ID: 1172390301

View in Genome Browser
Species Human (GRCh38)
Location 20:34560975-34560997
Sequence AGGATCTGGGGGGAGAGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 959
Summary {0: 1, 1: 0, 2: 12, 3: 74, 4: 872}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172390291_1172390301 15 Left 1172390291 20:34560937-34560959 CCCGCCGCAGGAAGGCATAGAAG 0: 1
1: 0
2: 1
3: 45
4: 145
Right 1172390301 20:34560975-34560997 AGGATCTGGGGGGAGAGAGAGGG 0: 1
1: 0
2: 12
3: 74
4: 872
1172390293_1172390301 11 Left 1172390293 20:34560941-34560963 CCGCAGGAAGGCATAGAAGTAAT 0: 1
1: 0
2: 0
3: 10
4: 194
Right 1172390301 20:34560975-34560997 AGGATCTGGGGGGAGAGAGAGGG 0: 1
1: 0
2: 12
3: 74
4: 872
1172390292_1172390301 14 Left 1172390292 20:34560938-34560960 CCGCCGCAGGAAGGCATAGAAGT 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1172390301 20:34560975-34560997 AGGATCTGGGGGGAGAGAGAGGG 0: 1
1: 0
2: 12
3: 74
4: 872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172390301 Original CRISPR AGGATCTGGGGGGAGAGAGA GGG Exonic
900118531 1:1038843-1038865 AGATGCTGAGGGGAGAGAGAAGG + Intronic
900126870 1:1072644-1072666 GGGATCTCTGGGGCGAGAGAGGG - Intronic
900270648 1:1785749-1785771 AGGGTGGGGAGGGAGAGAGAGGG - Exonic
900293915 1:1939222-1939244 GTGTGCTGGGGGGAGAGAGAGGG + Intronic
900365910 1:2311908-2311930 CAGAGGTGGGGGGAGAGAGATGG + Intergenic
900595359 1:3477857-3477879 AGGGACTGGGGGGACAGAGCCGG - Exonic
900777962 1:4598923-4598945 AGGCTCTGGAGCCAGAGAGACGG + Intergenic
901144848 1:7057904-7057926 AGGATCTGGGGGTCCAGAGAAGG - Intronic
901197276 1:7447241-7447263 ACCATCTGGAGGGAGAGAGTAGG + Intronic
901357504 1:8663981-8664003 AGGATTGGGGGGCAAAGAGAAGG - Intronic
901364973 1:8738973-8738995 AGCATATTTGGGGAGAGAGATGG - Intronic
901843081 1:11965741-11965763 AGGATTTGGGTAGGGAGAGAAGG + Intronic
902072460 1:13751928-13751950 AGGTGATGAGGGGAGAGAGAAGG - Intronic
902399569 1:16150641-16150663 GGGAACTGGGGAGACAGAGAAGG - Intronic
902512295 1:16973024-16973046 AGGGTCTGGGGCAAGAGGGATGG + Intergenic
902725134 1:18330505-18330527 AGGGGCAGGGGCGAGAGAGAAGG + Intronic
902757135 1:18556313-18556335 AGGCTCTGGGGGCACAGAGATGG - Intergenic
902919664 1:19658223-19658245 GGGACCTGGGGGGAGGGACAGGG + Intronic
903321833 1:22547955-22547977 AGGAGAGAGGGGGAGAGAGAGGG - Intergenic
903884723 1:26534375-26534397 AGGTTATGGGGGTAGAGAGGAGG + Intronic
904209876 1:28879937-28879959 AGGGTGTAGGGGGAGACAGAGGG + Intergenic
904677016 1:32205009-32205031 ACGATCTGGATGAAGAGAGAGGG + Intronic
904868080 1:33598371-33598393 AGGGTCTGGGGCAAGAGAGGAGG - Intronic
904939167 1:34152882-34152904 AGGGGCTGGGGAGGGAGAGATGG - Intronic
905390321 1:37632235-37632257 AGGACCTGGGAGGATTGAGAAGG - Intronic
905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG + Intronic
905427181 1:37895501-37895523 AGACTGTGGGGAGAGAGAGAGGG - Intronic
905731158 1:40300388-40300410 AGGCTCTGGAGGGGGAGGGAAGG - Intergenic
907332738 1:53681836-53681858 AGGATGGGGGAGGAGAGAGGGGG - Intronic
907425357 1:54375919-54375941 AGGCTCTGGGAGGAAAGGGAGGG + Intronic
907595762 1:55718433-55718455 TGGATATGGAGGGGGAGAGAAGG + Intergenic
907775124 1:57506739-57506761 AGAAACTGGGAGGACAGAGATGG - Intronic
907839516 1:58142809-58142831 AGGCTCTGGCTGCAGAGAGAAGG - Intronic
908254250 1:62289731-62289753 ATTATTTGGGGGGAAAGAGATGG + Intronic
908970453 1:69822511-69822533 AGGAGCTGGGAGGAGAGGTACGG - Intronic
909480586 1:76125475-76125497 AGGAGCAGAGGGGAGAGAGGTGG - Intronic
909633680 1:77792444-77792466 AGTGTCTGGTGGGAAAGAGAGGG + Intronic
909967574 1:81934594-81934616 AGCAACTGGTGGGAGAGAGAGGG - Intronic
910012786 1:82486204-82486226 AGGATCTTGGGGAGGAGAGGAGG + Intergenic
910936643 1:92488357-92488379 AGGAGCAGGTGGGAGGGAGATGG + Intergenic
911183450 1:94881349-94881371 AGGAAATGGTGGGAGAGAGGTGG - Intronic
912390261 1:109297793-109297815 AGGATCTTGGGAAAGAGGGATGG + Intronic
912483464 1:110004243-110004265 AGTTTCTTGGGGGAGAGGGAGGG - Intronic
912498662 1:110107465-110107487 AGAACCTGGGGAGACAGAGAAGG - Intergenic
912557273 1:110525223-110525245 AGGCTCTGGGGGCAGACAGGAGG + Intergenic
912904492 1:113689598-113689620 CGGACCTGGGGGCAGGGAGAAGG + Intergenic
913215854 1:116619718-116619740 AGGTTGGGAGGGGAGAGAGAGGG - Intronic
913613203 1:120529014-120529036 AGGATCTTGGGTGAGAGAGAGGG - Intergenic
914371555 1:147029776-147029798 AGGATCTTGGGTGAGAGAGAGGG - Intergenic
914577984 1:148993233-148993255 AGGATCTTGGGTGAGAGAGAGGG + Intronic
915206341 1:154273055-154273077 AGGACCTTGGGAGAGAGAGGAGG + Intronic
915576432 1:156781647-156781669 AGGATCTGGGGCAAGACAGGAGG - Intronic
915631130 1:157154864-157154886 AGGAGCTGGGAGGTGAGGGAGGG - Intergenic
915708963 1:157875078-157875100 AGGCTCTGGGTGGTGAGAGGAGG - Intronic
915740905 1:158117806-158117828 AGGATCAGGGAGAAGAGAGTAGG + Intergenic
916354427 1:163888877-163888899 AGGCAGTGGAGGGAGAGAGAAGG - Intergenic
916470390 1:165117702-165117724 AGGCTTTGGAGGGAGTGAGAGGG - Intergenic
916677466 1:167075929-167075951 GGGACCTGAGGGCAGAGAGATGG + Intronic
916778807 1:168000127-168000149 AGGCTCGAGAGGGAGAGAGATGG + Intronic
917051966 1:170934692-170934714 AGGTACTTGGGGGAGAGGGAGGG + Intergenic
917121398 1:171647752-171647774 AGGATGTGAGGGGAGGGTGAGGG - Intronic
917231708 1:172844828-172844850 AGGAAGGGGGGGGAGAGAGAGGG + Intergenic
918313546 1:183304009-183304031 AGGGTATGAGGGCAGAGAGAGGG - Intronic
918407369 1:184224173-184224195 AGAAGGTGGGTGGAGAGAGAGGG - Intergenic
919730223 1:200908944-200908966 AGGATCAGGGGGAAGGGAGAAGG + Intronic
920285919 1:204879598-204879620 AGGATCTGGGGGCAGCCAAATGG + Intronic
920689501 1:208135101-208135123 AGTATCTGGGGAGAGATGGAAGG - Intronic
921683279 1:218059879-218059901 AAGAGCTGGGGGCAGAGGGAAGG - Intergenic
921888523 1:220330421-220330443 AGGGCCTGGAGGGAGAGAGGGGG - Intergenic
922101579 1:222481746-222481768 TGGATATGGGGTGTGAGAGAAGG - Intergenic
922128688 1:222755378-222755400 AGGAGCAGGAGGAAGAGAGAGGG + Intergenic
922262660 1:223956862-223956884 TGGATATGGGGTGTGAGAGAAGG - Intergenic
922780289 1:228246955-228246977 AGGATATGTGTGGAGGGAGAGGG + Intronic
923524875 1:234764811-234764833 AGGGGCTGGGGAGAGAGAAATGG - Intergenic
923776574 1:236983898-236983920 AGGAGGTGGGGGAAGAGGGAGGG + Intergenic
923784093 1:237051207-237051229 AGGAAGGGGGGGGAGAGAAAGGG - Intronic
923886754 1:238165629-238165651 AGGAGCAGGGTGGAGAAAGAAGG - Intergenic
924344499 1:243061863-243061885 TGGATATGGGGTGTGAGAGAAGG - Intergenic
924553205 1:245097687-245097709 AGGATAAGGGGTGAGAGTGATGG + Intronic
924660869 1:246015601-246015623 AGGATCTGAGGGGAGAGGGTCGG - Intronic
1062942651 10:1435612-1435634 AGGAAGTGGAAGGAGAGAGAGGG - Intronic
1063113785 10:3058615-3058637 AGAAAATGGGGGGAGAGAGATGG - Intergenic
1063377348 10:5562062-5562084 GGGATCTGGGGGGAGATACCAGG - Intergenic
1063505030 10:6590013-6590035 CGGCCCTGGGGGGACAGAGATGG - Intergenic
1063583342 10:7329491-7329513 ATGAGCTGGAGGGAGAGAGGAGG + Intronic
1064091858 10:12392364-12392386 AGGGGCTGGGGGGAGAGGGAAGG - Intronic
1064696630 10:17973827-17973849 AGGAGATGGGGAGAGAGATAGGG - Intronic
1065338353 10:24678410-24678432 AGGAGGTGGAGGGAGAGAGCAGG - Intronic
1065385921 10:25133031-25133053 AGGCTGTGGGGGGAGTGGGAAGG + Intergenic
1065470377 10:26073811-26073833 AGGAAATGGGGGTGGAGAGAGGG + Intronic
1065512383 10:26492237-26492259 GGGCTCTTGGGGGAAAGAGAGGG + Intronic
1065642555 10:27799374-27799396 AGGATGTCAGAGGAGAGAGAAGG + Intergenic
1065870553 10:29952698-29952720 AGGAGCAGGAGGGAGAGAGGAGG + Intergenic
1065987605 10:30971468-30971490 ATGATCTCTGGGGAGACAGAAGG + Intronic
1066258355 10:33703970-33703992 AGCATGTGGGGGTGGAGAGAGGG - Intergenic
1066731834 10:38443209-38443231 TGGATATGGGGTGTGAGAGAAGG + Intergenic
1067142459 10:43668583-43668605 AGGAGCTGAGGGGAGTGAGCAGG + Intergenic
1067459541 10:46447512-46447534 ATGATCTGGGCGGCGAGAGGAGG + Intergenic
1067555821 10:47269514-47269536 AGGAGCTGGGGGAGGGGAGAAGG - Intergenic
1067755529 10:49001687-49001709 AGGAAATGGGGGGAAACAGAAGG + Intergenic
1067941945 10:50664241-50664263 AGAATTTGGAGGCAGAGAGATGG - Intergenic
1067985207 10:51136158-51136180 TGGATATGGGGTGTGAGAGAGGG + Intronic
1068332716 10:55592328-55592350 AAGAACTGGAGGAAGAGAGAAGG + Intronic
1069604632 10:69731676-69731698 AGGATCTGGGGAGAAAGGGTGGG - Intergenic
1069738997 10:70675571-70675593 TGGCTCTGGGAGGAGAGACAGGG - Intronic
1070295694 10:75159504-75159526 GGGATCTGAGGGGATATAGAAGG - Intronic
1070395299 10:76007059-76007081 AGGCCCAGGGGGCAGAGAGACGG - Intronic
1070613363 10:77949702-77949724 AGGAAGTGAGGGGAGAGTGATGG + Intergenic
1070643347 10:78184648-78184670 AGGATTTGAGAGGAGAGAGGAGG + Intergenic
1070766028 10:79056878-79056900 AGGGGCTGGGGCTAGAGAGATGG + Intergenic
1070793211 10:79201991-79202013 GGGAGGTGGTGGGAGAGAGATGG - Intronic
1070863189 10:79689192-79689214 AGAATTTGGAGGCAGAGAGATGG - Intergenic
1070921730 10:80191452-80191474 AGGATCTGGAAGGAAAGAGAAGG - Intronic
1071519377 10:86319563-86319585 AGGAGTTGGGGGGAGAGGGGAGG - Intronic
1072003926 10:91223790-91223812 TAGATGTAGGGGGAGAGAGAAGG + Intronic
1072637251 10:97185918-97185940 GGGAGCTGGAGGGAGGGAGAGGG - Exonic
1072741489 10:97912594-97912616 AGGGACTGGGGGGTGAGACAGGG + Intronic
1073034140 10:100551425-100551447 AGTCTCTGGGGGCAGAGGGAGGG - Exonic
1073121698 10:101125874-101125896 AGGAGGTGGGGGGAGTGAGTAGG - Intronic
1073430851 10:103485885-103485907 AGGAACTGGGGTGAGAGGAAGGG + Intergenic
1073457559 10:103646893-103646915 AGTACCTGAGGGCAGAGAGATGG + Intronic
1073833235 10:107411023-107411045 AGGGTCTGGTGGGAGATAAATGG + Intergenic
1073834628 10:107426818-107426840 AGCATCTGGGGAGGGAGGGACGG - Intergenic
1073867900 10:107825870-107825892 AGGATCTGGGGGTTTTGAGAGGG + Intergenic
1073935098 10:108621591-108621613 AGGATGAGGAGAGAGAGAGAGGG - Intergenic
1074120726 10:110492777-110492799 AGGATCGGGGGCAAGAGAGATGG + Intergenic
1074217719 10:111403884-111403906 AGGGGGTGGGGGGAGAGAGGGGG - Intergenic
1074667405 10:115745048-115745070 AGGGTCTTGGGGCAGAGTGATGG - Intronic
1074714776 10:116208179-116208201 AGTATCTGGGGGAGGACAGAAGG - Intronic
1074765561 10:116697435-116697457 GGGGTCTGGGGGGATAGAGGAGG + Intronic
1075076306 10:119352942-119352964 AGGTCCTCAGGGGAGAGAGAGGG - Intronic
1075503020 10:122995407-122995429 AGGCTCTGGGGGTACAAAGATGG + Intronic
1075572171 10:123554128-123554150 GGGACCTGGGGGGAGGGAGCTGG - Intergenic
1075817423 10:125275536-125275558 AGGGTCTAGGGGGAGAGAACTGG - Intergenic
1076049495 10:127321244-127321266 AGGAGAGGGGAGGAGAGAGAGGG - Intronic
1076078509 10:127556780-127556802 AGGGTGAGGGTGGAGAGAGATGG + Intergenic
1076153542 10:128184924-128184946 AGGGTCTGGGGAGAGATAAATGG - Intergenic
1076286837 10:129307725-129307747 TGGCTCTGGTGAGAGAGAGAAGG + Intergenic
1076321292 10:129583864-129583886 TGGAGCTGGGAGGAGACAGATGG + Intronic
1076980268 11:200390-200412 AGGGTCTGTGTGGGGAGAGATGG + Intronic
1077242422 11:1517562-1517584 AAGAGCTGGTGCGAGAGAGAAGG - Intergenic
1077268712 11:1665233-1665255 GGGATTTGGGGGGTGTGAGAGGG + Intergenic
1077272063 11:1686070-1686092 GGGATTTGGGGGGTGTGAGAGGG - Intergenic
1078006764 11:7537969-7537991 AGGATCAGCTTGGAGAGAGAGGG + Intronic
1078580913 11:12539070-12539092 TGGAGTTGGGGGGAGAGGGAAGG + Intergenic
1078613816 11:12846241-12846263 AGGCTCTGGGGGGTGGGGGAGGG - Intronic
1078949939 11:16118996-16119018 GTGATCTTGGGAGAGAGAGAAGG + Intronic
1079081516 11:17416607-17416629 AGGGTCTGGTGGGAGAGAGAGGG - Intronic
1079243009 11:18733816-18733838 AGGAGGAGGGTGGAGAGAGAGGG + Intronic
1079317720 11:19423391-19423413 AGGTGCTGGGAGTAGAGAGATGG + Intronic
1080580023 11:33634580-33634602 AAGTTATGGGGGGAGAAAGACGG + Intronic
1080996872 11:37613550-37613572 AGAATCTGAAGGGAGAAAGAGGG + Intergenic
1081489745 11:43558188-43558210 AGGAGCTTGGGGAAGAGAGGTGG + Intronic
1082120232 11:48372236-48372258 AGGAGCTGGGGAGAGACAGAGGG + Intergenic
1083115770 11:60457808-60457830 AGGAGGTGGGGGAAGAGAGTGGG + Intronic
1083989848 11:66240293-66240315 AGCAGCAGGGGGCAGAGAGAGGG + Intronic
1084028610 11:66467590-66467612 GGGGAATGGGGGGAGAGAGACGG + Intronic
1084104876 11:66974982-66975004 AGGAGGAGGGGGGAGGGAGAGGG + Intergenic
1084266798 11:68009170-68009192 AGGAAGTGGGGGCAGAGAGGGGG - Intronic
1084591183 11:70091586-70091608 AGGACATGGAGGGAGAGAAAGGG + Intronic
1085680961 11:78574649-78574671 AGGTTCTGTGGGGACAGAGCTGG - Exonic
1085810298 11:79674020-79674042 AGGGGCTGAGGGGAGAGTGAGGG - Intergenic
1085817448 11:79755144-79755166 AGGATCAGAGTGGAAAGAGACGG - Intergenic
1086161890 11:83731279-83731301 AGGGGCTGGGGGGAGAGGGGAGG - Intronic
1086599570 11:88616339-88616361 AGGATATGAGGCAAGAGAGATGG + Intronic
1087242243 11:95791977-95791999 AGGATCTAGGGGGAAAGAGTTGG + Intronic
1088290115 11:108227022-108227044 AGGCTCTGCGGGGCGGGAGATGG - Intronic
1088501813 11:110490822-110490844 AGGAGCTGGTGGGATGGAGACGG + Intergenic
1088747682 11:112818045-112818067 AAGATGGGGCGGGAGAGAGAGGG - Intergenic
1088840778 11:113625905-113625927 AGAATCTGGGTGGTCAGAGAGGG + Intergenic
1089218374 11:116849805-116849827 AGTAAGTGTGGGGAGAGAGAAGG - Intronic
1089225789 11:116920278-116920300 AGAAGTTGGGGTGAGAGAGATGG - Intronic
1089374935 11:117987516-117987538 AGGATCAAGGAGGAGAGAAAGGG + Intronic
1089540283 11:119185716-119185738 AGGACTTGGGGGGAGAGAAAGGG + Intronic
1089603377 11:119628138-119628160 AGGGTGGGAGGGGAGAGAGACGG - Intronic
1090036499 11:123253989-123254011 TGCAACTGGGGGGAGAGAGAAGG - Intergenic
1090796538 11:130140396-130140418 AGGATCTGGAGTGGGAGAGCAGG + Exonic
1090816370 11:130300148-130300170 GGGATGTGGGGAGACAGAGATGG + Intronic
1090931516 11:131301886-131301908 AGGATCTTGGGCCACAGAGAGGG - Intergenic
1091025924 11:132141251-132141273 AGGGGTAGGGGGGAGAGAGAGGG - Intronic
1091138022 11:133210373-133210395 AGGGGCTGGCGGGAGAAAGAGGG - Intronic
1091170945 11:133519108-133519130 AGGTTCTGCTGGGACAGAGACGG - Intronic
1091219595 11:133922218-133922240 AGGGTCTGGAAGGAAAGAGAAGG + Exonic
1091299676 11:134499486-134499508 AGGATCTGGAAAGAGAGAGCAGG + Intergenic
1091355199 11:134932399-134932421 AGGATCTGGGAGGAGGGATGGGG + Intergenic
1091678917 12:2512309-2512331 AGGACCTGGGGCGAGTGAGTGGG + Intronic
1092104378 12:5911008-5911030 AGCATCTGCGGGCAGGGAGAGGG + Intronic
1092182999 12:6458837-6458859 AGGTTCTGCGGTGAGAGAGGAGG - Exonic
1092461202 12:8687885-8687907 GGGATCTGTTGGGAGAGTGATGG + Intronic
1093729109 12:22547720-22547742 GGGGTTGGGGGGGAGAGAGATGG - Intergenic
1093871978 12:24303809-24303831 AGGATCAAAGGGGAGAGAGAGGG + Intergenic
1093925646 12:24905843-24905865 AGGGTCTGGGTGGAGAGGAATGG + Intronic
1095368884 12:41442495-41442517 AGGATCTGCTGTGAGAGTGAAGG - Intronic
1096035232 12:48461991-48462013 AAGAGATGGAGGGAGAGAGATGG + Intergenic
1096121725 12:49093017-49093039 GGGAGGTGGGGGGAGAGGGAGGG - Intronic
1096205765 12:49720252-49720274 AGGCTGTGGGGGGAGTAAGAAGG - Intronic
1096214348 12:49791366-49791388 AGGACCAGGGCAGAGAGAGAAGG + Exonic
1096353095 12:50916559-50916581 AGGAGATGGGAGGAAAGAGAAGG + Intergenic
1096983465 12:55742483-55742505 AGGATGGGGGAGGAGAGAGAGGG - Intergenic
1097034837 12:56116909-56116931 AAGAGCTGGTGGGAGAGAGAAGG + Intronic
1097037203 12:56131731-56131753 AGGGTCTGGAGGGAAAGAGCAGG - Exonic
1097153691 12:56997256-56997278 ATGATCTGGAGAGAAAGAGATGG - Intergenic
1098906921 12:76171691-76171713 ACGAACAGGAGGGAGAGAGAGGG + Intergenic
1098907856 12:76180181-76180203 AGGAGCTGGTGGGTGGGAGAGGG - Intergenic
1099205327 12:79720399-79720421 AGGATGTGGGAGTTGAGAGAGGG - Intergenic
1099287405 12:80731586-80731608 AGGATTTGGAGGGAGAGGGAAGG - Intergenic
1099682889 12:85850193-85850215 GGGGCCTGAGGGGAGAGAGAGGG - Intergenic
1099718779 12:86334282-86334304 AAGATATTGGGGGAGAGAGAGGG - Intronic
1100371714 12:93974821-93974843 AGGATCTTGCAGGAAAGAGATGG + Intergenic
1100811249 12:98340411-98340433 AGGCTCTGGGGGCAGAGAGCTGG - Intergenic
1101000733 12:100355199-100355221 AGTATGTGTGGGGAGAAAGAGGG + Intergenic
1101039026 12:100735627-100735649 CGGGTCTAGGGGGAGAGGGATGG + Intronic
1101088166 12:101257274-101257296 AGAGTCTGGTGGGAAAGAGAGGG + Intergenic
1101577531 12:106011727-106011749 AGGAGCAGGAGGAAGAGAGAGGG - Intergenic
1101618435 12:106360365-106360387 AAGATCTCAGGGGAGGGAGAGGG - Intronic
1101856858 12:108450974-108450996 GGGGTCTGGGGGCAGAGAAATGG + Intergenic
1101957303 12:109222781-109222803 AGGATCTGCAGGGGGAGGGATGG - Exonic
1101967084 12:109288913-109288935 ATGATCTGGTCAGAGAGAGAAGG - Intronic
1102027471 12:109721636-109721658 AGGACCAGGGGGGACAGCGAGGG + Intronic
1102541084 12:113619605-113619627 AAGATCTGTGGGGAGAGAGAAGG + Intergenic
1102874903 12:116441800-116441822 AGGGTTTTGGGGGAGTGAGAGGG + Intergenic
1102877976 12:116462443-116462465 GGGAAGTGGGGAGAGAGAGAGGG + Intergenic
1102913057 12:116733113-116733135 AGGATGTGGAGGGGGAGACAGGG + Intronic
1103340264 12:120217112-120217134 CGGATCTAGGGGGAGGGGGAGGG + Intronic
1103501568 12:121407073-121407095 ATAATCTGGGGGGAGGGGGAAGG - Intronic
1103908036 12:124337176-124337198 TGGACCTGGGGGAGGAGAGAAGG + Exonic
1104002103 12:124866306-124866328 AGGAGATGGAGGCAGAGAGATGG - Intronic
1104842615 12:131832082-131832104 AGGATCTGGGGGGGACGGGAAGG + Intronic
1104842646 12:131832155-131832177 AGGATCTGGGGGGGAAGGGAAGG + Intronic
1104842661 12:131832191-131832213 AGGATCTGGGGGGGACGGGAAGG + Intronic
1104842674 12:131832227-131832249 AGGATCTGGAGGGGAAGGGAAGG + Intronic
1104842689 12:131832263-131832285 AGGATCTGGGGGGGACGGGAAGG + Intronic
1105354443 13:19645777-19645799 ATGACTTGGGGGTAGAGAGAAGG - Intronic
1105519081 13:21115467-21115489 AGGGGCTGGGGGGAGGGACATGG + Intergenic
1105826433 13:24127381-24127403 GGGAACTGGAGGGAGAGAGAAGG - Intronic
1106512279 13:30421997-30422019 GGGATGTGGGAGGGGAGAGAAGG + Intergenic
1106571561 13:30932746-30932768 AGGTTGTGGTGGCAGAGAGAGGG - Exonic
1107651967 13:42553722-42553744 ATGGACTGGGGGGAGGGAGATGG + Intergenic
1107877706 13:44805261-44805283 AGGAGCTAGGAAGAGAGAGAAGG - Intergenic
1108263909 13:48685215-48685237 AGGAGCAGGAGGAAGAGAGAAGG + Intronic
1108353967 13:49613689-49613711 AGGATCGGGGGAGAGGGACATGG - Intergenic
1108795916 13:54030709-54030731 TGGGTATGGGGAGAGAGAGAAGG - Intergenic
1109843420 13:67951274-67951296 AGGATCAAGAGAGAGAGAGATGG + Intergenic
1110130807 13:72007253-72007275 AGGATATGGGGGGAATGAGAGGG + Intergenic
1110306060 13:73987857-73987879 AGGAACTGCAGGGAGAGGGAGGG + Intronic
1110351956 13:74519495-74519517 AGGTGTTGGGAGGAGAGAGAGGG - Intergenic
1110456375 13:75694602-75694624 TGGATTTGGAGGGACAGAGAAGG + Intronic
1110969187 13:81739698-81739720 AGTATCTTTGGAGAGAGAGAAGG - Intergenic
1111661166 13:91213695-91213717 AGGGGCTGGGAGGAGGGAGAAGG + Intergenic
1111936700 13:94565245-94565267 AGGAGGAAGGGGGAGAGAGAGGG + Intergenic
1112177315 13:97038814-97038836 AGAAAATGGGGGGAGATAGATGG + Intergenic
1114216449 14:20660962-20660984 AAGATATGTGGGGAGAGAGTAGG + Intergenic
1114418679 14:22561460-22561482 AGGATCTTAGAGGAGAGAGTAGG - Intergenic
1115431632 14:33325763-33325785 AGGAGCTGGGGGCAGAAATAGGG - Intronic
1117232806 14:53738830-53738852 AGGATCTGGTGTGAGGGAGAAGG - Intergenic
1118171691 14:63395430-63395452 AGGACAAGGGGGAAGAGAGAAGG + Intronic
1118394824 14:65327108-65327130 AGGAGAGAGGGGGAGAGAGAGGG + Intergenic
1119062008 14:71484554-71484576 AGGAACTAGGGCCAGAGAGAGGG + Intronic
1119159094 14:72438387-72438409 TGGATTTGTGGGGAGAGAGCTGG - Intronic
1119170528 14:72531953-72531975 AGGGGCTGTGGGGAGTGAGAAGG - Intronic
1119279665 14:73394684-73394706 AGGATCTAGGGAGGAAGAGAGGG - Intronic
1119669448 14:76507426-76507448 AGGATATGGGGCGGGAGTGATGG + Intergenic
1119711988 14:76829073-76829095 GGAAACTGGGAGGAGAGAGAGGG - Intronic
1119734812 14:76975081-76975103 AAAATCAGGGGAGAGAGAGAGGG + Intergenic
1119773462 14:77235537-77235559 AGGATCTGGGGAGACTGTGATGG + Intronic
1121103806 14:91267759-91267781 AGGACCACGGGGGAGAGTGAGGG + Intergenic
1121157634 14:91701486-91701508 AGGATTTGGGTGGATAGAGCGGG + Intronic
1121318250 14:92974888-92974910 AGGAGCGGGGGTGTGAGAGAAGG + Intronic
1121564878 14:94901753-94901775 AAGATGTGGGGAAAGAGAGAGGG + Intergenic
1121735301 14:96214019-96214041 AGGAGCTGGGGCTGGAGAGATGG + Intronic
1122027014 14:98885576-98885598 AGGCTCTGGGAGCACAGAGATGG - Intergenic
1122146717 14:99693982-99694004 AGGGTCTGGGGGGAGGGGAATGG - Intronic
1122163806 14:99805966-99805988 AGGAGCTGGCGGGGGAGAGTGGG - Intronic
1122199661 14:100114739-100114761 AGGAGCAGGGAGGAGAGAGAGGG - Intronic
1122393480 14:101406803-101406825 AGGAGCTGGGGGAGGGGAGAAGG - Intergenic
1123688859 15:22820661-22820683 AGGATCAGGCGGGAGGGTGAGGG - Intronic
1123816211 15:23981803-23981825 GGGATTGGGGGAGAGAGAGAGGG + Intergenic
1124162605 15:27286882-27286904 AGGATCTGGAGGGAGAGAGTAGG - Intronic
1124176470 15:27429578-27429600 AGGATCTGGGGAAAGAGAATGGG - Intronic
1124362042 15:29044683-29044705 AGGCTCTGGGAGGGGAGAAAAGG + Intronic
1124589428 15:31040342-31040364 AGTCTCTGGGGGGAAAGAGAAGG + Exonic
1124590867 15:31051752-31051774 AGGAGCTCTGGGGAGAGAGGTGG - Intronic
1124866676 15:33499177-33499199 AGGAAGGGGAGGGAGAGAGAGGG - Intronic
1124873892 15:33572556-33572578 AGGCGGTGGGGGGAGGGAGATGG + Intronic
1125329062 15:38564712-38564734 AGGCCCGGGGGGGAGAGAGCCGG - Exonic
1125520041 15:40343459-40343481 TGGGTCTGGGAGGAGAAAGAAGG - Intergenic
1126179700 15:45773104-45773126 AGGAGATGGGAGGAGAGGGAGGG + Intergenic
1126657040 15:50989734-50989756 AGGATCTGGGGGGTGTGACAGGG + Intronic
1126685685 15:51246888-51246910 AGGAGCTGGGGTGTGAAAGAGGG - Intronic
1127226910 15:56940724-56940746 AGGAGAAGGGGGGGGAGAGAAGG - Intronic
1127588051 15:60397170-60397192 AGGAACTGAGAGTAGAGAGAAGG - Intronic
1127735014 15:61831769-61831791 AGCATCTGCTGGGAGAGAGATGG - Intergenic
1128826034 15:70718245-70718267 AGGAACGGGGGGGAGGGAGGGGG + Intronic
1129081295 15:73043395-73043417 AGGTGGTGGGGAGAGAGAGAAGG - Intergenic
1129238228 15:74236513-74236535 TGGATGTGGGGGGAGGGGGAGGG - Exonic
1129281680 15:74490035-74490057 GGGGTGTGGGGGGTGAGAGATGG - Intergenic
1129357659 15:75002425-75002447 AGGATATGGGGGTAGGGAGAGGG - Intronic
1129388003 15:75206566-75206588 AGGAGCTGGGGCCAGAGAGCAGG - Exonic
1129553086 15:76474336-76474358 ATGCTCTAGTGGGAGAGAGATGG + Intronic
1130050382 15:80479252-80479274 AGCATCTGGGGTGAGGGTGATGG + Intronic
1130151517 15:81315164-81315186 AGGAGCAGGGAGGAGAGAGAAGG - Intronic
1130338635 15:82979685-82979707 AGTATCTGGAGTAAGAGAGATGG + Intronic
1130673088 15:85930418-85930440 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673130 15:85930586-85930608 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673137 15:85930610-85930632 AGGAGAGGGGGGAAGAGAGAAGG - Intergenic
1130673144 15:85930634-85930656 AGGAGATGGGGGTAGACAGAAGG - Intergenic
1130673150 15:85930658-85930680 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673191 15:85930785-85930807 AGGAGAAGGGGGTAGAGAGAAGG - Intergenic
1130673197 15:85930809-85930831 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673211 15:85930857-85930879 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673218 15:85930881-85930903 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673226 15:85930905-85930927 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673234 15:85930929-85930951 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130673242 15:85930953-85930975 AGGAGAGGGGGGTAGAGAGAAGG - Intergenic
1130685945 15:86037767-86037789 AGGATCTTGGTGGAGAAACAGGG - Intergenic
1130826827 15:87557327-87557349 AGGATCTGGGCAGAGAAGGATGG + Intergenic
1130908727 15:88256906-88256928 AGGACAGGCGGGGAGAGAGACGG - Intergenic
1131125032 15:89852744-89852766 AGGAACTGTGGGGATGGAGATGG - Intronic
1131130886 15:89899570-89899592 AGGACCTGGGGGGAGACGAAGGG - Exonic
1131284429 15:91045283-91045305 AGAATCTTGGGAGAGAGAGATGG + Intergenic
1131469361 15:92683088-92683110 GGGAGTTTGGGGGAGAGAGAGGG - Intronic
1131469466 15:92683707-92683729 AGGACATGGGAGGAGAGCGAGGG - Intronic
1132317112 15:100898229-100898251 AGGAAGTAGGGGGAGACAGATGG - Intronic
1132321427 15:100928421-100928443 TGGATTTGGGGGGTGGGAGAGGG - Intronic
1132560437 16:590890-590912 AGGATCTGGGGTCTGGGAGAAGG + Intronic
1132664631 16:1075963-1075985 AGGAGGGGGAGGGAGAGAGAGGG - Intergenic
1132664757 16:1076290-1076312 AGGGTGTGGGGAGAGAGGGAGGG - Intergenic
1132747890 16:1444538-1444560 AGGTTCTGGGGAGAGAAGGAAGG - Intronic
1132855517 16:2042958-2042980 AGGTGCTGGGGGGAGAAAGGGGG - Intronic
1133221838 16:4322197-4322219 AGGCTCTGGGCTGAGAGAGCAGG + Intronic
1133458237 16:5961998-5962020 CGGATTTGGAAGGAGAGAGATGG - Intergenic
1133492052 16:6279841-6279863 GGGATCTGGGGAGAGAGGAAGGG + Intronic
1133622842 16:7542826-7542848 AGGAACAGAGGGGAGAGAGAAGG + Intronic
1133831838 16:9330472-9330494 AGGTTTTGTGGGGAGAGTGAGGG + Intergenic
1134408601 16:13984135-13984157 ATGATTTGGGGGGTGAGGGATGG - Intergenic
1134837207 16:17371033-17371055 AGGACCTGAGGTTAGAGAGAAGG + Intronic
1134865333 16:17601910-17601932 AGGGTTTGGGGGGAGGGGGAGGG - Intergenic
1135572975 16:23563427-23563449 ACCATCTGGGGGAAGGGAGAGGG - Intronic
1135612062 16:23876981-23877003 AGGATATGGGGGGGGAGGGATGG + Intronic
1135630968 16:24035399-24035421 AGGCTGTGAGGGCAGAGAGAGGG - Exonic
1136016900 16:27406177-27406199 GGGAACTGAGGGGAGAGAGACGG + Intronic
1136034663 16:27530116-27530138 ACATTCTGGGGGGAGAGACAGGG + Intronic
1136054579 16:27678896-27678918 AGGGGCAGGGAGGAGAGAGAAGG + Intronic
1137484596 16:48880987-48881009 AGGAACAGGGCAGAGAGAGAGGG - Intergenic
1137511220 16:49102442-49102464 GGGATCTGGAGGGAGAAAAATGG - Intergenic
1137567267 16:49541100-49541122 AGGTTCTGGGTGCAGAGAGCGGG - Intronic
1137572933 16:49578582-49578604 AGGAAGAGGTGGGAGAGAGAAGG - Intronic
1137667313 16:50259314-50259336 AGGATCTGGTGGGAGGGACATGG + Intronic
1137845969 16:51688512-51688534 AGAAACAGAGGGGAGAGAGATGG + Intergenic
1137898320 16:52237869-52237891 AGGATCTGCTGGGAGAGAGAAGG - Intergenic
1138050499 16:53771939-53771961 AGGAGCTGGGGAGAGAGGAATGG + Intronic
1138125869 16:54437868-54437890 AGAATCTGGAGGCACAGAGACGG + Intergenic
1138181910 16:54946346-54946368 AGGACATGTGGGGAGTGAGAAGG + Intergenic
1138196009 16:55052817-55052839 AGGGCCTGGGAGGAGAGTGAGGG - Intergenic
1139953943 16:70684681-70684703 AGGATTTGGGGGCTGGGAGAAGG - Intronic
1140989874 16:80200294-80200316 AAGATCGGGGAGGAGAGATAAGG - Intergenic
1141424505 16:83936240-83936262 AGGAGCTGGGGAGACAGAGCTGG - Intronic
1141568404 16:84918981-84919003 AGGCTTTGGGGAGAGGGAGAAGG + Intronic
1141836265 16:86541818-86541840 ACGACCTGGGGGAAGAGAGGAGG + Exonic
1142124338 16:88402699-88402721 AGGATCTGGGGGCACAGAATGGG + Intergenic
1142195917 16:88739242-88739264 AGCCTCTGGGGGGACAGAGGTGG + Intronic
1142409128 16:89907512-89907534 AGGAACTGGGAGGAGGGAGGTGG - Intronic
1142482803 17:229184-229206 AGCATCTGGGTGGGGAGAGGAGG - Intronic
1142570289 17:869146-869168 AGGATGTGAGATGAGAGAGAAGG - Intronic
1142672475 17:1493469-1493491 GGAAGCTGTGGGGAGAGAGAAGG - Intergenic
1142959399 17:3543129-3543151 AGGACCTGGGGAGTGAGGGACGG - Intronic
1143180346 17:4980506-4980528 AGGCTCTGGGGGGTGAGCGTGGG + Exonic
1143203237 17:5126593-5126615 AGGATAAGGAGGGCGAGAGATGG - Intronic
1143622074 17:8086451-8086473 AGGAGCTGGGGATGGAGAGAAGG - Intronic
1144161615 17:12566028-12566050 AGGTTTTGGGGAGAGAGAGATGG + Intergenic
1144624331 17:16837085-16837107 AGAAGCTGAGGGGAGAGAGGGGG + Intergenic
1144726761 17:17506160-17506182 AGGTTCTAGAGGGAGAGACAGGG + Intronic
1144882096 17:18435635-18435657 AGAAGCTGAGGGGAGAGAGGGGG - Intergenic
1145150137 17:20508751-20508773 AGAAGCTGAGGGGAGAGAGGGGG + Intergenic
1145836340 17:27956868-27956890 AGGCTCAGGGAGGGGAGAGAGGG - Intergenic
1145883286 17:28366920-28366942 AGGGTCTTGGAGGAGAGAGAAGG - Intronic
1146055935 17:29581218-29581240 AGTCTCTGGGGGGAGGGAGCAGG + Intronic
1146162069 17:30565396-30565418 AGAAGCTGAGGGGAGAGAGGGGG + Intergenic
1146238018 17:31186223-31186245 AGTATAGGTGGGGAGAGAGAAGG - Intronic
1146658866 17:34651470-34651492 CGGATCTTGGGGGAGGGAAAGGG + Intergenic
1147154258 17:38535634-38535656 AGGTACTGGGGGCACAGAGAGGG - Intronic
1147545340 17:41396991-41397013 AGGATCTGGGGAGTGAGAGGTGG + Exonic
1147578468 17:41615806-41615828 AGAAGCTGAGGGGAGAGAGGGGG + Intronic
1147792075 17:43020212-43020234 AGGAGGAGGAGGGAGAGAGAGGG + Intronic
1147845597 17:43402119-43402141 AGGACCTGGGGAGAAAGAGAAGG + Intergenic
1148138201 17:45309361-45309383 AGGAGCTGGAGGGAGCGAGGAGG - Intronic
1148374601 17:47131523-47131545 AGAAGCTGAGGGGAGGGAGAAGG + Intronic
1148554026 17:48567107-48567129 AGGGTTTGGGGAGAAAGAGAAGG - Intronic
1148816290 17:50330342-50330364 AGGACCTGAGGGAAGAGTGATGG - Intergenic
1148984029 17:51605839-51605861 ATGATGTTGGGGGTGAGAGATGG + Intergenic
1149448571 17:56732547-56732569 AGGAGCTGAGGTCAGAGAGATGG - Intergenic
1149448857 17:56733878-56733900 AGGAGCTGAGGTCAGAGAGATGG - Intergenic
1149996808 17:61409961-61409983 AGGTTCAGGAGGCAGAGAGAGGG - Intergenic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1150729511 17:67679815-67679837 AGGAGATGGGGTGAGAGGGAAGG + Intronic
1151598436 17:75091712-75091734 AGGACCTGGGGTGAAAGGGAGGG + Intronic
1151717938 17:75840896-75840918 GGGATCTGGGGTGAGAGAGGCGG - Intronic
1151850314 17:76686026-76686048 AGGATATGGAGGGACAGAGAGGG - Intronic
1151893286 17:76963770-76963792 AGAAGCCGGTGGGAGAGAGATGG - Intergenic
1151899601 17:77003096-77003118 AGGAGCGGGGAGGGGAGAGAGGG - Intergenic
1151977870 17:77492596-77492618 GGGATAAGGAGGGAGAGAGATGG - Intronic
1152073033 17:78143526-78143548 AGGAGCTGAGGGCAGAGAGGGGG + Intergenic
1152479163 17:80538448-80538470 AGGATCTGGGGGAGGAAGGAAGG + Intergenic
1152508970 17:80772427-80772449 GGCATGTGGGGGGAGAGACAGGG - Intronic
1153247604 18:3088300-3088322 AGCAGCTGGGATGAGAGAGAAGG + Intronic
1153250777 18:3119349-3119371 AAGAGCTGGGAGGAGGGAGAAGG + Intronic
1153254270 18:3155084-3155106 AGCATCTGTGGAGACAGAGAAGG + Exonic
1153534502 18:6086562-6086584 AGGATCTGGGATGAGATGGAAGG - Intronic
1153940736 18:9974283-9974305 AGCATCTGGGAGGAGAAGGACGG + Intergenic
1154115115 18:11607517-11607539 AGGCTCTGGGGGTAGAAAGCGGG + Intergenic
1154393248 18:13962404-13962426 AGGATGTGGGGGGCTAGAGGAGG - Intergenic
1154528287 18:15314933-15314955 AGGATCTGGGGTGGGAGATGGGG + Intergenic
1155270488 18:24137075-24137097 AGGATTTGGGGTGTGGGAGAGGG + Intergenic
1155554894 18:27007823-27007845 AGGGTCTGGGGGGACAGGAAAGG + Intronic
1156016992 18:32557939-32557961 AGGAGGTGGGGAGGGAGAGAGGG - Intergenic
1156548366 18:37988371-37988393 AGAATGGGGGAGGAGAGAGAGGG + Intergenic
1156713209 18:39974085-39974107 TGCTTCTGGTGGGAGAGAGAAGG - Intergenic
1157248385 18:46072587-46072609 AGGCTCTGCGGGGTGATAGACGG + Intergenic
1157682892 18:49620754-49620776 AGGAAGTGGGAGGAGGGAGAGGG - Intergenic
1158216384 18:55104524-55104546 AGGAGCAGGAGGAAGAGAGAAGG + Intergenic
1159477894 18:68947460-68947482 AGGAAGTAGAGGGAGAGAGATGG + Intronic
1159708364 18:71721126-71721148 AAGACCTACGGGGAGAGAGAAGG + Intergenic
1159819146 18:73117773-73117795 GAGATTTGGGAGGAGAGAGAGGG + Intergenic
1159858722 18:73620044-73620066 AGGAGCTGGGGAGAATGAGAAGG - Intergenic
1160680528 19:409955-409977 AGGGTCGGGGCGAAGAGAGAAGG + Intergenic
1160696296 19:486202-486224 AGGATTTGGGGGGCTGGAGAGGG + Intergenic
1161118398 19:2512051-2512073 AGCGTCGGGTGGGAGAGAGAAGG - Exonic
1161319458 19:3634228-3634250 GGGATCTGGGGAGGGAGGGAGGG + Intronic
1161319869 19:3636206-3636228 AGGAGTTGGGGGGACAGAGAGGG + Intronic
1161403937 19:4081594-4081616 AGCATCTAGGAGGAGGGAGAAGG - Intergenic
1161427279 19:4210466-4210488 AGGGTGGGGAGGGAGAGAGATGG - Intronic
1161446429 19:4321726-4321748 AGTATCTGGGGGGAAATAGCTGG + Intronic
1161471386 19:4458431-4458453 AAGCTCTGGGGAGACAGAGAAGG - Intergenic
1161497190 19:4593041-4593063 AAGATCTGGAGTGGGAGAGAAGG + Intergenic
1161635322 19:5385078-5385100 AGTATCTTGGTGGAGAGCGATGG - Intergenic
1161869212 19:6857385-6857407 AGGACCTGCTAGGAGAGAGATGG + Intergenic
1162072578 19:8163136-8163158 AGGGGCTGGGGGAAGAGGGATGG + Intronic
1162318529 19:9956629-9956651 AGGGTCTGGGGGGAGGGGGGAGG - Intergenic
1162336648 19:10065424-10065446 ACCATCTGCGTGGAGAGAGATGG + Intergenic
1162896117 19:13765467-13765489 AGGAAGTGGGGGGAAAAAGATGG - Intronic
1162904553 19:13816028-13816050 GAGAGATGGGGGGAGAGAGAGGG + Intronic
1163316226 19:16542307-16542329 AGGTTCCGGGGAGAGAGAAACGG + Intronic
1163501571 19:17679547-17679569 AGGCTCTGGGGGGTGATACAAGG + Intronic
1163518795 19:17779946-17779968 AGGAGATGGGGGGAGAGCGGCGG + Intronic
1163837191 19:19582120-19582142 AGGATTTGGGGGGTGGGAGGAGG - Intronic
1164441088 19:28281561-28281583 AGGCTTTGGGGAGAGAGAGTAGG - Intergenic
1164526390 19:29016509-29016531 AAGAGCAGGGGAGAGAGAGAGGG - Intergenic
1164528562 19:29029715-29029737 AGGCTCTGGGGGTAGACAGCAGG - Intergenic
1164870593 19:31640196-31640218 AGGCTCTGGAGGGAGGAAGAGGG + Intergenic
1164870647 19:31640385-31640407 GGGATCTGGAGGGAGGGAAAAGG + Intergenic
1164908190 19:31984755-31984777 AGGCTCTGTAGGTAGAGAGATGG - Intergenic
1165756481 19:38296166-38296188 AGGAGGTGGGGGGAGAGGGGTGG + Intronic
1165858602 19:38894878-38894900 CGGATCTGAGGGCAGAGAGATGG - Intronic
1165942752 19:39423435-39423457 CGGATCTGGGTGGAGACAGCGGG + Exonic
1166276192 19:41755777-41755799 AGGCTCTGAGAGGAGACAGAGGG + Intronic
1166880867 19:45929278-45929300 AGAAACTAGGGGCAGAGAGAGGG + Intergenic
1166882846 19:45939818-45939840 AGGAGATGGGAGGAGAGAAAAGG + Exonic
1167102927 19:47415116-47415138 GGGAGGTGGGGGGAGACAGAGGG + Intronic
1167110605 19:47458412-47458434 GAGAACTCGGGGGAGAGAGATGG - Intronic
1167110636 19:47458592-47458614 GAGAAATGGGGGGAGAGAGATGG - Intronic
1167110718 19:47459101-47459123 AGGAAGGGGAGGGAGAGAGATGG - Intronic
1167284176 19:48589413-48589435 GGGATCTGAGGGGAGAGACTTGG + Intronic
1167577990 19:50326837-50326859 AGAATTTGGAGAGAGAGAGAAGG + Intronic
1167791764 19:51687943-51687965 AGGACCTGGGGAGAGAGGAAGGG - Intergenic
1168306458 19:55438622-55438644 ATTATCTGGGGGGACCGAGAAGG + Intronic
1168405465 19:56108204-56108226 AGGGGCTGGGTGGAGAGAGCGGG - Intronic
925853676 2:8108748-8108770 AGGGTCTGGGAGTGGAGAGATGG - Intergenic
925921313 2:8639735-8639757 AGGATATGGGGGGTGTGGGAAGG - Intergenic
925979709 2:9166897-9166919 AAGCTCTGGGAGGAGACAGAAGG - Intergenic
926236043 2:11044808-11044830 AGGATCTGGAGTCAGAGAGAAGG - Intergenic
926754920 2:16226873-16226895 AGGCTTTGGGGGCAGGGAGAGGG + Intergenic
926801635 2:16665224-16665246 GGGTTCTGGGGGAGGAGAGAGGG + Intronic
927029712 2:19108054-19108076 AGGAAGTGGGGAGAGAGAGATGG + Intergenic
927212050 2:20645075-20645097 GGGCTCTGGGGGTATAGAGAAGG - Intronic
927718869 2:25370274-25370296 AAGATTTTGGGGGAGAGAGCAGG - Intergenic
927874910 2:26648785-26648807 AGGGGCTGGGGAGAGAGAGGTGG - Intergenic
927980029 2:27369344-27369366 GGGATGTGGTGGGAGAGATAAGG - Intronic
928088371 2:28359516-28359538 AGGGTCAGGGGGAAGACAGAGGG + Intergenic
928820924 2:35359882-35359904 AGGTTGTGGGGGAAGAGAGGGGG + Intergenic
928941693 2:36733348-36733370 ATGGTCTGGAGAGAGAGAGAGGG - Intronic
929005701 2:37390771-37390793 AGGAACCGGGAGAAGAGAGAAGG - Intergenic
929272562 2:39988629-39988651 AGGATCAGAGTGGTGAGAGAGGG - Intergenic
929503399 2:42509361-42509383 AGCATCTTGTGGGAGACAGACGG - Intronic
929561919 2:42961453-42961475 AAGATGTGGGGAGAGAGGGAGGG - Intergenic
929590465 2:43142593-43142615 TTGAACTGGGAGGAGAGAGATGG - Intergenic
929673717 2:43903230-43903252 AGGACCTGGGGGGAGGGATGTGG - Intronic
929783239 2:44971352-44971374 AGGATCGGGTGGCAGTGAGAGGG - Intergenic
930001866 2:46866994-46867016 GGGATCTGAGGAGAGAGAGGTGG + Intergenic
930212283 2:48653417-48653439 AGGAACTGGGGGTTGAAAGAGGG - Intronic
930576085 2:53150514-53150536 AGGGTGTGGGTGGGGAGAGAGGG + Intergenic
930695125 2:54403411-54403433 GGGGTTTGTGGGGAGAGAGAGGG - Intergenic
931905913 2:66843943-66843965 AGGGAATGGTGGGAGAGAGAAGG - Intergenic
932150875 2:69370618-69370640 AAGAACTGGAGGGAGAGAAACGG + Intronic
932423735 2:71616025-71616047 AGGCTTTGGGAGCAGAGAGAAGG - Intronic
932493797 2:72136839-72136861 AGGGTCTTGGGGGAATGAGAGGG + Intronic
933165446 2:79070072-79070094 AGGCTCAGGTGGCAGAGAGAGGG + Intergenic
933386180 2:81613468-81613490 TTGATCTGGGAGCAGAGAGAAGG + Intergenic
933435790 2:82247973-82247995 GGGATGTGGGGAGAGAGAGGAGG + Intergenic
934525543 2:95049475-95049497 AGGAAGTGGGGGGAGAGGCAAGG + Intronic
934613344 2:95756426-95756448 GGGAAATGGGGGGAGAGGGAGGG - Intergenic
935662483 2:105479123-105479145 AGGTGCTGGGGAGACAGAGATGG + Intergenic
935684297 2:105669978-105670000 AGCAGGTGGGAGGAGAGAGAAGG - Intergenic
936043237 2:109165731-109165753 AGGATCTGAGTGGGGAGAGTGGG - Intronic
937064814 2:119009951-119009973 AAGATTGGGGGAGAGAGAGATGG + Intergenic
937089609 2:119197091-119197113 AGGATTTGCGGGGACAGGGAAGG - Intergenic
938244272 2:129765185-129765207 ACCATCTGGGTGGAAAGAGATGG - Intergenic
938262009 2:129903169-129903191 AGGCTCTGGGGAGAGAATGAGGG - Intergenic
938262773 2:129907126-129907148 ACGAGCAGGGTGGAGAGAGACGG + Intergenic
939008849 2:136821469-136821491 TGGAGCAGGGAGGAGAGAGAGGG - Intronic
939675221 2:145063744-145063766 TGGATTTGGGGTGTGAGAGAAGG + Intergenic
939678792 2:145105392-145105414 AAGAGTTGGGGTGAGAGAGAAGG + Intergenic
940887438 2:159001861-159001883 AGGCTGTGGGGGAAGGGAGAGGG + Intronic
941885286 2:170521582-170521604 AGGATCTGGGGTCTGTGAGATGG - Intronic
942247081 2:174017842-174017864 AGGGTCTGGGGGTGCAGAGAGGG + Intergenic
942763702 2:179429306-179429328 AGGACCTGGAGGGGGAGAGCAGG - Intergenic
943799917 2:192045049-192045071 AGAAGCAGGCGGGAGAGAGAAGG - Intronic
944142768 2:196475323-196475345 AGGAGATGGGGGGAGAGGGAGGG + Intronic
944703534 2:202266099-202266121 GGGCTCTGGGAGGAGGGAGAAGG + Intronic
944737132 2:202577296-202577318 AGGAAGGGGGGAGAGAGAGAAGG + Intergenic
945431642 2:209771936-209771958 GGGATCAGGGCGGAGAGAGCCGG + Intergenic
945678967 2:212889909-212889931 AGGATGTGGGGGTAGGGAGTTGG - Intergenic
946030401 2:216699231-216699253 AGCATCTGGTGGGACACAGAGGG - Intergenic
946031876 2:216711838-216711860 AGGATGTAGGGGTAGAAAGATGG - Intergenic
946360035 2:219213796-219213818 AGGATCTTGGATGAGAGAGTGGG - Intronic
946410743 2:219514043-219514065 AGGAGGTGGGGGGATAGAGTTGG + Intergenic
947828899 2:233125215-233125237 AGAGTCTGGGGGAGGAGAGAAGG + Intronic
948061665 2:235046978-235047000 AGGCTCTGGTGGGAGAGAAGTGG - Intronic
948206084 2:236163575-236163597 AGGATCTGCGGGGAGTGCCAGGG + Intergenic
948223182 2:236289462-236289484 ATAACCTGGGGGTAGAGAGAAGG + Intergenic
948319440 2:237057893-237057915 AGGAGCAGGAGGAAGAGAGAGGG - Intergenic
948385189 2:237576486-237576508 AGAATCTCGGGGGAGAGCAAGGG - Intronic
948406883 2:237728473-237728495 CTGCTCTAGGGGGAGAGAGAGGG + Intronic
948930535 2:241129041-241129063 AGGTACAGGGGAGAGAGAGATGG - Intronic
1168743981 20:220330-220352 AGGATGTAGAGGGAGAGAAAAGG + Intergenic
1169831222 20:9827610-9827632 AGGATTTTGGGGGAGGGGGAGGG + Intronic
1170459625 20:16564988-16565010 AGGATCAAGTTGGAGAGAGAAGG - Intronic
1170777967 20:19395175-19395197 AGGTACTGGGGGGAGAAATAAGG + Intronic
1170799689 20:19580891-19580913 AGGTACTCAGGGGAGAGAGAAGG - Intronic
1171091713 20:22291436-22291458 AGGGACTGGGGGGAAAGAGGAGG + Intergenic
1171203074 20:23257271-23257293 AGGGTCTGGGGGAAGTGGGAGGG - Intergenic
1172164426 20:32890282-32890304 AGGCTGTTGGGGCAGAGAGAGGG - Intronic
1172206149 20:33164261-33164283 AGGATCTGGAAGATGAGAGAGGG + Intronic
1172388239 20:34548604-34548626 AGGATCTGTGGGGAGCAAGGTGG + Intronic
1172390301 20:34560975-34560997 AGGATCTGGGGGGAGAGAGAGGG + Exonic
1172950503 20:38720352-38720374 AGGGTATGTGGGGAGAGAGCAGG - Intergenic
1172951431 20:38725390-38725412 AGGAAATGGGGGGAGGGAGCAGG + Intronic
1173071682 20:39774314-39774336 AGGGTCTGGGGCAAGAGAGGAGG - Intergenic
1173189132 20:40862863-40862885 AGCATCTGATGGGAGAGGGAAGG + Intergenic
1174507733 20:51027494-51027516 AGTGTCTGTGGAGAGAGAGAAGG - Intergenic
1174535081 20:51245172-51245194 AGGAACTGGAGGGAAAGAAAAGG + Intergenic
1174919073 20:54682792-54682814 AGCATCTGGCTGGAGAGAGGTGG + Intergenic
1175043193 20:56075718-56075740 AGGAGCAGGAGGAAGAGAGATGG - Intergenic
1175191400 20:57214443-57214465 AGAAACTGGGGAGAGAGAGGAGG + Intronic
1175475637 20:59272000-59272022 AGGGAGTGGGGGGAGAGAAAAGG + Intergenic
1175648386 20:60695420-60695442 AGGGTCTGGTGGGAGAGTGGAGG - Intergenic
1175764493 20:61583122-61583144 AGGCTCTGCGGGGGGACAGAGGG + Intronic
1175997938 20:62819734-62819756 AGGCTCTGGGAGGAGGGAGGGGG - Intronic
1176108842 20:63401982-63402004 CAGATGTGGTGGGAGAGAGATGG - Intergenic
1177736207 21:25092926-25092948 AGGAGCCGGGGGAAGAGGGAGGG - Intergenic
1178003750 21:28193266-28193288 GAGGTCTGGGGTGAGAGAGAAGG - Intergenic
1178365420 21:31985788-31985810 TGGATTTGGGGGGTGGGAGAGGG + Intronic
1178541973 21:33459689-33459711 AGGATTAGGTTGGAGAGAGAAGG + Intronic
1179036659 21:37763799-37763821 AGAATGTGGGGGGAGGGGGAAGG + Intronic
1179103636 21:38378628-38378650 AGGTTCAGTGGGGAGAGACAAGG - Intergenic
1179788556 21:43743049-43743071 AGGAGCTGGGGGGAGGGAGGTGG - Intronic
1179788587 21:43743149-43743171 AGGAGCTGGGGGGAGGGAGGTGG - Intronic
1179788621 21:43743249-43743271 GGGAGCTGGGGGGAGGGAGGTGG - Intronic
1179788708 21:43743503-43743525 AGGGGCTGGGGGGAGGGAGGTGG - Intronic
1180059035 21:45375307-45375329 AGGATGTGGGGAGGGAGGGAGGG + Intergenic
1180722221 22:17917836-17917858 AGGATGTGGGTCGAGAGTGACGG - Intronic
1181631084 22:24151747-24151769 AGGACCTTTGTGGAGAGAGAGGG - Intronic
1181636556 22:24177414-24177436 AGGACCTGGGGGGAGCGGGTGGG + Intronic
1181672937 22:24434198-24434220 AGGATCTGGGGGAAGGCAGGTGG - Intronic
1181695501 22:24590911-24590933 AGGAGTGGTGGGGAGAGAGAAGG - Intronic
1181776789 22:25165874-25165896 AGGGACTGGGGGGTGAGAGGAGG + Intronic
1182287277 22:29255810-29255832 AGGATCTGGGGAGAGTGAACAGG + Intronic
1182353174 22:29710295-29710317 AGGATGAGGGAGCAGAGAGAGGG - Intergenic
1182985476 22:34712291-34712313 ATGCTCTGGGGGTAGAAAGAAGG - Intergenic
1183111674 22:35654082-35654104 AAGATATGGGGGAAGAGACATGG + Intronic
1183122257 22:35739114-35739136 AGGACGGGAGGGGAGAGAGAAGG + Intronic
1183376508 22:37468359-37468381 AGGCCCTGGGGGCAGAGAAAAGG + Intergenic
1183600983 22:38840541-38840563 CAGAACTGGGGGGAGAGGGAGGG + Intronic
1183727083 22:39596148-39596170 GGGAGCAGGGTGGAGAGAGATGG + Intronic
1183727156 22:39596339-39596361 GGGAGCAGGGCGGAGAGAGATGG + Intronic
1183727163 22:39596362-39596384 GGGAGCAGGGCGGAGAGAGATGG + Intronic
1183727170 22:39596385-39596407 GGGAGCAGGGCGGAGAGAGATGG + Intronic
1183828079 22:40404119-40404141 TGGATATGGTGGGAGAGAGCTGG + Intronic
1183830491 22:40416207-40416229 ATGAAGTGGGGGGAGAGGGAAGG - Intronic
1183935819 22:41261576-41261598 AGGATCTGTGGGGAAAGGCAAGG + Exonic
1184177363 22:42795876-42795898 AGGGGCTGGGGGGAGACTGAGGG + Intergenic
1184950295 22:47837199-47837221 AGGAGATGAGGGCAGAGAGATGG - Intergenic
1185245165 22:49769534-49769556 AGGCTCTGTGGGGATGGAGATGG + Intergenic
1203294542 22_KI270736v1_random:29238-29260 AAGGACTGGGGGGAGACAGAGGG - Intergenic
949150012 3:755443-755465 GGGATGAAGGGGGAGAGAGAAGG - Intergenic
949265996 3:2156661-2156683 AGGAAATGGAGGCAGAGAGAAGG + Intronic
949737846 3:7194942-7194964 AGGACCTGAGGGAAGAGGGAAGG + Intronic
950139849 3:10607939-10607961 AGGAGCAGGTGGAAGAGAGAGGG - Intronic
950164022 3:10780134-10780156 AGGATGGGGAGAGAGAGAGAGGG - Intergenic
950165874 3:10798426-10798448 AGGATCTGGAGGAAGATAAAAGG + Intergenic
950212061 3:11131010-11131032 GGGATGGTGGGGGAGAGAGAGGG - Intergenic
950259296 3:11532383-11532405 AGGAGGTGGAGGCAGAGAGAGGG + Intronic
950550214 3:13661751-13661773 AGGAAGTGGGGTGGGAGAGATGG + Intergenic
950676405 3:14556768-14556790 AGGATGTGGGATGAGAGAGGAGG - Intergenic
950694238 3:14685343-14685365 GTGATCTCTGGGGAGAGAGAAGG + Intronic
950702858 3:14762006-14762028 AGGGTGTGGTGGGACAGAGAGGG - Intronic
951580157 3:24154265-24154287 AGGATCTGGGCAGAGAAAAAAGG + Intronic
951710387 3:25580747-25580769 TGGGTCTGGGGAGGGAGAGAGGG + Intronic
952668312 3:35935115-35935137 AGGAGATGGGGTGAGAAAGAAGG - Intergenic
952713927 3:36459085-36459107 AGGTACTGGGGAGAGAGAAAAGG + Intronic
952820767 3:37483751-37483773 AGGAGCTGGGGGGAGACAGGTGG + Intronic
953020230 3:39108320-39108342 AGGCTCTCAGGGGGGAGAGATGG - Exonic
953180819 3:40593474-40593496 AGGTTCTGGGGGTGGAGAGGAGG - Intergenic
953304788 3:41818301-41818323 AGGAACTCAAGGGAGAGAGAAGG - Intronic
953965302 3:47300169-47300191 AGGAGGTGGGGAGAGAGAGAAGG - Intronic
954030679 3:47818004-47818026 CCGATCTGGGGAAAGAGAGAGGG - Exonic
954135352 3:48579784-48579806 AGGACCTGGAGCCAGAGAGAAGG - Exonic
954137440 3:48588505-48588527 AGGGTCTGAGAGGAGGGAGAGGG - Intronic
954636358 3:52072991-52073013 AGAATCTGGTGGGAGGGAAACGG - Intergenic
955032428 3:55233866-55233888 GGGATGAGGGTGGAGAGAGAGGG + Intergenic
955054450 3:55443493-55443515 AGGCTCTGGTGGGAAAGGGAAGG - Intergenic
955376591 3:58402260-58402282 AGAAGAAGGGGGGAGAGAGAGGG - Intronic
955638633 3:61057674-61057696 AGTATGTGGCGGGGGAGAGAGGG + Intronic
956329400 3:68088934-68088956 AGGATGTAGGGGGAGAGGGAAGG + Intronic
956480549 3:69669783-69669805 AGGAGATGGGGTTAGAGAGAGGG - Intergenic
956560196 3:70566459-70566481 AGAATCTTGGGGCAGAGAGCAGG + Intergenic
956723627 3:72139146-72139168 AGAAGCTGGGTAGAGAGAGAAGG - Intergenic
956994813 3:74813505-74813527 AGGAGCTGGTGGGAGTGAAAAGG + Intergenic
957348931 3:78997875-78997897 AGCATTTGTGGGGAAAGAGAAGG + Intronic
957385506 3:79490948-79490970 GGGATCCAGGGAGAGAGAGAAGG - Intronic
957895635 3:86418309-86418331 AGGAGGTGGGGGGAAGGAGATGG - Intergenic
958111477 3:89152378-89152400 AGGTTGTGGGTGGAAAGAGAAGG - Intronic
958461744 3:94406380-94406402 AGAAAGTCGGGGGAGAGAGAGGG - Intergenic
958479328 3:94626705-94626727 AGAGCCTGGGTGGAGAGAGAAGG - Intergenic
959167085 3:102793924-102793946 AGTATAGGGGGAGAGAGAGAGGG + Intergenic
959391942 3:105786056-105786078 AGGATCGGGGGGGGGAAAGTGGG + Intronic
960489587 3:118297947-118297969 AGGACATGGGGGGAGAGGGGAGG + Intergenic
960639187 3:119810447-119810469 AGCAACTGAGGGGAGACAGAGGG - Intronic
961080871 3:124026371-124026393 GGGAGCTGAAGGGAGAGAGAGGG - Intergenic
961324648 3:126103035-126103057 AGGATGTGGGTGCAGAGAGGAGG + Intergenic
961465815 3:127080962-127080984 AGGGTCTGGTGGGAAAGGGAGGG - Intergenic
961789604 3:129366154-129366176 AGGAGAGGGAGGGAGAGAGATGG + Intergenic
962611930 3:137084935-137084957 AGGGACTGGAGGCAGAGAGATGG + Intergenic
962684571 3:137834832-137834854 AGGGTCTGGGAGGAGAGAAGAGG - Intergenic
963155497 3:142091699-142091721 TGGATGGGGGTGGAGAGAGATGG + Intronic
963277675 3:143349097-143349119 AGTAGCTGGGGGCAGAGAGTTGG - Intronic
963633357 3:147761890-147761912 AGTATCTGGGCCAAGAGAGATGG - Intergenic
963737325 3:149034415-149034437 AGGGGCTGGGGGGAGAGGAATGG + Intronic
964201865 3:154126413-154126435 CGGATATGGGGGCAGAGAGAGGG - Intronic
964724110 3:159796331-159796353 AGAAGCTAGGGGGAGAGGGAAGG + Intronic
966894035 3:184428791-184428813 ACAAGCTGGGGGAAGAGAGAAGG + Intronic
967530706 3:190546390-190546412 AGGAGTTGTGGGGAGAGAAAAGG - Intronic
967933336 3:194706604-194706626 AGGATCTGAAGGCAGACAGAAGG + Intergenic
967972835 3:195012064-195012086 GGCAGCTGAGGGGAGAGAGAAGG + Intergenic
968190001 3:196660697-196660719 AGGTTCAGGTGGGAGAGGGAAGG - Exonic
968222681 3:196949902-196949924 AGGAGATGGGGGGAGAGAAGAGG + Intronic
968377871 4:59061-59083 AGGATCTGTGGGGAGGGAACAGG - Intronic
968544892 4:1193658-1193680 AGGATGTGGGGGGTGTGGGAAGG + Intronic
968544975 4:1193879-1193901 AGGATGTGGGGGGTGTGGGAAGG + Intronic
968801647 4:2746939-2746961 GGGGTCTAGTGGGAGAGAGAAGG - Intronic
968813773 4:2811460-2811482 AAGTTCTGGGAGGAGAGGGAGGG + Intronic
968844164 4:3030635-3030657 AGGCTCTAGGGGGTGAGAGGGGG + Intronic
968978634 4:3834936-3834958 AGGAGAGGGAGGGAGAGAGATGG + Intergenic
969319258 4:6401817-6401839 AGAATCTGGTGGGAGAGGGGGGG + Intronic
969327954 4:6454541-6454563 CTGATCTGGGGGGACTGAGATGG - Intronic
969344286 4:6561466-6561488 AGGAGGTGGGGGGAGGGGGAGGG + Intronic
969509986 4:7612285-7612307 TGGGTCTGGGGGGAAGGAGAAGG + Intronic
969709001 4:8831979-8832001 AGGATCTGGGGCAAGAGAAAGGG + Intergenic
970372027 4:15417851-15417873 TGGATCAAGTGGGAGAGAGAAGG + Intronic
970417544 4:15874274-15874296 AGGAGCAGGAGGAAGAGAGAGGG - Intergenic
971482323 4:27125676-27125698 GAGATGTGGGGGGAGAGAGGTGG - Intergenic
972381421 4:38523685-38523707 AGGGTATGGGGGAAGAGGGATGG - Intergenic
972807018 4:42539244-42539266 GGGACCTGGGGGGAGAGGAAGGG + Intronic
974940790 4:68465325-68465347 AGGATTTGATGGGACAGAGAGGG - Intronic
975380100 4:73690100-73690122 AGGATTTGGGTGGTGAGACAGGG + Intergenic
975668103 4:76754035-76754057 AGGATGTGGGGGCGGTGAGAGGG + Intronic
976178669 4:82379035-82379057 TGGATGTGGGGGGTGAGGGAGGG - Intergenic
976599893 4:86928412-86928434 AGGCACTGGGAGGAGATAGAAGG - Intronic
976615263 4:87069607-87069629 AGGAAGTGGGGGGAAAGGGAAGG - Intronic
977213437 4:94247978-94248000 AGGATGTGGGGGAAGAGTTAAGG - Intronic
978010966 4:103683804-103683826 AGGAAGTGGGGGAGGAGAGATGG + Intronic
978165064 4:105597021-105597043 AGGAGCTGGGCTGGGAGAGAAGG - Intronic
978621326 4:110637041-110637063 AGGAGCAGAGGGAAGAGAGAGGG - Intronic
979258220 4:118625836-118625858 TGGATATGGGGTGTGAGAGAAGG + Intergenic
979330129 4:119414732-119414754 TGGATATGGGGTGTGAGAGAAGG - Intergenic
979539833 4:121869413-121869435 AGGATCTAAGGGGTTAGAGAAGG - Intronic
980030933 4:127829404-127829426 AGGATCTGGAGGCAGAGAGATGG + Intronic
980753449 4:137123798-137123820 AGGAGAAGGAGGGAGAGAGATGG + Intergenic
981110805 4:140931071-140931093 GGGGTGTGGGGAGAGAGAGAAGG + Intronic
981946702 4:150354063-150354085 AAGACTTGAGGGGAGAGAGAAGG + Intronic
982168629 4:152639600-152639622 AAGAAATGGGGAGAGAGAGAGGG - Intronic
984241037 4:177219480-177219502 AGGGACTGGGGAGAGGGAGAGGG + Intergenic
986667999 5:10119651-10119673 AGGAGCAGGAGGAAGAGAGATGG - Intergenic
986974432 5:13379233-13379255 AGGGACAGGAGGGAGAGAGAGGG - Intergenic
987172012 5:15269066-15269088 TTGATCAGGGGGCAGAGAGATGG + Intergenic
987926551 5:24349962-24349984 AGCATCTGGGGGAGGAGAGGAGG - Intergenic
988418764 5:30979370-30979392 AGGATCTGGGGGGTGAGGAGGGG - Intergenic
988511246 5:31866435-31866457 GGCATCTGAGGGCAGAGAGAGGG + Intronic
988511708 5:31869838-31869860 GGCATCTGAGGGCAGAGAGAGGG + Intronic
988604394 5:32667451-32667473 AGGATGGGGTGAGAGAGAGAGGG + Intergenic
988638609 5:33016043-33016065 AGGCTCTGGTGGGAGATTGAAGG + Intergenic
988915447 5:35889408-35889430 AGGTTCTGGAGGAAGAGAGACGG - Intergenic
989286137 5:39702105-39702127 AGCATCTGAGAGGAGAGAGAAGG + Intergenic
989435665 5:41410437-41410459 AGGAGCTGGGGGGCGGGGGACGG - Intronic
989557053 5:42809497-42809519 AGAATCTGTGGGGAGAGATCAGG + Intronic
989823703 5:45827845-45827867 TGGATCTTGGGGGAGTGAAAGGG - Intergenic
990347087 5:54881822-54881844 TGAATGTGGGGAGAGAGAGAGGG - Intergenic
990412518 5:55555071-55555093 AGAATGTGGGTGGAGAGAGTAGG + Intergenic
991157265 5:63453767-63453789 TGGATCTGAGGGGTGAGAGTAGG - Intergenic
991451443 5:66755006-66755028 AGGAGCTGGGACTAGAGAGAAGG + Intronic
992085557 5:73275171-73275193 GGGAGATGGGGGCAGAGAGATGG + Intergenic
992509698 5:77420739-77420761 AGGATCTGGGGATTTAGAGAAGG + Intronic
992628567 5:78658378-78658400 AGGCTTTTGGGTGAGAGAGAAGG + Intronic
993423513 5:87732799-87732821 AGGAGTTGGGGGTGGAGAGAAGG + Intergenic
993443091 5:87979663-87979685 AGGAACAGGGAGAAGAGAGAGGG - Intergenic
993870809 5:93252249-93252271 AGGATCTTGGGAAAGAGAGAAGG - Intergenic
993926190 5:93869273-93869295 AGGTTGTGGGAGTAGAGAGAGGG + Intronic
994152632 5:96466228-96466250 AGGAGGTGGGAGGGGAGAGAAGG - Intergenic
994324321 5:98431781-98431803 GGGATGTGGGGGCAAAGAGATGG - Intergenic
994420962 5:99526106-99526128 AGGTACTGGAGGGAGAGACACGG + Intergenic
995229875 5:109747581-109747603 AAGAGCTGGGGGGAGAGGGTGGG + Intronic
995647588 5:114330014-114330036 AGGCTCAAAGGGGAGAGAGAGGG - Intergenic
995835216 5:116394096-116394118 AGAGTCTGGGGGGATAGAGGGGG + Intronic
995847187 5:116506672-116506694 AGCATCTGGCGGGAGGGGGAGGG + Intronic
996422903 5:123281438-123281460 GAGAACTGGTGGGAGAGAGAAGG - Intergenic
997454749 5:134008119-134008141 AGGATGTGGGGGCGGAGAGGCGG - Intergenic
997467794 5:134099890-134099912 AGGTTCTGGGGAGATAAAGAAGG - Intergenic
997469092 5:134106863-134106885 AGGAACTGGAAGGAGAAAGATGG - Intergenic
997657214 5:135564264-135564286 AGGAGCTGGGGTGAAAGAGAGGG - Intergenic
997986521 5:138505563-138505585 AGGAGCGTGGGAGAGAGAGAGGG + Intergenic
998145334 5:139724628-139724650 AGTATAAGGGGGCAGAGAGAAGG + Intergenic
998155517 5:139784610-139784632 AGGATGTGGGAGGTGAGAGCAGG - Intergenic
999102671 5:149039310-149039332 AGGTTACGGAGGGAGAGAGAGGG + Intronic
999188851 5:149731628-149731650 GGGAGGTGGGAGGAGAGAGAGGG + Intronic
999833319 5:155341588-155341610 AGGATTTGAGCAGAGAGAGAAGG + Intergenic
1000427384 5:161107889-161107911 AGCATCTGGGAGGAGGGAAATGG + Intergenic
1000872182 5:166590728-166590750 AGGATCTGGGTGGAGAAAGAGGG - Intergenic
1000935849 5:167302612-167302634 AGGATCAGGGTGCAGAGATAAGG + Intronic
1001179242 5:169503247-169503269 AGGGGCTGGGGGGAGAGAAAGGG - Intergenic
1001271796 5:170318162-170318184 AGGAGCTGGGGAGGGAGAAAGGG + Intergenic
1001581498 5:172801637-172801659 ATGATCAGGGGCCAGAGAGAAGG + Intergenic
1001582084 5:172805868-172805890 AGGAGCTTGGGGAAAAGAGAAGG - Intergenic
1001600139 5:172923243-172923265 AGCATCTGGGAGGAGGGAGGAGG + Intronic
1001849685 5:174952492-174952514 AGCATTTGGGGGGAAAGAGTGGG - Intergenic
1001938002 5:175719781-175719803 AGGATCTGGTGGGAGAGTGTGGG + Intergenic
1002151456 5:177235625-177235647 AGGAGCTGGGGGGAGACAAAAGG - Intronic
1003400665 6:5787850-5787872 AGTCTGTGGGGGGAGGGAGAAGG - Intergenic
1003527514 6:6910379-6910401 ATGTGCTGGGAGGAGAGAGATGG - Intergenic
1004043409 6:12005030-12005052 AGGATTTGGGAGCAGAAAGAAGG + Intergenic
1004830200 6:19468523-19468545 ATTATCTGGTGGTAGAGAGATGG + Intergenic
1004867749 6:19870624-19870646 GGGAGCTAAGGGGAGAGAGAAGG + Intergenic
1005463511 6:26090615-26090637 AGGATCTGGGGGCAGTGAGGGGG + Intronic
1005511137 6:26512542-26512564 TGGAGCTGAGGGGAGAGAAAAGG + Intergenic
1005533975 6:26736100-26736122 ATGATCTAGAGGGAGAAAGAGGG - Intergenic
1005534546 6:26742579-26742601 ATGATCTAGAGGGAGAAAGAGGG + Intergenic
1005536820 6:26765554-26765576 ATGATCTAGAGGGAGAAAGAGGG + Intergenic
1006740428 6:36304133-36304155 ATGGTCTGGGTGGAGACAGAGGG + Intronic
1007047873 6:38796085-38796107 AGGATGCTGGAGGAGAGAGAAGG + Intronic
1007289299 6:40773185-40773207 AGGGGCTGGGGGAAGAGAGCTGG - Intergenic
1007372883 6:41438316-41438338 AGCAACTGGGGTGGGAGAGAGGG - Intergenic
1007481741 6:42154746-42154768 AGGCTCAGAGGGGAGAGAGTGGG + Intergenic
1008057168 6:46956931-46956953 TGGAGGTGAGGGGAGAGAGAGGG + Intergenic
1008826602 6:55702066-55702088 GATATCTGGGGGAAGAGAGAGGG + Intergenic
1009007717 6:57807967-57807989 ATGATCTAGAGGGAGAAAGAGGG + Intergenic
1009539330 6:64932144-64932166 AAGAGCTGGGGAGAGAGGGATGG - Intronic
1010257148 6:73771148-73771170 GGGATCTGAGGGGTGGGAGATGG + Intronic
1010995455 6:82527146-82527168 AGGGGCTGGTGGGAGAGAAATGG - Intergenic
1011194568 6:84767799-84767821 AGGACTTGGGGAGAGAGAGAAGG + Intergenic
1011397027 6:86920808-86920830 AGGATCCTGGGAGAGAGAAAAGG - Intergenic
1011748212 6:90428485-90428507 AATATGTTGGGGGAGAGAGAAGG - Intergenic
1012444416 6:99293343-99293365 AAGTTGTGGGGGCAGAGAGAGGG - Intronic
1012998453 6:105995991-105996013 AGGTTTTGGAGTGAGAGAGAAGG - Intergenic
1013015501 6:106157461-106157483 AGGATCTGGAGGGAGAGACATGG - Intergenic
1013645847 6:112140347-112140369 AGTATCTGGGATGAGAGAGGGGG - Intronic
1013931709 6:115542397-115542419 AGTATTTGGGGGGAGGGGGAAGG + Intergenic
1014459377 6:121677536-121677558 AGGATCATGGGGAAAAGAGAAGG + Intergenic
1014760074 6:125346393-125346415 CGGAGCTGGGGGGAGAAGGAAGG + Intergenic
1015483015 6:133735289-133735311 AGGATCTGGGATGAGAGAAAAGG + Intergenic
1015920297 6:138259592-138259614 AGAATCTGGAGGGAAAGGGATGG - Intronic
1017272493 6:152524697-152524719 AGGATGTGTGGAGAGCGAGATGG + Intronic
1017640892 6:156492761-156492783 AGCATCCTGGGGGAGGGAGATGG + Intergenic
1017710931 6:157167215-157167237 AGGAGGAGAGGGGAGAGAGAGGG - Intronic
1017989317 6:159472397-159472419 TGGATCAGGAGGAAGAGAGAGGG + Intergenic
1018392705 6:163352597-163352619 AGGGTCTGCGGGGAGAGAGTTGG - Intergenic
1018463600 6:164022128-164022150 AGGAACTGGGGGAGCAGAGAAGG + Intergenic
1018805220 6:167254102-167254124 TGGAGCAGGAGGGAGAGAGAAGG - Intergenic
1019557871 7:1641561-1641583 AAGAGCTGGGGGGCGGGAGAAGG - Intergenic
1020011374 7:4807607-4807629 GGGAGACGGGGGGAGAGAGAAGG - Intronic
1020173793 7:5866332-5866354 AGGAGTGGGGGGGAGAGGGAGGG + Intergenic
1021310739 7:19092982-19093004 AGGATAAGGTGGGAGTGAGAGGG + Intronic
1021697059 7:23286179-23286201 AGGAGAGGGGTGGAGAGAGAGGG - Intergenic
1021963441 7:25894891-25894913 GGGATCCGGCGGGTGAGAGAGGG - Intergenic
1022208273 7:28183533-28183555 GGGCTCTGGGGAGAGACAGATGG - Intergenic
1022303742 7:29127050-29127072 AGGATATGGTGGCAGAGACAGGG - Intronic
1022508303 7:30920453-30920475 AGGATCTGGGGACAGGCAGAAGG - Intronic
1022666711 7:32417571-32417593 AGGCTCTGCAGTGAGAGAGATGG - Intergenic
1023271647 7:38469721-38469743 AGGATTTGGTGAGGGAGAGAGGG - Intronic
1023397372 7:39763762-39763784 AGGAGGTAGGGAGAGAGAGAGGG - Intergenic
1023400205 7:39787130-39787152 TGGATATGGGGTGTGAGAGAAGG + Intergenic
1023702828 7:42909922-42909944 AGGACCTGGGGAGAGAGAGAGGG - Exonic
1023863026 7:44226876-44226898 GGGAGCTTGGGGGACAGAGAGGG + Intronic
1023968630 7:44976473-44976495 TGGCTCTGGGGAGTGAGAGACGG - Intronic
1024073133 7:45802881-45802903 TGGATATGGGGTGTGAGAGAAGG + Intergenic
1024650198 7:51397307-51397329 TGGATATGGGGTGTGAGAGAAGG - Intergenic
1025054345 7:55752956-55752978 TGGATATGGGGTGTGAGAGAAGG - Intergenic
1025132395 7:56383109-56383131 TGGATATGGGGTGTGAGAGAAGG - Intergenic
1025135301 7:56406706-56406728 AGGAGGTAGGGAGAGAGAGAGGG + Intergenic
1025183454 7:56837565-56837587 TGGATGTGGGGTGTGAGAGAAGG - Intergenic
1025688471 7:63739402-63739424 TGGATGTGGGGTGTGAGAGAAGG + Intergenic
1026454154 7:70556166-70556188 AGGAGCAAGGGAGAGAGAGAGGG + Intronic
1026549319 7:71354004-71354026 AGGATCAAGAGAGAGAGAGAAGG + Intronic
1027203647 7:76080041-76080063 TGGATGTGGGGTGTGAGAGAAGG - Intergenic
1027208907 7:76127789-76127811 AGGAACTGGGGAGCAAGAGAGGG + Intergenic
1027577702 7:79951378-79951400 AGGATTTGAGGGGAGGGATATGG - Intergenic
1027732428 7:81891789-81891811 AGGGGCTGGTGGGGGAGAGATGG + Intergenic
1029054269 7:97724026-97724048 AGGATGTGTGTGGAGAAAGAGGG + Intergenic
1029193146 7:98785927-98785949 GGGTTTTGGGGTGAGAGAGAGGG + Intergenic
1029726681 7:102410588-102410610 CAGATCTGGGGAGAGGGAGACGG + Intronic
1030033886 7:105392183-105392205 AGGAGTTGGGGGGTGGGAGAAGG + Intronic
1030077859 7:105751817-105751839 GGGATGTGGGGGTAGAGACAGGG + Intronic
1031077067 7:117223093-117223115 GGGATGTGGGGAGTGAGAGAGGG - Exonic
1031980016 7:128118789-128118811 GAGATGTGGGGGGAGAGAGATGG + Intergenic
1032050520 7:128646575-128646597 TGGATATGGGGTGTGAGAGAAGG + Intergenic
1032795124 7:135270497-135270519 AGGAGCTGGTGGGACTGAGATGG - Intergenic
1033172360 7:139095399-139095421 AGGATGTGGGGAGACACAGAGGG + Intronic
1033363021 7:140651247-140651269 AGGACCTGGGGGGAGGGGCAGGG + Intronic
1033540722 7:142353402-142353424 AGGAGCTGCAAGGAGAGAGAAGG - Intergenic
1033551980 7:142455679-142455701 AGGAGCTGCAAGGAGAGAGAAGG - Intergenic
1033933005 7:146547490-146547512 AGGAGCTGAGGGAAGAGGGATGG - Intronic
1034074905 7:148222144-148222166 AGAATCTGGAAGCAGAGAGATGG - Intronic
1034443461 7:151099924-151099946 AGGAAGTGGGCGGAGAGACAGGG - Intronic
1034487499 7:151375019-151375041 CGGGGCTGGGGGGACAGAGATGG + Intronic
1034501388 7:151453079-151453101 AGGTTCTGGGGGGTGAGGGTGGG + Intergenic
1034982722 7:155489031-155489053 AGGATCTGTGGGTGGTGAGAGGG - Intronic
1035096500 7:156360253-156360275 AGGGTGTGGGAGGAAAGAGAGGG + Intergenic
1035181122 7:157090430-157090452 AGGGGCTGGAGGGAGAGAGGAGG + Intergenic
1035404850 7:158590057-158590079 GGGAGATGGAGGGAGAGAGAAGG - Intergenic
1036457940 8:8925940-8925962 AGGGTGGAGGGGGAGAGAGATGG - Intergenic
1036479508 8:9125933-9125955 AGGCTCTGGTGGTGGAGAGATGG + Intergenic
1036570689 8:9977504-9977526 AGGATCTGGGGAAGGGGAGATGG + Intergenic
1036757071 8:11477638-11477660 AGGATTAGGTGGAAGAGAGAAGG - Intergenic
1037016705 8:13916361-13916383 AGGAGCAGGAGGAAGAGAGAGGG - Intergenic
1037016793 8:13917670-13917692 AGGACTTGGAGGCAGAGAGATGG - Intergenic
1037511598 8:19588773-19588795 AGGATATGGGGGATGCGAGAGGG + Intronic
1037535319 8:19817804-19817826 AGGATGGGAGGGGAGAGAGGAGG - Intronic
1037646887 8:20800306-20800328 AGGATGGGGGAGGAGAGAGACGG + Intergenic
1037717570 8:21412816-21412838 AGGCTCTGTGGGTAGAGACATGG + Intergenic
1037951283 8:23019898-23019920 AGGAGCAGGCAGGAGAGAGAGGG + Intronic
1038497325 8:28012965-28012987 AGGATGGGGGGAGAGAGAGAAGG + Intergenic
1038592993 8:28857845-28857867 AGCAGCTGAGGGGATAGAGAGGG + Intronic
1038620129 8:29134785-29134807 AAGATGTGGGGAGAGATAGAAGG + Intronic
1038669392 8:29570351-29570373 AGCAATGGGGGGGAGAGAGAAGG - Intergenic
1038796731 8:30716900-30716922 AAAATTTGGGGGGAAAGAGAAGG - Intronic
1039451198 8:37676340-37676362 AGGAAGTGGGAGGAGAAAGAGGG - Intergenic
1040309527 8:46229564-46229586 AGGATGTTGAGGGAGACAGAGGG + Intergenic
1040560728 8:48521259-48521281 AGGCTTTTGGGGGAGGGAGAAGG + Intergenic
1041595349 8:59644252-59644274 AACATCTGGGGGGAGAGTCAAGG - Intergenic
1041782020 8:61587158-61587180 GGTTTCTGGGAGGAGAGAGAAGG - Intronic
1042164374 8:65931155-65931177 AGGAAGAGTGGGGAGAGAGAGGG - Intergenic
1042746952 8:72118835-72118857 GGGATGTGGGGGGAGATAGAGGG - Intergenic
1043495034 8:80791327-80791349 AGGATCTGCAGGGACAGGGATGG - Intronic
1044506711 8:93028854-93028876 AGGATATGGGGATAGAGTGATGG - Intergenic
1044753000 8:95434145-95434167 AGGATGTTGGGGGAAAGAGGTGG - Intergenic
1046100080 8:109603858-109603880 AGGATCTGGGAGGAGTGTGCAGG + Intronic
1046120535 8:109840822-109840844 AGGATTTGGGGGCAGAGATATGG - Intergenic
1046609244 8:116405672-116405694 TGGATATGGGGGGAGAAGGAGGG + Intergenic
1046865656 8:119147371-119147393 AAAATTTGGTGGGAGAGAGAGGG - Intergenic
1047676395 8:127207629-127207651 AGGACCTGGGATGAGAAAGAAGG - Intergenic
1047987991 8:130256395-130256417 AGGATCTGGGGGGTGGGGGGCGG + Intronic
1048285323 8:133136940-133136962 AGGATCTGGGGGCTCAGACAGGG + Intergenic
1048411199 8:134175303-134175325 AGGAAATGGGGAGAGAGAAATGG - Intergenic
1048883063 8:138886024-138886046 AGGAGGTGGGGGAAAAGAGATGG - Intronic
1049062925 8:140290152-140290174 AGGCCCTGAGGGGACAGAGATGG - Intronic
1049219505 8:141422494-141422516 AGGATCCTGGAGGAGGGAGATGG + Intronic
1049268618 8:141682580-141682602 TGGATTTGGTGAGAGAGAGATGG + Intergenic
1049315980 8:141967867-141967889 AGGTTCTCGGGGCAGGGAGAGGG + Intergenic
1049363438 8:142225147-142225169 AGGGTCTGGGGGGAGGGGGGAGG - Intronic
1049426168 8:142538790-142538812 AGGGTCTGGGGAGGGAGAGGTGG - Intronic
1049841804 8:144777834-144777856 GGGACCTGGGGCGAGAGGGAAGG + Intronic
1050081715 9:1922384-1922406 AGGTTCTGGCGGGAGATTGAAGG - Intergenic
1050424348 9:5498607-5498629 AGCAGCTGGGGGAAGAGAGGAGG - Intergenic
1050804995 9:9665114-9665136 TGTATGTGGGGAGAGAGAGAGGG + Intronic
1050885148 9:10755044-10755066 GGGAGATGGGGGAAGAGAGAGGG + Intergenic
1051729553 9:20125943-20125965 AGGATCTGGGAGGGGAGGGCTGG + Intergenic
1052300345 9:26946789-26946811 AGGCTGGGGGGAGAGAGAGACGG + Intronic
1052625659 9:30973541-30973563 AGGAAATGGTGGTAGAGAGAGGG + Intergenic
1052822725 9:33151406-33151428 TGGTTCTAGGTGGAGAGAGAAGG - Intronic
1052988417 9:34504225-34504247 AGGATGTGGTGGGACAGAGTGGG - Intronic
1053032972 9:34798030-34798052 AGGATTAGGGGGTAGAGAAAAGG + Intergenic
1053754631 9:41293133-41293155 AGGATGTAGGCGGAGAGACAGGG - Intergenic
1054260153 9:62857437-62857459 AGGATGTAGGCGGAGAGACAGGG - Intergenic
1054830874 9:69623185-69623207 TGGATCTTGGGGGAGAGTGCTGG + Intronic
1055087822 9:72332303-72332325 AGGATCAGGGGGAAAATAGAGGG - Intergenic
1056136281 9:83632225-83632247 AGAATATGGGTGGAGAGAGACGG - Intronic
1057177496 9:93010644-93010666 AGGAAGGAGGGGGAGAGAGAGGG + Intronic
1057634160 9:96747388-96747410 AAGAACTGGGGGGTGAGGGAGGG - Intergenic
1057791744 9:98129237-98129259 AGGAGCTGTGGGGATGGAGATGG - Intronic
1058250041 9:102681955-102681977 AGGGGCTGGGGGGAATGAGAGGG + Intergenic
1058923678 9:109641087-109641109 AGGGCCTGGGGGGCGAGTGAGGG + Intronic
1059153153 9:111967120-111967142 AGGATCTGCTGGGGGAGGGAGGG - Intergenic
1059379961 9:113915426-113915448 AGGAACTGGGGGGAGACTGGTGG + Intronic
1059472222 9:114514321-114514343 TGGAGCAGGAGGGAGAGAGAGGG + Intergenic
1059655574 9:116354598-116354620 TGGATATGGAGGGAGTGAGAGGG - Intronic
1059681740 9:116592352-116592374 TGGAGCAGGAGGGAGAGAGAAGG + Intronic
1059999770 9:119947759-119947781 AGAATATGGTGGGAAAGAGACGG - Intergenic
1060146177 9:121254422-121254444 AGGAACTTGGGAGAGAGAAAAGG - Intronic
1060147182 9:121263135-121263157 AGGCTCTTGGTGGAGGGAGAAGG + Intronic
1060260834 9:122072308-122072330 AGGATGTGGGAGGAGAGTGAAGG - Intronic
1060548957 9:124476291-124476313 AGGATGGGGGAGCAGAGAGAGGG + Intronic
1060858253 9:126933190-126933212 AGGAAATGGGAGGAGAAAGAGGG + Intronic
1061119256 9:128633191-128633213 AGGTTCTGTGGGGTAAGAGATGG - Exonic
1061191032 9:129082834-129082856 AGCATCTGGGAGTAGAGACAGGG - Intronic
1061445049 9:130632823-130632845 AGCGTCTGTGGGGACAGAGAGGG - Intronic
1061618093 9:131793184-131793206 GAGAACTGGGAGGAGAGAGAGGG + Intergenic
1061782866 9:133006044-133006066 AGGATCTGGGGGAGGGGAGTGGG + Intergenic
1062062164 9:134502492-134502514 TGCATCTGGGTGCAGAGAGAGGG - Intergenic
1062335107 9:136061491-136061513 AGGGGCTGGAGGCAGAGAGAAGG + Intronic
1062346592 9:136118076-136118098 AGGAGCCGGGCGGAGGGAGAGGG - Intronic
1062726619 9:138077706-138077728 AGGATATGGAGAGAGAGAGGAGG + Intronic
1203571367 Un_KI270744v1:135186-135208 AGGATCTGTGGGGAGGGAACAGG + Intergenic
1185462443 X:339511-339533 AGGAGCCGGGGGGGGTGAGAGGG + Intronic
1185462468 X:339560-339582 AGGAGCCGGGGGGGGTGAGAGGG + Intronic
1185462554 X:339731-339753 AGGAGCCGGGGGGGGTGAGAGGG + Intronic
1185462566 X:339755-339777 AGGAGCCGGGGGGGGTGAGAGGG + Intronic
1185462577 X:339779-339801 AGGAGCCGGGGGGGGTGAGAAGG + Intronic
1185462638 X:339902-339924 AGGAGCTGGGGGGGGTGAGAGGG + Intronic
1185462682 X:339995-340017 AGGAGATGGGGGGGGTGAGAGGG + Intronic
1185462693 X:340019-340041 AGGAGATGGGGGGGGTGAGAGGG + Intronic
1185462704 X:340043-340065 AGGAGATGGGGGGGGTGAGAGGG + Intronic
1185462725 X:340090-340112 AGGAGATGGGGGGGGTGAGAGGG + Intronic
1185462736 X:340114-340136 AGGAGATGGGGGGGGCGAGAGGG + Intronic
1185462749 X:340141-340163 AGGAGCCGGGGGGGGTGAGAAGG + Intronic
1185568035 X:1111629-1111651 AGGATGAAGGGAGAGAGAGAGGG + Intergenic
1187354315 X:18552723-18552745 AGGATCTGGGGGATGAGAGAGGG + Intronic
1189352593 X:40287405-40287427 AGGGGCTGGGGGGTGAGAGGAGG - Intergenic
1189955329 X:46271866-46271888 TGGAGCTGGGGAGAGAGGGATGG - Intergenic
1190134293 X:47781283-47781305 GGGATATGGGAGGAAAGAGATGG + Intergenic
1190702581 X:52999666-52999688 GGGAGCTGGGGAGAGAGAGGAGG - Intergenic
1190738193 X:53269567-53269589 GGGATGTGGGGGCAGATAGAGGG - Intronic
1190786221 X:53651792-53651814 AGGAAATGGTGGGAGAGAGAAGG - Intronic
1191735928 X:64387705-64387727 AGAGATTGGGGGGAGAGAGAAGG + Intronic
1192211482 X:69130725-69130747 AGGGTAGGGGGAGAGAGAGAGGG - Intergenic
1192563277 X:72141542-72141564 GGAATCTGCGGGGAGGGAGAAGG - Intergenic
1192615221 X:72613439-72613461 GGTATCTGGGGGAACAGAGATGG + Intronic
1193198755 X:78663262-78663284 GGGATATGGGGAGAAAGAGAGGG + Intergenic
1193907395 X:87260272-87260294 AGGGTCTGGAGGGAGAAATAAGG + Intergenic
1194001800 X:88438799-88438821 AGGATCTGGGGGTTCTGAGAGGG + Intergenic
1195067813 X:101253412-101253434 AGCATCTGCGGGGACAGAAAAGG - Intronic
1195165894 X:102220120-102220142 AGGATGTAGGAGGAGAAAGAAGG + Intronic
1195192965 X:102466971-102466993 AGGATGTAGGAGGAGAAAGAAGG - Intronic
1195750547 X:108159132-108159154 AAGATCTGGGAGGACAGTGAGGG - Intronic
1196697969 X:118634463-118634485 AGGACATGGGGCGAGGGAGATGG + Intronic
1197174163 X:123466884-123466906 AGGATCCTGAGGGATAGAGAGGG - Intronic
1197542532 X:127783032-127783054 AGGAGCCGGGGGAAGAGAGGTGG - Intergenic
1197688622 X:129472991-129473013 AGGATCTAGGGAGATGGAGAAGG + Intronic
1197996876 X:132386807-132386829 AGGGCCTGTGGGGGGAGAGATGG + Exonic
1198932871 X:141879406-141879428 AGGTTGTGGGGGGAGAAAGCGGG + Exonic
1199433684 X:147788886-147788908 AGGAGTTGAGGGGAGACAGAGGG - Intergenic
1200062557 X:153490067-153490089 AGGCTCTGGTGGGAGTGGGAAGG - Intronic
1200852828 Y:7903465-7903487 AGTATATGGGGGTAGAGAAATGG + Intergenic