Intergenic
1151107816 17:71638374-71638396 GTGTTGAAGTTGAAGCCTGGTGG - Intergenic
1151712093 17:75812775-75812797 GTGCACATGTGAAAGCCTGGAGG - Intronic
1154290779 18:13104335-13104357 GAATTCAGGTGGTACCCTGGTGG - Intronic
1155545514 18:26910375-26910397 GATTTCCTTTGGAAGCTTGGCGG + Exonic
1156365148 18:36419317-36419339 GAGTTCAAGTGGAGGCCTCCTGG + Intronic
1162060845 19:8094230-8094252 GGATTCATGAGGAAGCCTGTGGG + Intronic
1163645181 19:18485250-18485272 GAGTTGAGATGGAGGCCTGGAGG - Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165416488 19:35697186-35697208 GGGATCATGGGAAAGCCTGGGGG - Intergenic
1165831192 19:38731208-38731230 TTGTTCAGGTGGAAGCCTAGGGG + Exonic
1167050443 19:47074841-47074863 GAGTACATGAGGGCGCCTGGAGG - Intronic
1167117622 19:47497394-47497416 GAGTCCATGTTGCTGCCTGGGGG - Intronic
926642550 2:15253014-15253036 GAGTTCATGTGGAAGAAGGAGGG + Intronic
927411318 2:22829547-22829569 GAACTCATGTGGATGTCTGGGGG - Intergenic
929552867 2:42905511-42905533 GAGGTCATGTGAAAGCCGTGGGG - Intergenic
931649594 2:64455237-64455259 GTGTGCATGTGGAAGGCTGCTGG + Intronic
933975277 2:87504537-87504559 GTGGTCATGGGGAAGGCTGGGGG - Intergenic
935830415 2:106996098-106996120 GAAATGATGTGGAAGGCTGGAGG - Intergenic
936318549 2:111446276-111446298 GTGGTCATGGGGAAGGCTGGGGG + Intergenic
938943765 2:136192123-136192145 GAGTGGAAGGGGAAGCCTGGGGG + Intergenic
939732503 2:145801976-145801998 GAGTTCATGTTGCAGTCTTGAGG + Intergenic
942075862 2:172356713-172356735 GAGGTCATGGTGGAGCCTGGTGG + Intergenic
944402446 2:199343764-199343786 GAGTTCATGGGCCAGCCTTGAGG - Intronic
945168155 2:206967835-206967857 AATTTCATCTGGAAGCCAGGTGG + Intronic
946572825 2:221043149-221043171 CAGACCATGTGGAAGCTTGGTGG - Intergenic
946941741 2:224776433-224776455 GAGTTCCTGGGGCAGCGTGGGGG - Intronic
947699390 2:232219742-232219764 GAGTTGCTGTGGAAGCCTGTAGG - Intronic
948667282 2:239544618-239544640 GAGTCCATGTGGGAGCCCAGTGG - Intergenic
1169979678 20:11370452-11370474 GAGTTGATGTGTGAGACTGGAGG + Intergenic
1170158561 20:13290195-13290217 GAGCTGAGTTGGAAGCCTGGTGG + Intronic
1171350000 20:24494787-24494809 CAGTACATGGGGAAGGCTGGAGG - Intronic
1171423483 20:25034479-25034501 GGGTCCATTTGGAAGTCTGGGGG - Intronic
1172385327 20:34530120-34530142 GAGTTCATGTGGAAGCCTGGGGG - Intronic
1173202153 20:40962091-40962113 GTGGCCATGTGGAAGCGTGGAGG - Intergenic
1175679191 20:60973108-60973130 GAGGTCATGGGGGAGCCTTGAGG - Intergenic
1177049956 21:16220611-16220633 GTGTTTATGTGGCAGCCAGGTGG + Intergenic
1179403788 21:41108776-41108798 GACTTCCTGTGGCAGCCTGGGGG - Intergenic
1183671199 22:39273978-39274000 TGGTTCATGAGGAGGCCTGGGGG - Intergenic
1183678889 22:39315327-39315349 GAGTTGCTGTGCAAACCTGGGGG - Intronic
1184355254 22:43975303-43975325 GAGTTCAATTGCAAGCCTGAGGG + Intronic
949288697 3:2437840-2437862 GAGTTCGTGTAGATGTCTGGGGG + Intronic
951567541 3:24026335-24026357 GAGCTCGTGTGGAAGTCTGGAGG - Intergenic
953843345 3:46407269-46407291 GAGATCCTCTGGAGGCCTGGGGG + Intronic
956484918 3:69711904-69711926 GAATTCAGGTGCAAGCCGGGTGG - Intergenic
956973458 3:74553125-74553147 GAGAACATGTGGATGCATGGAGG - Intergenic
959444521 3:106422136-106422158 GAGTAGATGTGTAAGGCTGGAGG + Intergenic
959484635 3:106913111-106913133 GAGGTTATGTGGACACCTGGAGG - Intergenic
963681660 3:148385739-148385761 GAGTTCATGGGGAAGCTTTGGGG - Intergenic
965742964 3:171896008-171896030 CAGTTCATCTGGAAGCTGGGCGG + Intronic
968600682 4:1507883-1507905 GAGTCCATGTGGAAAAGTGGAGG - Intergenic
969574256 4:8027418-8027440 GATTTCATGTGTCAGCCGGGGGG - Intronic
970254664 4:14154895-14154917 AGGTTCAGGTGGAAGGCTGGTGG - Intergenic
971832457 4:31713800-31713822 CAGTCCATGAGGAAGCCTTGTGG - Intergenic
973846162 4:54915228-54915250 GAGTTCATATGGAAGAATGGTGG + Intergenic
974777393 4:66503224-66503246 GACTACATGTGTGAGCCTGGAGG + Intergenic
984915255 4:184717908-184717930 AAGTTAATGTAAAAGCCTGGTGG + Intronic
984981820 4:185289427-185289449 GCAGTCATCTGGAAGCCTGGGGG + Intronic
988871060 5:35390527-35390549 GAGAACATGTGGATGCTTGGAGG + Intergenic
988878868 5:35478163-35478185 CAGTTCATGATGAAGCCTGGTGG + Intergenic
992568402 5:78025609-78025631 GAATGCAGATGGAAGCCTGGAGG + Intronic
993704677 5:91156085-91156107 GAGTTCAGATGTAGGCCTGGTGG + Intronic
998673424 5:144379533-144379555 GAGTTCATTTGGGAGCTTGGGGG + Intronic
1000721883 5:164718436-164718458 GAGAACATGTGGAAACATGGGGG - Intergenic
1002188776 5:177468301-177468323 GGGTGCCTGTGGAGGCCTGGAGG - Intronic
1002409855 5:179065277-179065299 AATGTCATGTGGAATCCTGGGGG - Intronic
1003248291 6:4402376-4402398 GAGTCCTTGGGGGAGCCTGGAGG - Intergenic
1005754272 6:28911480-28911502 GGGTTCATGTGGGAGGCTGCCGG - Intronic
1006167102 6:32071416-32071438 GGGTGGATGTGGGAGCCTGGGGG - Intronic
1007428215 6:41760682-41760704 GATTTGAGCTGGAAGCCTGGGGG - Intergenic
1008489933 6:52076002-52076024 GAGTTGATGTTGGAGACTGGAGG - Intronic
1010850649 6:80772350-80772372 GAGTACATATGGAAGCCTATAGG + Intergenic
1011249138 6:85352296-85352318 GAGTGAATGTGAAGGCCTGGGGG + Intergenic
1012547542 6:100436609-100436631 GAGATCATGTGTAAGGTTGGTGG - Intronic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1018795391 6:167181386-167181408 GAGTTCACCTGGAAGCCTCCGGG + Intronic
1018820932 6:167373677-167373699 GAGTTCACCTGGAAGCCTCCGGG - Intronic
1019660317 7:2220334-2220356 GTGGTCAGGAGGAAGCCTGGCGG - Intronic
1021205045 7:17769830-17769852 GGGTGGAGGTGGAAGCCTGGAGG - Intergenic
1022105475 7:27193274-27193296 GGGTTCTTGTAGAAGCGTGGAGG + Intergenic
1022846175 7:34212282-34212304 GTGTGCATGTGGAAGTGTGGAGG - Intergenic
1030857385 7:114577624-114577646 GAGATCAGGAGGAAGTCTGGTGG - Intronic
1031823294 7:126531479-126531501 GTGTTCATTTGAAAACCTGGGGG - Intronic
1033144464 7:138859545-138859567 GAGTTCATGAGGGAGCGTGCAGG - Intronic
1033468563 7:141621658-141621680 GAGTGCATGTGGCAGTGTGGTGG + Intronic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1036428119 8:8665193-8665215 GAGGTCACGTGGGCGCCTGGCGG - Intergenic
1036443602 8:8802871-8802893 GAATTCATGGGGAAGGCAGGTGG + Intronic
1037290680 8:17346459-17346481 GAGTTCATTTTCAGGCCTGGAGG + Intronic
1037522456 8:19693164-19693186 GGGTTTAAGTGGAAGACTGGAGG + Intronic
1040034260 8:42853376-42853398 GAGTTGTTGTAGAAGACTGGTGG - Exonic
1041128165 8:54666640-54666662 GAGTACATCTGGAAGCCTAGAGG - Intergenic
1042211651 8:66387108-66387130 AACTTCATGTGAAATCCTGGAGG + Intergenic
1044142074 8:88668792-88668814 GTGTTCATGTGGAGGCCAGAGGG + Intergenic
1046462863 8:114565704-114565726 GGCTTCATGTGGAAGGGTGGGGG - Intergenic
1048299619 8:133241858-133241880 GAGGGCATGTGGCAGCCTGGAGG - Intronic
1049450713 8:142660026-142660048 GGGCTCATGTGGGAGGCTGGTGG + Intronic
1049600165 8:143503916-143503938 GGGCCCATGTGGAAGGCTGGAGG - Intronic
1052842570 9:33305501-33305523 GACTTCATTTGGAAGGCTGTGGG + Intronic
1054922351 9:70554991-70555013 GACTTCATGCTGAAGCCAGGGGG - Intronic
1058131653 9:101260409-101260431 GAGAGAATGTGGAAGCCTGAAGG + Intronic
1058601792 9:106678472-106678494 GTGTTCATGAGGCAGCCAGGTGG - Intergenic
1059508033 9:114817630-114817652 GAGTATCTGTGGAAGGCTGGGGG + Intergenic
1060185488 9:121561711-121561733 GAGTTCATCAGGCAGACTGGAGG - Intergenic
1060747337 9:126146256-126146278 GAGCGCAGGTGGAAGCATGGAGG - Intergenic
1187126887 X:16462372-16462394 GAGCTCATGGGGAAGCCAGCCGG + Intergenic
1190636675 X:52441605-52441627 GCATTCATGAGGAAGACTGGAGG + Intergenic
1192236795 X:69301329-69301351 GTGTTCATGTGCACTCCTGGGGG + Intergenic
1193425739 X:81338435-81338457 GTGTTGATCTGGAGGCCTGGGGG + Intergenic
1194628627 X:96255650-96255672 GAGTTCATGTCCAAAGCTGGAGG - Intergenic
1194922483 X:99783315-99783337 GAGATCAAGTGGAAGGCTGCGGG - Intergenic
1202096814 Y:21259923-21259945 GAGCTCCTGTGGAAGACTGCAGG + Intergenic
1202170151 Y:22034829-22034851 GAGTTCCTCTGGAAACATGGCGG + Intergenic
1202221215 Y:22551544-22551566 GAGTTCCTCTGGAAACATGGCGG - Intergenic
1202321900 Y:23644118-23644140 GAGTTCCTCTGGAAACATGGCGG + Intergenic
1202548867 Y:26025938-26025960 GAGTTCCTCTGGAAACATGGCGG - Intergenic