ID: 1172388206

View in Genome Browser
Species Human (GRCh38)
Location 20:34548477-34548499
Sequence CACGCCCCTGGCTCAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172388200_1172388206 20 Left 1172388200 20:34548434-34548456 CCTCTCACTCAGGGAGGTGGAGT 0: 1
1: 0
2: 2
3: 14
4: 290
Right 1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 109
1172388199_1172388206 21 Left 1172388199 20:34548433-34548455 CCCTCTCACTCAGGGAGGTGGAG 0: 1
1: 0
2: 2
3: 27
4: 253
Right 1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 109
1172388197_1172388206 25 Left 1172388197 20:34548429-34548451 CCGGCCCTCTCACTCAGGGAGGT 0: 1
1: 0
2: 1
3: 26
4: 214
Right 1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 109
1172388194_1172388206 27 Left 1172388194 20:34548427-34548449 CCCCGGCCCTCTCACTCAGGGAG 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 109
1172388195_1172388206 26 Left 1172388195 20:34548428-34548450 CCCGGCCCTCTCACTCAGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 352
Right 1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172388206 Original CRISPR CACGCCCCTGGCTCAAGAGG AGG Intronic
900031717 1:377619-377641 CACCACCCAGGCTCATGAGGTGG - Intergenic
900052264 1:605810-605832 CACCACCCAGGCTCATGAGGTGG - Intergenic
906777499 1:48543196-48543218 CACACCCCTGACTCAGGAGTAGG + Intronic
907456818 1:54581518-54581540 CATGACTCTGGCTCAGGAGGAGG + Intronic
918151384 1:181800300-181800322 CATGCCCCTGGGCCAAGATGGGG + Intronic
919981039 1:202643176-202643198 CACGCCTCAGGCCCTAGAGGTGG + Intronic
923123064 1:231012214-231012236 CAAGACCCTGTCTCAAGAGAAGG - Intergenic
923370914 1:233311409-233311431 CAAGCCCATGGCTCCAGAGCGGG + Intergenic
1063068097 10:2629920-2629942 CCCGCCCCGGGCTCCAGAGTTGG + Intergenic
1065115335 10:22477909-22477931 CAAGCCCCTGGGACAAGAAGAGG - Intergenic
1067046748 10:42989523-42989545 CATGCCCAGGTCTCAAGAGGAGG + Intergenic
1067287047 10:44914397-44914419 CACCTCCCTGGCTCAGGATGTGG + Intronic
1072619044 10:97067816-97067838 CACGGGCCTGGCCCAGGAGGAGG - Intronic
1081610571 11:44560653-44560675 CAAGGCCCTGGTTCAAGAGCAGG - Intergenic
1083668060 11:64285942-64285964 CACGCTCCAGCCTCAAGGGGAGG - Intronic
1090840915 11:130486986-130487008 AACGCCCCTGGCTAGGGAGGCGG + Intergenic
1091751719 12:3026030-3026052 CAAGTACCTGGCTCAAGACGGGG - Intronic
1092072133 12:5639968-5639990 CAGGCACCTAGCTCTAGAGGAGG + Intronic
1095353407 12:41242115-41242137 CACATACCTGGCTCAAGAGTTGG - Intronic
1097078953 12:56415476-56415498 CACGCCACCGGCTCATGCGGTGG + Intergenic
1100605764 12:96150752-96150774 AACTCCCCTGGCTTAAAAGGGGG - Intergenic
1102009101 12:109607076-109607098 CAGGCCCCTGGATCAGGAAGTGG - Intergenic
1113901647 13:113801296-113801318 CGGGCCCCTGTCCCAAGAGGGGG - Intronic
1119382266 14:74236851-74236873 CACACCCCTGGCCCAAGCTGTGG + Intergenic
1125368592 15:38945900-38945922 CACGCCCATGACGCAGGAGGTGG - Intergenic
1129302799 15:74635742-74635764 CAAGTCCCAGGCTCCAGAGGGGG + Intronic
1134091443 16:11393623-11393645 CCCGCCCCAGGCTCAGGAAGAGG + Intronic
1134187865 16:12098625-12098647 CACGACCCAGGCAAAAGAGGAGG - Intronic
1134649712 16:15898830-15898852 CATACCCCTGGCTCGAGGGGAGG + Intergenic
1135153372 16:20030598-20030620 GACGCACATGGCTCAAAAGGGGG - Intergenic
1135260798 16:20978893-20978915 CATGCCCCTGGCTCTACAGCTGG + Intronic
1137572887 16:49578298-49578320 CAGCCCCCTGGCTCCAGCGGGGG + Intronic
1138082827 16:54108013-54108035 CTCTCCCCTGGCTGTAGAGGTGG + Intronic
1139468169 16:67165011-67165033 CACGGCCCAGTCTCAGGAGGGGG - Intronic
1144575576 17:16427532-16427554 CACTCACCTGGCCCACGAGGAGG - Exonic
1144887409 17:18472697-18472719 CACCACCCAGGCTCAAGGGGAGG - Intergenic
1144952178 17:19000273-19000295 GACTCCCCTGGGACAAGAGGCGG - Intronic
1145144807 17:20471597-20471619 CACCACCCAGGCTCAAGGGGAGG + Intergenic
1146354120 17:32119785-32119807 CACCACCCAGGCTCAAGGGGAGG - Intergenic
1147771161 17:42868460-42868482 CACGCCCCTGACCCATGGGGTGG + Intergenic
1148908934 17:50929683-50929705 CACCTCCCGGGCTCAAGACGAGG + Intergenic
1152779480 17:82219909-82219931 CCAGCCCCCAGCTCAAGAGGAGG + Intergenic
1152947938 17:83208095-83208117 CACCACCCAGGCTCATGAGGTGG + Intergenic
1155057834 18:22200640-22200662 CACCCGCCTGGCAGAAGAGGGGG - Exonic
1156019246 18:32580809-32580831 CACACCCCTAGCTCCAAAGGTGG + Intergenic
1160527804 18:79547666-79547688 CAGGCGCCTGGCTCCAGCGGAGG + Intergenic
1161850995 19:6737999-6738021 CACATCCCTGGCTCAAGAAGAGG - Intronic
1164128124 19:22336988-22337010 CAGGGCCCTGGCAGAAGAGGAGG + Intergenic
1165068811 19:33243478-33243500 CACGACCCTGTCTCAACAGGTGG + Intergenic
1166500534 19:43337784-43337806 CGCACACCTGGCTCAGGAGGTGG + Intergenic
1166764640 19:45245474-45245496 CCCGCCCCTGGCCCCAGAGAGGG - Intronic
1167465644 19:49649897-49649919 CCAGCCCCTGGATCAAGGGGTGG + Intronic
925454549 2:4004052-4004074 CACGCCACTGGCTCCAAAGTTGG + Intergenic
925742456 2:7018047-7018069 CACCCTCCTGGCTCAACAGTGGG - Intronic
931300588 2:60974506-60974528 CACGCCCCTTGCTCACCACGGGG + Intronic
932440934 2:71734473-71734495 CACTCACCTGGCTGAAGAGAGGG + Intergenic
934717780 2:96553319-96553341 CAGGGCCTTGGCTCAGGAGGAGG + Intergenic
935744836 2:106181256-106181278 CACGTCCCTGGCTCAGGGCGGGG + Intronic
936061318 2:109297445-109297467 CACCCCTCTGGCTCTGGAGGAGG - Intronic
937175495 2:119928283-119928305 CACGTCCCTGCCTCCAGAGTAGG + Intronic
941029545 2:160494355-160494377 CATGCCCCTTGCACAAGGGGAGG + Intergenic
942502690 2:176607890-176607912 CAAGGCCCTGTCTCAAGGGGGGG + Intergenic
946434526 2:219642920-219642942 AAGGCACCAGGCTCAAGAGGTGG + Intergenic
947003583 2:225486103-225486125 CACGCACCTTGCTCAAGGGTGGG - Intronic
947446414 2:230167019-230167041 CAGGCCTCTAGTTCAAGAGGAGG + Intergenic
948118123 2:235508964-235508986 CACGCCCCCGACTAAAGTGGTGG - Intronic
1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG + Intronic
1172668019 20:36614137-36614159 CACGGCCCAGGCTCGACAGGTGG - Intronic
1176011522 20:62899127-62899149 CAAGCCCCGGTCTCCAGAGGCGG + Intronic
1176104957 20:63381594-63381616 CTCCGCCCTGACTCAAGAGGAGG - Intergenic
1176272991 20:64246227-64246249 CAGGCCCCTGACTCCAGAGCTGG + Intergenic
1180143416 21:45906650-45906672 CAGACCCCTGCCTCATGAGGTGG - Intronic
1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG + Intronic
1181316001 22:21971236-21971258 CTCACCCGTGGCTCAAGAGCTGG - Intronic
1182442336 22:30371756-30371778 CACACCCCTGGCTTGAGATGTGG - Intronic
1183352376 22:37341442-37341464 CACCCGCCTGGGTCTAGAGGAGG + Intergenic
1184361617 22:44022516-44022538 CACGCCCCTGGCTGAGGACTGGG + Intronic
950134174 3:10569028-10569050 CACGTCCCAGGGTTAAGAGGAGG - Intronic
951819850 3:26796108-26796130 CAGGGCCCTGCCTCAAAAGGGGG + Intergenic
977564410 4:98566889-98566911 CAAGCCTCGGCCTCAAGAGGAGG + Intronic
978342604 4:107734343-107734365 CCCGCCACTGGCTCAGAAGGGGG + Intergenic
991626177 5:68603301-68603323 CATTCTCCTGCCTCAAGAGGAGG + Intergenic
992381910 5:76245892-76245914 CACTCCCCTGCCTCAATAGATGG - Intronic
997385844 5:133471876-133471898 CATCCCCCTTGCTCTAGAGGGGG + Intronic
1001163592 5:169343426-169343448 CTCACCCCTGGCTCCAGAAGTGG + Intergenic
1002742103 5:181441249-181441271 CACCACCCAGGCTCATGAGGTGG + Intergenic
1005039208 6:21587042-21587064 CACACCCCTGGCCCGAGAGGCGG + Intergenic
1005976559 6:30804518-30804540 CAGGGCCCTGGCTCAGGAAGTGG - Intergenic
1018922387 6:168184296-168184318 CACACCCCTGGATAAAGAAGTGG + Intergenic
1019247239 6:170716987-170717009 CACCACCCAGGCTCATGAGGTGG + Intergenic
1022794250 7:33719448-33719470 CACACCCCAGGCTAAAAAGGCGG - Intergenic
1023151797 7:37208313-37208335 CTGGCCCATGGCTCAAAAGGAGG + Intronic
1027787327 7:82597187-82597209 CATGCACCTGGCTCAAGACATGG - Intergenic
1028364662 7:90013359-90013381 CCTGACCCTGGCTCCAGAGGAGG + Intergenic
1032903549 7:136338253-136338275 CAGGACCCTGGATCAGGAGGAGG - Intergenic
1034421432 7:150993109-150993131 CACCCCCATGACTCAAGTGGGGG - Intronic
1034914167 7:155023180-155023202 CACTCACCTGGCCCAGGAGGTGG - Intergenic
1035500896 8:90947-90969 CACCACCCAGGCTCATGAGGTGG - Intergenic
1037599021 8:20378243-20378265 CAGGTCCCTCGGTCAAGAGGTGG - Intergenic
1045489167 8:102656020-102656042 CCCGCCCCTGCCTAGAGAGGCGG + Intergenic
1047325534 8:123832228-123832250 CAAGCCCCTGCCTCGAGACGTGG - Intergenic
1048028993 8:130613257-130613279 CAGGCCCCTCCCTCAACAGGTGG - Intergenic
1048356992 8:133661710-133661732 CACGCCCCTGCCGCGTGAGGTGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1060403652 9:123362285-123362307 CAGACCCCTGGCAGAAGAGGTGG + Intronic
1060479398 9:124009175-124009197 CAGGCCCCGGGGTCCAGAGGCGG - Intronic
1203608014 Un_KI270748v1:72465-72487 CACCACCCAGGCTCATGAGGTGG + Intergenic
1185706413 X:2270574-2270596 CACGTCCCTGGCCCCAGTGGAGG + Intronic
1193224129 X:78961498-78961520 CACTCTCCTTGCTCATGAGGCGG - Exonic
1195615650 X:106909836-106909858 CACAGCCCTGGCTCAAATGGTGG - Intronic
1196045113 X:111248720-111248742 CACGCTCCTGGATGTAGAGGTGG + Exonic
1198461929 X:136871661-136871683 CAAGACCCTGTCTCAAGAAGAGG - Intronic
1199778207 X:151034163-151034185 CACTCCTGGGGCTCAAGAGGAGG + Intergenic