ID: 1172392367

View in Genome Browser
Species Human (GRCh38)
Location 20:34574595-34574617
Sequence CAGGCAGAGGAGAAGGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1303
Summary {0: 1, 1: 1, 2: 13, 3: 120, 4: 1168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172392367 Original CRISPR CAGGCAGAGGAGAAGGGGGC CGG (reversed) Intronic
900008941 1:88704-88726 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900008974 1:88850-88872 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900008991 1:88921-88943 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900118374 1:1038234-1038256 GAGGCAGAGGGGAAGGGGCCAGG + Intronic
900208326 1:1440977-1440999 AATGCAGAGGACAAGGGGGCTGG + Exonic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
900419724 1:2550686-2550708 CAGGAAGAGGAGGAGGCAGCCGG + Intergenic
900426881 1:2585009-2585031 GATGCAGAGCAGAAGGTGGCTGG - Intergenic
900555797 1:3279755-3279777 CAGGCAATGGGGAAAGGGGCAGG - Intronic
900736756 1:4304036-4304058 CAGGTTGTGGAGAAGGGAGCGGG - Intergenic
900875821 1:5341780-5341802 CAGGCACAGGAGAGAGGGGCTGG + Intergenic
901055698 1:6447839-6447861 TAGGGAGAGGCGCAGGGGGCGGG + Intronic
901323769 1:8355323-8355345 CAGGCAGAGGGGGAGGAGCCTGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901462948 1:9402360-9402382 CAGGCAGAGGTGTAGGGGGAAGG - Intergenic
901475313 1:9485394-9485416 GAGGAAGAGGAGAAGGGAGTGGG - Intergenic
901508379 1:9700990-9701012 GAGGAAGGGGAGTAGGGGGCAGG - Intronic
901767710 1:11514544-11514566 CTGGGAGGGGAGGAGGGGGCTGG - Intronic
901790760 1:11652745-11652767 CAGGCACTGGGGAAGGGGACAGG + Intronic
901797996 1:11691668-11691690 CGGGCAGGAGGGAAGGGGGCGGG - Intergenic
901855131 1:12039569-12039591 CAGCCAGTGGAGAAGGGGAGAGG + Intergenic
901892114 1:12275532-12275554 AAGGCAGGGGAGAAGTGGGGAGG + Intronic
902170331 1:14604918-14604940 AGGACAGAGGAGAAGGGAGCTGG - Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902478694 1:16700798-16700820 TAGGGAGAGGCGCAGGGGGCGGG - Intergenic
902718814 1:18290834-18290856 GAGGCAGCGGGGAAAGGGGCAGG - Intronic
902771456 1:18647495-18647517 GGGGGAGAGGAGAAGGAGGCAGG + Intronic
902922831 1:19677434-19677456 CAGGAAGAGGAGGAAGGGGTAGG - Intronic
903757550 1:25673035-25673057 CAGCCAGAGGTGAACGGGGAGGG + Intronic
903759414 1:25687404-25687426 CAGGCTGCAGACAAGGGGGCTGG - Intronic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904044680 1:27602514-27602536 GAGCCAGAGGGGCAGGGGGCTGG - Intronic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904311200 1:29630729-29630751 AAGGAAGAGAAGAAGGGGGGGGG - Intergenic
904456223 1:30649796-30649818 CAGGCAGAGAGGAGGTGGGCAGG - Intergenic
904487822 1:30839361-30839383 AAGGCAGAGGAAGAGGGGGGTGG - Intergenic
904910019 1:33927767-33927789 CAGGCAGAAGAGAAGGGAGCAGG - Intronic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
904993117 1:34609927-34609949 CAGGCAGAGGGCAGGGGGACAGG + Intergenic
905224642 1:36471419-36471441 AAAGCAGAGGTAAAGGGGGCTGG - Exonic
905326147 1:37153338-37153360 CCTGCAGAGGACATGGGGGCAGG - Intergenic
905353397 1:37363240-37363262 GAGGCAAAGGAGGATGGGGCGGG - Intergenic
905510959 1:38519744-38519766 AAGGGAGAGGAGAAGGGAGGGGG + Intergenic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906292908 1:44631706-44631728 CAGGCACAGGAGGCGGGAGCCGG + Intronic
906316076 1:44787069-44787091 CAGGCACAGGAGCTGGGTGCTGG - Intronic
906439399 1:45827932-45827954 GAGGCTGAGGAGAAGCGGGGAGG - Intronic
906660458 1:47578070-47578092 CAGGCAGAGGAGGGGTTGGCAGG - Intergenic
906685066 1:47757820-47757842 CTGGCAGAGCAGATGGGGGTGGG + Intergenic
907053073 1:51342833-51342855 CAGGCTGAGGAGAAGGTGTAGGG - Intronic
907270615 1:53288800-53288822 AAAGGAGATGAGAAGGGGGCGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909475097 1:76073510-76073532 AAGGCAGAGGAGGGAGGGGCGGG + Intergenic
910226548 1:84941959-84941981 CAGGCAGAAGAGAGCTGGGCTGG - Intronic
910598563 1:89005732-89005754 CAGGCAGAGGGCAAGAGGGGCGG + Intergenic
910935410 1:92482440-92482462 CAGGCAGAGGAGCTAGGCGCTGG - Intronic
911167405 1:94736158-94736180 CAGCCACAGGAGAATGGGGGTGG - Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912418455 1:109527825-109527847 GAGGCAGAGGAAAAGGGCCCTGG - Intergenic
912640674 1:111342627-111342649 CAGGCAGAGGCAAAGGGAGGAGG - Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912812222 1:112803092-112803114 CAGGGAGTGGAGAGGAGGGCAGG - Intergenic
912860765 1:113211775-113211797 CAGGGAGGGGAGATGGGGGGAGG + Intergenic
913245035 1:116863758-116863780 CAGCCAGGGGAGAAGGGGAGAGG - Intergenic
913328286 1:117646671-117646693 GGGCCAGAGGAGAAGGGGCCTGG - Intergenic
913611018 1:120509861-120509883 CTGGCAGGGGAGAAGAGGGAAGG - Intergenic
914580172 1:149012378-149012400 CTGGCAGGGGAGAAGAGGGAAGG + Intronic
914802459 1:150971566-150971588 CTGGCTGAGGTGGAGGGGGCAGG - Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915003078 1:152611328-152611350 CAGGCAGTCAAGAATGGGGCTGG + Intergenic
915141232 1:153769869-153769891 CTGGGAGAGGAGAGGAGGGCAGG + Intronic
915284181 1:154842388-154842410 CAGGCCGAGGAGAGGGGCCCTGG + Intronic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
915935416 1:160087713-160087735 AAGGTGGAGGAGGAGGGGGCGGG + Exonic
915951118 1:160190532-160190554 GAGGAATAGGAGCAGGGGGCGGG - Intergenic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
916001538 1:160621187-160621209 CAGGCAGAGGCAATGGAGGCTGG + Intronic
916216333 1:162398114-162398136 CAGACAGAGTAGAATGGGGATGG + Intronic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916524761 1:165598877-165598899 AAGGGAGAGGAGAAGAGGGGAGG + Intergenic
916577878 1:166083067-166083089 CAGGTAGAGGAGATGGGGAGTGG + Intronic
916750807 1:167721729-167721751 AAGGCAGAGGAGACGCTGGCTGG + Intronic
916915196 1:169399222-169399244 GAGGCAAGGTAGAAGGGGGCTGG + Intronic
917333891 1:173909284-173909306 CAGGTAGAGGAGATGGGACCAGG - Intronic
917476518 1:175373790-175373812 AAGGCTGGGGATAAGGGGGCTGG - Intronic
917823947 1:178796500-178796522 CAGGGAGAGGGCAATGGGGCTGG - Intronic
918095446 1:181330329-181330351 CAGGCAGAGAAGAAGGGGAGAGG - Intergenic
918118570 1:181517612-181517634 GAGGCAGAGGAAAAGGGAGCAGG + Intronic
918202663 1:182281680-182281702 CAGGAAGAGGAGAAGGGAGGTGG + Intergenic
919495910 1:198267791-198267813 CAGGCAGAGGTGAGGGTGGTAGG - Intronic
919675067 1:200373890-200373912 CAGGCAGAAAAAAAGGGGGGAGG + Intergenic
919846990 1:201648608-201648630 CAGGCACGGGGGGAGGGGGCAGG - Exonic
919915753 1:202138120-202138142 GAGGCAGAGGAGAGTAGGGCAGG - Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920102307 1:203525014-203525036 GAGGCAGGGGTGCAGGGGGCAGG - Intergenic
920293456 1:204940588-204940610 GAGGCAGAGGGGAAGGGAGAAGG - Intronic
920372226 1:205486248-205486270 GAGACAGAGGGGAAGGGGGTGGG - Intergenic
920443108 1:205994510-205994532 CAGGAAGAAGAGATGGGGGTGGG + Intronic
920727551 1:208450347-208450369 CAGGCAGATGAGAAAGGGAGAGG + Intergenic
920741749 1:208587381-208587403 CAGGCAGAGGAGAGAAGAGCTGG - Intergenic
920925545 1:210338049-210338071 CAGGCAGAGGATCTGGGGACAGG + Intronic
921397084 1:214679859-214679881 GAGGAGGAGGAGAAGGGGGGAGG - Intergenic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922471131 1:225877993-225878015 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922728365 1:227936944-227936966 GAGGCAGCTGAGAAGGGTGCGGG - Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923272887 1:232373373-232373395 CAGGCAGAGAGGACAGGGGCAGG + Intergenic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923850678 1:237790875-237790897 CAGACAGGTGAGCAGGGGGCAGG - Intronic
924847700 1:247789743-247789765 CAGACAGAGGAGAAGGGACTGGG - Intergenic
1062818971 10:519828-519850 CAAGTAGAGGAGCAGGGGGGAGG - Intronic
1062890729 10:1057360-1057382 CAGGCCGAAGCAAAGGGGGCGGG - Intronic
1063280923 10:4628496-4628518 CAGGCAGAGGAGAAATGGAGAGG - Intergenic
1063480053 10:6367507-6367529 AAGGGAGAAGAGAAGGGTGCAGG + Intergenic
1063499020 10:6536595-6536617 GAGGAAGAGGAGAAGGGGAGCGG - Intronic
1063515767 10:6693623-6693645 CAGGCGCAGGAGGAGGGGGGAGG - Intergenic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1063935519 10:11073717-11073739 CTGACTGAGGAGAAGGGGCCAGG + Intronic
1064190125 10:13198589-13198611 TAGGCAGAGGAGGAGGGAGTGGG + Intronic
1064194550 10:13234407-13234429 GGGGGAGAGGAGGAGGGGGCTGG + Intergenic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065681792 10:28242849-28242871 CAGGAAGAGGAGGAGGGGAGAGG + Intronic
1065735032 10:28743770-28743792 AAGGCATGGGAGAAAGGGGCCGG - Intergenic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1067038924 10:42938392-42938414 CAGGCAGTGAAGGAGGGGCCAGG - Intergenic
1067280728 10:44870165-44870187 CGGGCAGGGGTGAAGGCGGCGGG - Intergenic
1067343006 10:45419456-45419478 CAGGCAGAGGCCTAGGGGGTGGG + Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068845035 10:61662808-61662830 CGCGCAGAGGAGCAGGAGGCCGG - Intergenic
1069058558 10:63869898-63869920 CAGGCACTGGGGAAGAGGGCAGG - Intergenic
1069078188 10:64060550-64060572 CAGGCAGAGAATGAGTGGGCAGG - Intergenic
1069240298 10:66130016-66130038 CTGGCAGAGGTGAAGCAGGCAGG - Intronic
1069744148 10:70704210-70704232 CTGACAGTGGAGCAGGGGGCTGG - Intronic
1069910255 10:71754451-71754473 CAGGCAGACGGGAAGAGGCCAGG + Intronic
1070311259 10:75275724-75275746 CAGACTGAGGGCAAGGGGGCTGG + Intergenic
1070711888 10:78689055-78689077 CAGGCAGAGGTGGAGGGGAGAGG - Intergenic
1070712651 10:78693929-78693951 GAGTCAGGGGAGAAGGAGGCTGG + Intergenic
1070749086 10:78953344-78953366 CAGGCCGAGGAGACCGGAGCTGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070877380 10:79826362-79826384 CAGGCGGAGGAGGAAGCGGCGGG + Intergenic
1071643875 10:87342406-87342428 CAGGCGGAGGAGGAAGCGGCGGG + Intergenic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1072614772 10:97042253-97042275 CCAGAAGCGGAGAAGGGGGCTGG + Intronic
1072756249 10:98023120-98023142 CAGCCAGGTGGGAAGGGGGCGGG + Intronic
1072767123 10:98104246-98104268 CAGGAAGGGGAGAAGAGGGGAGG - Intergenic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073036512 10:100567536-100567558 CCTGCAGAGGGGAAGGGAGCAGG + Intergenic
1073050580 10:100664559-100664581 AGGGGAGAAGAGAAGGGGGCAGG + Intergenic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073146700 10:101285964-101285986 GAGGCAGAGGGGAAGGTTGCCGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073301994 10:102476519-102476541 AAGGCAGTGGAGCAGGGTGCTGG - Exonic
1073353661 10:102837021-102837043 CAGGGGGTGGTGAAGGGGGCAGG + Intronic
1073879886 10:107968509-107968531 CAGTCAGAGGAGAACAGGGAAGG - Intergenic
1074187991 10:111113569-111113591 TAGGAAGAGGAAAAGAGGGCTGG + Intergenic
1074446877 10:113528078-113528100 CATGCACATGGGAAGGGGGCTGG - Intergenic
1074467045 10:113692511-113692533 CAGGCAGACCAGAAGGGGCGTGG - Intronic
1074522861 10:114240374-114240396 CAGACAGAAGAGAAGGGAGGAGG + Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075100413 10:119502587-119502609 AGGGCAGAGGAGGAGGGGGAGGG + Intronic
1075246933 10:120830824-120830846 CAGTCAGCAGAGAAGGGAGCTGG + Intergenic
1075288177 10:121205021-121205043 CAGACAGAGGTGGAGGTGGCAGG - Intergenic
1075304296 10:121354309-121354331 CAGGGAGGAGAGAAGAGGGCAGG - Intergenic
1075450613 10:122549524-122549546 GAGGGAGAGGAGAAGGGGACAGG + Intergenic
1075579681 10:123607651-123607673 CAGCCGGAGCAGAAGGGGCCAGG - Intergenic
1075607635 10:123825238-123825260 GAGACAGAGAGGAAGGGGGCAGG + Intronic
1076035512 10:127196179-127196201 CCGGCAGCGGTGGAGGGGGCGGG - Intronic
1076070228 10:127482962-127482984 CAGGGAGTGGACAAGGGGGAAGG - Intergenic
1076183813 10:128431236-128431258 CAGGCAGACAAGGAGGCGGCAGG - Intergenic
1076222500 10:128745763-128745785 CTGATAGGGGAGAAGGGGGCAGG + Intergenic
1076346038 10:129779872-129779894 CGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076721960 10:132396807-132396829 CAGGCAGGGGAGCGGGGGGATGG + Intergenic
1076723549 10:132403165-132403187 TGGCCAGAGGAGAATGGGGCGGG + Intronic
1076730366 10:132436137-132436159 CATCCAGTGGAGAAGGGGCCTGG - Intergenic
1076730418 10:132436313-132436335 CATCCAGTGGAGAAGGGGCCTGG - Intergenic
1076730445 10:132436398-132436420 CATCCAGTGGAGAAGGGGCCTGG - Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076801927 10:132834970-132834992 CGGGCAGAGGAGATGGGTGGGGG - Intronic
1076858287 10:133127971-133127993 CAGGAAGAGGTGAAGTGGGGTGG - Intronic
1077020149 11:413760-413782 CAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077141850 11:1028195-1028217 CAGCCAGGGGAGTGGGGGGCCGG + Intronic
1077185380 11:1233377-1233399 CAGGCTGGGGAGAGTGGGGCAGG + Intronic
1077344343 11:2039463-2039485 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1077550063 11:3196280-3196302 CATGCAGGAGAGAAGGGGGCCGG + Intergenic
1077552023 11:3204665-3204687 CTGGCAGAGGGGGTGGGGGCCGG - Intergenic
1077610563 11:3641321-3641343 GAGCCCGAGGAGAATGGGGCTGG - Intronic
1077889800 11:6410884-6410906 GAGGGAGAGGAGAAGGCGGCCGG - Exonic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078375717 11:10791763-10791785 GAGGCTGAGGAGAAGGGCGCCGG - Intergenic
1078670646 11:13362041-13362063 CAGGCAAGAGAGAAGGGGCCTGG + Intronic
1078733041 11:13993257-13993279 AAGGCCGAGGAGAAGGGGGTGGG + Intronic
1078824966 11:14920760-14920782 CAGGCAAAGGAAAAAGGGGAGGG - Intronic
1078845370 11:15114848-15114870 CGGGCGGGGGAGAACGGGGCGGG + Intronic
1081773931 11:45665305-45665327 GAGGCCGAGGAGGAGGGCGCGGG - Exonic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1082009876 11:47442631-47442653 GGGGCAGCGGGGAAGGGGGCAGG - Intronic
1082059538 11:47848494-47848516 AATCCAGAAGAGAAGGGGGCAGG + Intronic
1082798663 11:57397372-57397394 TAAGCAGAGGAGAAGTGGGATGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083270773 11:61571518-61571540 GAAGCAGAGGAGAAGGGGTGTGG - Intronic
1083310385 11:61780804-61780826 GAGCCAGAGGAGAGGGGCGCTGG - Intronic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083571962 11:63765836-63765858 GAGGAGGAGGAGGAGGGGGCCGG - Exonic
1083680440 11:64349292-64349314 CAGGCTCAGGGCAAGGGGGCAGG - Intronic
1083725839 11:64627542-64627564 CTTGCAGAAGAGATGGGGGCTGG - Intronic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083751955 11:64765922-64765944 GAGGCGGAGGAGGAGGGGGCGGG + Intronic
1083763255 11:64830122-64830144 CGGGCAGAGGAGGATGGGGATGG - Intronic
1083828294 11:65215473-65215495 AGGGCAGAGGAGAAGGGAGAGGG - Intergenic
1083929606 11:65833571-65833593 CAGGCAGTGGGGAAGGGGAAGGG - Intronic
1083982716 11:66186471-66186493 GAGGCAGAGGAGAGCGGGGAGGG - Intronic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084190950 11:67498517-67498539 CAGGGAGCGGGGAAGGGGTCAGG - Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084557531 11:69883826-69883848 CAGACACAGGAGCAGGGAGCTGG + Intergenic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085071154 11:73547146-73547168 TAGGCAGAGGAAAAGGCGGGGGG + Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085417703 11:76330247-76330269 CTGGGAGGGGAGGAGGGGGCTGG - Intergenic
1085508704 11:77074500-77074522 CTGGCTGATGAGGAGGGGGCTGG - Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085702242 11:78755647-78755669 CAGGCTGAGGAGCAGAGAGCAGG - Intronic
1086111962 11:83208803-83208825 CAGGCAGTTGAAAAGGGGGCTGG + Intronic
1087822274 11:102725846-102725868 CAGGCAGAAGACAAGGGAGAGGG + Intronic
1087890418 11:103531650-103531672 TCAGCAGAGAAGAAGGGGGCTGG - Intergenic
1088559582 11:111099099-111099121 CAGGAAGAGGAGGCGGGGGAGGG + Intergenic
1088561690 11:111121851-111121873 AAGCCAGAGGACAAGGGAGCTGG + Intergenic
1088573046 11:111241807-111241829 GAGGCAGAGGAGAAATGTGCTGG - Intergenic
1088889041 11:114030440-114030462 CAGAGAGAGGCCAAGGGGGCAGG - Intergenic
1088907745 11:114167647-114167669 CTGGGAGAGCAGGAGGGGGCTGG - Intronic
1088924418 11:114285794-114285816 CAGGAAGAGGTGAAGGGAGCAGG + Intronic
1089258105 11:117204621-117204643 TAAGCAGGGGAGAAGCGGGCTGG + Exonic
1089362864 11:117902493-117902515 CAGGCAGAGAAGGGGAGGGCTGG + Intronic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089657819 11:119964493-119964515 CATGCAGTGGGGAAGGTGGCCGG - Intergenic
1090079510 11:123602587-123602609 GAGGAAGGGGAGAAGGTGGCAGG - Intronic
1090178563 11:124673600-124673622 CAGGCTGAGGGGCAGGGGTCCGG + Intronic
1090484646 11:127102203-127102225 GAGGGAGAGGAGGAGAGGGCAGG - Intergenic
1090703229 11:129314795-129314817 GAGGGAGAGGGGAAGGGGGAAGG - Intergenic
1090817948 11:130314943-130314965 GAAGGGGAGGAGAAGGGGGCGGG + Intergenic
1090819304 11:130326663-130326685 AAGCGAGAGGAGAAGGGGTCCGG - Intergenic
1090976852 11:131686567-131686589 GAGGCAGAAGAGGAGGAGGCAGG + Intronic
1091179338 11:133589305-133589327 CAGGGAGAGGAGATAGGGCCGGG + Intergenic
1202827329 11_KI270721v1_random:94652-94674 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1091635550 12:2194096-2194118 CAGGAGGAGGAGGACGGGGCAGG - Intronic
1091800703 12:3322996-3323018 AAGGCAGAGGAAAAGGGAGAAGG + Intergenic
1091857915 12:3753810-3753832 CAGGCAGAGATGAAAGGGGAGGG - Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092253280 12:6913261-6913283 CAGGCAGAGGAGTTGGTGGGGGG + Intronic
1092256326 12:6928280-6928302 CGAGAAGAGGAGAGGGGGGCGGG + Intronic
1092697253 12:11186572-11186594 CAGCCAGAGGAAAAGGGAGTGGG + Exonic
1092986613 12:13851925-13851947 TAGGCAGAGGAGGAGGAGGGTGG + Intronic
1092991440 12:13905850-13905872 GAGGCTGAGCAGAACGGGGCTGG - Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093417400 12:18935470-18935492 CAAGCAGAGGAGAAGGCTGCAGG + Intergenic
1093844525 12:23952197-23952219 CAGGAAGAGGAGGAGGCGGGAGG + Intergenic
1094173725 12:27521292-27521314 CAGCCACAGGAGATGGGGGAGGG - Intergenic
1094473182 12:30822457-30822479 CAGGCAGCCGAGAAAGGAGCTGG - Intergenic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1095982641 12:47981842-47981864 CAGGTAGAGGTGAGGGAGGCAGG + Intronic
1096038112 12:48490770-48490792 CAGTCAGAGATGATGGGGGCTGG - Intronic
1096218068 12:49809321-49809343 CAGGCATGGGAGGAAGGGGCTGG + Intronic
1096318077 12:50586343-50586365 CAGGCAGATGACATGGGGCCTGG + Intronic
1096478757 12:51924269-51924291 CAGGCACAGGGGAAGGGGAAAGG - Intergenic
1096482430 12:51951626-51951648 CGGGCGGAGGAGAGGGAGGCGGG + Intergenic
1096630967 12:52926502-52926524 CCGGCAGAGGTGACTGGGGCAGG - Intronic
1096665174 12:53159772-53159794 CAGGGAGAGGGGAAAGGGGCAGG - Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1097176142 12:57144091-57144113 CAGGGAGATGGGAAGGGGACCGG - Intronic
1097282646 12:57854205-57854227 AAAACAGAGGAGGAGGGGGCGGG + Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1098105897 12:67069049-67069071 CAGGCAGAGGAGCAGGAGAGAGG - Intergenic
1098305596 12:69099467-69099489 GAGGCAGAGAAGAAGGGGGCGGG + Intergenic
1098769999 12:74539938-74539960 TAGGCAGTGGAGCAGGGGACAGG - Exonic
1099009252 12:77272167-77272189 CAGGAAGAGGAGTGGGGGCCAGG + Intergenic
1099072549 12:78064112-78064134 ATGGCAGTGGGGAAGGGGGCTGG + Intronic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100282415 12:93130542-93130564 CAGGAAGAGGGAAAGGGGTCAGG - Intergenic
1100614441 12:96220185-96220207 CAGGCAGAGGAGCAGTGGTGGGG - Intronic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101718121 12:107328946-107328968 CAGGGAGAGGGGAAGCCGGCGGG - Intronic
1101904114 12:108812547-108812569 CAGGCGGAGGTCAAGGGGGCAGG + Intronic
1102039839 12:109793875-109793897 CAGGAAGAGAAGAGGAGGGCAGG + Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102255786 12:111414200-111414222 CAGGCAGATGGGAAGGGAGAGGG - Intronic
1102592386 12:113966483-113966505 AATGCAGCGGAGAAGGCGGCAGG + Intergenic
1102675588 12:114656265-114656287 CAGTCAGGGCAGCAGGGGGCTGG - Intergenic
1102808101 12:115799714-115799736 GAGGAAGAGGAGGAGGGGGAGGG + Intergenic
1102919548 12:116781597-116781619 AAGGCAGAGGTGTAGGGGGAGGG - Intronic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103145313 12:118590361-118590383 CACACAGAGGAGAAAGGAGCTGG - Intergenic
1103915099 12:124372133-124372155 AAGGCAGAGAAGAAGGAGGGCGG - Exonic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1103987493 12:124777759-124777781 CAGGCTGAGGTGAAGAGGCCTGG - Exonic
1104120808 12:125797976-125797998 CAGCCAGAGCAGGATGGGGCTGG - Intergenic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104819068 12:131664515-131664537 GAGGCAGAGGAGGAGGAGCCAGG - Intergenic
1104926933 12:132318720-132318742 CAGGCAGACGAGAGGAGGGCAGG - Intronic
1104956021 12:132466204-132466226 GAGGAAGAGGAGGAGGGGGACGG - Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1105583009 13:21718549-21718571 GAAGCAGAGTAGAAAGGGGCTGG + Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106038058 13:26063318-26063340 CAGGCAGAGAAGAAAGAGGTGGG + Intergenic
1106301300 13:28468691-28468713 CAGGAACAAGAGAAGGGGGGAGG - Intronic
1106335271 13:28777974-28777996 GAGGCTCAGGAGAAGGTGGCAGG + Intergenic
1106391462 13:29339037-29339059 GAGGCTCAGGAGAAGGTGGCAGG + Intronic
1106391640 13:29339820-29339842 CTGGGAGCGGAGAAGGGGCCTGG + Intronic
1106466233 13:30016813-30016835 GAGGCAAAGGAGATGGGGGAGGG - Intergenic
1107173719 13:37376213-37376235 CAGGCAGAGAAGAAGGCACCAGG - Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107460205 13:40594613-40594635 AAGGCAGGGGAGAAGGCGTCAGG + Intronic
1108157831 13:47604561-47604583 AAGGCAGAGACAAAGGGGGCAGG + Intergenic
1108454552 13:50599717-50599739 AAGACAGAGGAGAAGTGGGAGGG - Intronic
1110066247 13:71110065-71110087 GAGGCAGAAGAAAAGGGGGCAGG - Intergenic
1110356770 13:74575906-74575928 CAGGCCGTGGAGGAGGGGGGAGG + Intergenic
1110444168 13:75558914-75558936 CAGGAAGTGGAGAAAGGAGCAGG + Intronic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111994441 13:95150490-95150512 CTGGCAGTGGGGAAGGGGGAGGG - Intronic
1112402076 13:99086361-99086383 CAGGCGGAGGCGGAGGCGGCGGG - Intronic
1113472660 13:110557905-110557927 CAGGCTGATGAGAAAGCGGCTGG - Intronic
1114194021 14:20461361-20461383 ACGGCAGAGGCGAAGGGAGCCGG - Exonic
1114735577 14:25040280-25040302 GAGGCAGAGGACAAGGGAGGTGG + Intronic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115098285 14:29666406-29666428 CAGGAAGAGGAGAAGAGAGATGG - Intronic
1115133247 14:30078370-30078392 GAGCCAGAGGAGAAGGGTTCAGG - Intronic
1117166516 14:53039709-53039731 TAGGCAGTGGAGAAGCAGGCAGG + Intronic
1117460247 14:55938277-55938299 CAGACAGAAGGGAAGAGGGCTGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117546499 14:56798120-56798142 CTGGCCGGGGAGAAGGGGCCGGG - Intergenic
1117595846 14:57326449-57326471 CAGGGAGAGGAAAAAGGGGAAGG - Intergenic
1117662475 14:58021700-58021722 CAGCCAGAGGAGAAAGGGCCAGG + Intronic
1117799381 14:59427675-59427697 CAGTCAGAGGATAATAGGGCTGG - Intergenic
1118290406 14:64515893-64515915 CAGGTAGAGGAGTATGCGGCAGG - Intronic
1118459559 14:65976053-65976075 GGGGAAGAGGAGAAGGGGGAAGG + Intronic
1118640004 14:67783238-67783260 AAGGCAGAGGAGGTGAGGGCTGG + Exonic
1118696963 14:68394893-68394915 CAGGCGGGGGTGAGGGGGGCTGG - Intronic
1118735269 14:68696599-68696621 CAGTGAGAGGAGCAGAGGGCTGG - Intronic
1118851508 14:69587234-69587256 CAGCCATTTGAGAAGGGGGCTGG - Intergenic
1118854360 14:69610080-69610102 CAGGGAGGGGACAAGGGGGAAGG - Intergenic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1118982408 14:70727475-70727497 AAGGCAGAGGAAAGGGGGGCCGG + Intronic
1119123022 14:72097573-72097595 GAAGAGGAGGAGAAGGGGGCGGG + Intronic
1119132524 14:72187542-72187564 TAGGCAGAGAAGCAGGGGACAGG + Intronic
1119162110 14:72461250-72461272 CAGGCAGTGGAGAGGGTGGGAGG + Intronic
1119186894 14:72649509-72649531 GATACAGAGAAGAAGGGGGCTGG + Intronic
1119335432 14:73829522-73829544 CAGCCACAGAAGAAAGGGGCGGG - Intergenic
1119777873 14:77259497-77259519 CAGGCAGAGAGGCAGGGGCCAGG - Intergenic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120048280 14:79833966-79833988 CAGGCAGAGGAAAAGAGTTCTGG + Intronic
1120238780 14:81925305-81925327 AAAGCAGAGGAGAATGGGGGTGG - Intergenic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120676945 14:87431586-87431608 CAGGAAGAAAAGAAGGGAGCTGG - Intergenic
1120858037 14:89229879-89229901 CAGGCAGAGGAGAACAGCTCAGG + Intronic
1121144616 14:91573637-91573659 CTGGCAGGGGAGGAGGAGGCTGG + Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121535385 14:94687136-94687158 AGGGAACAGGAGAAGGGGGCTGG + Intergenic
1121592393 14:95125746-95125768 CAGGGAGGGGAGGAGGGGGAGGG + Intronic
1121613387 14:95296225-95296247 AAGACAGAGAGGAAGGGGGCTGG + Intronic
1121616506 14:95317328-95317350 CTGGGAGTGGAGATGGGGGCAGG - Intronic
1121787506 14:96673547-96673569 CAGGCAGGGGAGAAGGGGAGGGG - Intergenic
1121853832 14:97248255-97248277 CAGGCAGAGACAAAGGTGGCCGG + Intergenic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122398350 14:101451178-101451200 CAGGCAGGGGGAAAGGGAGCAGG - Intergenic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1122806515 14:104262774-104262796 AAGGCAGAGCAGCAGGGGACGGG - Intergenic
1122809370 14:104280451-104280473 CAGGGAGCGGAGCAGTGGGCTGG + Intergenic
1122810325 14:104284522-104284544 CAGGCAGGAGGGGAGGGGGCTGG + Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1123079825 14:105686655-105686677 CACGCAGAGGTGAGAGGGGCGGG + Intergenic
1123474996 15:20582915-20582937 CCGGCAGAGGAGGAGCGGGGCGG - Intergenic
1124003609 15:25779484-25779506 CCTGCAGAGGAGACGGGGCCAGG + Intronic
1124159646 15:27256502-27256524 CGGGGAGAAGAGAAGGGGGCTGG + Intronic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125876843 15:43155595-43155617 TAGGCAGAGGAGAAGAGGAGTGG + Intronic
1126112943 15:45186415-45186437 TCTGCTGAGGAGAAGGGGGCAGG + Intronic
1126767024 15:52019551-52019573 CAGGCGGGCGAGCAGGGGGCGGG - Intronic
1127007663 15:54588630-54588652 GAGGAAGAGGGGAAGGGGGTAGG - Intronic
1127298787 15:57632715-57632737 AAGGCAGAGGGGAAGAGGGGAGG - Intronic
1127378448 15:58406775-58406797 CAGGCTGAGGAGATGGGGTGGGG - Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127673441 15:61217459-61217481 GAGGCAGAGGAGGAGGGGAAAGG + Intronic
1127704165 15:61530888-61530910 CAGGCAGAGTTGAGGGGGGGGGG - Intergenic
1127705608 15:61544649-61544671 CAGGTAGAGGAGAAGCATGCAGG + Intergenic
1127775092 15:62258148-62258170 CAGGCAGAGGAGCAGCTGGCTGG + Intergenic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128560925 15:68667221-68667243 CAGGTAGAAGAGACCGGGGCTGG - Intronic
1128567650 15:68711794-68711816 GATGCACTGGAGAAGGGGGCTGG - Intronic
1128646153 15:69380257-69380279 CAGGCACCGGAGCAGGGAGCAGG - Intronic
1128843893 15:70872412-70872434 GAGGGAGAGGAGGAGGGGGAGGG + Intronic
1129116523 15:73368158-73368180 GACGCCGAGGAGGAGGGGGCCGG - Exonic
1129194450 15:73955757-73955779 CTGGCAGAGAAGAAGGGGCAGGG + Intergenic
1129626273 15:77203196-77203218 CAGGCAGAAGAGGAGGTGGAAGG + Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129763793 15:78148234-78148256 CAGGGAGAGGACAAGGGGAAAGG + Intronic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130236403 15:82138690-82138712 CAGGAAGAGGACAAGTGGCCTGG - Exonic
1130258723 15:82337971-82337993 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130269962 15:82441113-82441135 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1130462297 15:84168426-84168448 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130490376 15:84426359-84426381 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130501967 15:84505117-84505139 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130596200 15:85251988-85252010 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1130902099 15:88214966-88214988 CGGGCAGAGGAGTGGGGAGCAGG - Intronic
1132390268 15:101433609-101433631 GAGGAACAAGAGAAGGGGGCGGG + Intronic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1132808268 16:1785774-1785796 GAGGCGGATCAGAAGGGGGCAGG + Intronic
1132860673 16:2070172-2070194 CAGACAGGGCAGAATGGGGCGGG - Intronic
1132882655 16:2169370-2169392 CAGGCAGAGGCCCAGGGGACGGG - Intronic
1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG + Intronic
1133320205 16:4909060-4909082 CAGGCAGAGGCCAGGGAGGCAGG + Intronic
1133392378 16:5420877-5420899 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG + Intergenic
1134095884 16:11418078-11418100 CAGGCAGGGGAGAGTGGGCCTGG + Intronic
1134108231 16:11499132-11499154 GAGGCAGAGGGGAGGGGGGAAGG + Intronic
1134108243 16:11499155-11499177 GAGGCAGAGGGGAGGGGGGAGGG + Intronic
1134108253 16:11499177-11499199 GAGGCAGAGGGGAGGGGGGAAGG + Intronic
1134108264 16:11499200-11499222 GAGGCAGAGGGGAGGGGGGAAGG + Intronic
1134108275 16:11499223-11499245 GAGGCAGAGGGGAGGGGGGAAGG + Intronic
1134108286 16:11499246-11499268 GAGGCAGAGGGGAGGGGGGAAGG + Intronic
1134108297 16:11499269-11499291 GAGGCAGAGGGGAGGGGGGAAGG + Intronic
1134108308 16:11499292-11499314 GAGGCAGAGGGGAGGGGGGAAGG + Intronic
1134122817 16:11596757-11596779 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1134242044 16:12513345-12513367 AAGGCTGAGGAGAAGAGAGCAGG - Intronic
1134332618 16:13264996-13265018 CAGGAAGAGGAGAGGAGGGAAGG - Intergenic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1135184900 16:20307136-20307158 CAGGCAGGGATGAAGGTGGCAGG - Intergenic
1135260894 16:20979699-20979721 GAGGCAGAGAAGGATGGGGCAGG + Intronic
1135677710 16:24431210-24431232 CACCCAGAGGAGCTGGGGGCTGG - Intergenic
1135866816 16:26110848-26110870 CACGCAGACAAGAAGGAGGCCGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136042405 16:27590713-27590735 CAGGGAGAGGAGAAGGCCCCAGG - Intronic
1136124495 16:28167919-28167941 GGGGGAGAGGAGAATGGGGCGGG + Intronic
1136296872 16:29308891-29308913 CAGGCAGAGGAGACGGGCAGAGG - Intergenic
1136520895 16:30795093-30795115 CAGGGAGAAGTGAAGGGGGCTGG - Intergenic
1136955377 16:34778745-34778767 AAGGCAAATGAGAAGAGGGCAGG + Intergenic
1137017812 16:35394088-35394110 AAGGCAGAGGCCAATGGGGCAGG + Intergenic
1137560089 16:49496931-49496953 CACCCAGAGGGGAAGGGGGAGGG - Intronic
1137566767 16:49538137-49538159 CAGGCAGAGGGGGACTGGGCAGG + Intronic
1137581373 16:49635617-49635639 CAAGGAGAGGAGCAGGGAGCAGG + Intronic
1137812933 16:51370364-51370386 CAGGCAGAGGAGAGGAGGCCAGG - Intergenic
1138239242 16:55413121-55413143 TAGGCAGGAGAGAAGGGAGCTGG - Intronic
1138307094 16:55988435-55988457 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1138433174 16:56982360-56982382 CAGGGAGAGGAAAGGGGGCCAGG - Intronic
1138595250 16:58026169-58026191 AAGCCCGAGGAGAAGCGGGCAGG - Exonic
1139304142 16:65968800-65968822 AAGCCAGAGGGCAAGGGGGCCGG + Intergenic
1139377583 16:66509822-66509844 CAGGCAGAGCTGGTGGGGGCAGG - Exonic
1139424947 16:66873756-66873778 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139424957 16:66873781-66873803 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139429510 16:66903721-66903743 CAGGGATAGGATGAGGGGGCTGG - Intergenic
1139516332 16:67454449-67454471 GAGGCAGAGCAGAAGGGCCCGGG + Intronic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140291467 16:73662839-73662861 CAAGCAAAGGGGAAGTGGGCGGG + Intergenic
1140299057 16:73738786-73738808 CAGCCTGTAGAGAAGGGGGCAGG - Intergenic
1140332244 16:74069540-74069562 CAGGCATAGGAGTATGGGGCAGG + Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1140837820 16:78811665-78811687 TAAGAAGAGGACAAGGGGGCTGG - Intronic
1141027675 16:80563449-80563471 CTGGCAGAGGAGAGGGGGAGAGG - Intergenic
1141619159 16:85227678-85227700 CAGGCAGAGAGGAAGTGGGAGGG + Intergenic
1141625728 16:85260043-85260065 GAGGCAGTGGAGGAGGGGGCTGG + Intergenic
1141630140 16:85283224-85283246 AGGGCAGCGGAGAAGAGGGCAGG - Intergenic
1141855389 16:86677720-86677742 CGGGGAGAGGGGAGGGGGGCAGG - Intergenic
1141955236 16:87366436-87366458 CAGACAGAGGTGAAGAGAGCGGG + Intronic
1141995157 16:87632300-87632322 CAGGCAGAGGAGGGTGGGGGAGG - Intronic
1142024489 16:87805127-87805149 CAGGCAGATGGGCAGGTGGCAGG - Intergenic
1142149439 16:88506178-88506200 AAGGCAGAGGAGACCAGGGCAGG + Intronic
1142177422 16:88651507-88651529 CAGGGGGAGGAAATGGGGGCTGG - Intergenic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1142285893 16:89171423-89171445 GAGCCAGAGGAGGATGGGGCGGG - Intergenic
1142296304 16:89224760-89224782 CAGGAAGAGGAGTTGAGGGCAGG + Intronic
1142363169 16:89636755-89636777 CAGGCAGAGGGGATGGGCTCTGG - Intronic
1142455344 16:90218043-90218065 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
1142455360 16:90218114-90218136 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
1142455377 16:90218185-90218207 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1142455395 16:90218260-90218282 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142863423 17:2776843-2776865 GAGGAGGAGGAGGAGGGGGCTGG + Intergenic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142966572 17:3585586-3585608 GAGGCAGGGGAGATGGGCGCAGG + Intronic
1143112448 17:4560036-4560058 CAGGCAGGAGAGAAGGGGCTGGG + Intronic
1143114376 17:4574035-4574057 CAGGCAGGGGAGACAGGAGCTGG - Intergenic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143527151 17:7479383-7479405 CGGGCAGCGGAGAGGGGGCCTGG + Intronic
1143712751 17:8745294-8745316 CAGGCACAGGAGGAGGGCCCAGG + Intergenic
1144032718 17:11336595-11336617 AAGGCAGATGAGGAGGGGGCAGG + Intronic
1144300104 17:13915504-13915526 GAGGGAGAGGAGAAGAGGCCTGG - Intergenic
1144650199 17:17002447-17002469 CAGGCTGGGGTGCAGGGGGCAGG - Intergenic
1144748488 17:17632059-17632081 GAGGAAGAGGAGAAGAGGGCTGG + Intergenic
1144788842 17:17846466-17846488 CAGGCAGAGCAGCTAGGGGCTGG - Intronic
1144955652 17:19017652-19017674 CAGACAGGGGAGAGTGGGGCAGG - Intronic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145767938 17:27472163-27472185 CAGTCAGGGGAGAAAGGGTCAGG - Intronic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1146127126 17:30238489-30238511 CAGGCAGGGGAGCAGGGCGCGGG - Intergenic
1146257626 17:31400734-31400756 GAGGCAGAGAGGAAGAGGGCTGG + Intronic
1146307783 17:31743912-31743934 CAGGCAGTGGGGATGGGGGTGGG - Intergenic
1146675189 17:34768435-34768457 CATTCAGAGGATAAGGGAGCTGG - Intergenic
1146724961 17:35149037-35149059 CATGCAGAGGAGAATGTGACAGG - Intronic
1146795111 17:35775040-35775062 CAGGCAGAAGAGGGGGTGGCGGG + Intronic
1147134904 17:38428902-38428924 CGGGCAGAGGAAACGGCGGCAGG - Intronic
1147341801 17:39756711-39756733 CAGGCAGAAGAGAGGGAGACAGG - Intergenic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147383860 17:40070705-40070727 CAGGCAGAGGGGAAGGGGAGAGG + Intronic
1147443334 17:40460614-40460636 CAGGTAGAAGGGAAGGGGGCTGG - Intergenic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147459939 17:40561815-40561837 GAGGCAGAGGAGAAGCAGGGAGG + Intronic
1147465758 17:40609410-40609432 TAGGAAGAGGAGATCGGGGCCGG - Intergenic
1147952141 17:44113152-44113174 CAGGCATAGGAGAGTGTGGCAGG + Intronic
1147970743 17:44218362-44218384 CGCCCAGAGTAGAAGGGGGCAGG + Intronic
1147978374 17:44260543-44260565 CAGGCAGTGGAGGAGTGAGCTGG + Intronic
1148029800 17:44611703-44611725 CGGCTGGAGGAGAAGGGGGCTGG + Intergenic
1148071331 17:44910554-44910576 CAGGCCCTGGAGGAGGGGGCAGG + Exonic
1148179647 17:45595043-45595065 GAGGAAGAGGAGAAAGGGGAAGG + Intergenic
1148269257 17:46250858-46250880 GAGGAAGAGGAGAAAGGGGAAGG - Intergenic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148384659 17:47225465-47225487 CTGGCTGAGGAGGAGAGGGCTGG + Intergenic
1148688530 17:49513790-49513812 CAGGCAGTGGGGAAGGGGTGGGG - Exonic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149107105 17:52982651-52982673 AAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1149305681 17:55344542-55344564 CAGGCATAGTAGAAGGGGACAGG - Intergenic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1149992590 17:61391213-61391235 GAGGCAGAGGAGGAGGAGGGCGG + Intronic
1150134974 17:62690550-62690572 CAGGCTGCAGAGAAGAGGGCTGG + Intronic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151344540 17:73493527-73493549 CATGCAGAGGAGCTGGTGGCAGG + Intronic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151456019 17:74226256-74226278 GAGTGAGAAGAGAAGGGGGCTGG + Intronic
1151622397 17:75254208-75254230 CAGCCTGAGGAGAAGGGGAAAGG - Intronic
1151723920 17:75874016-75874038 CTGGCCTGGGAGAAGGGGGCTGG - Intergenic
1151873262 17:76850898-76850920 CAGGCAGAGGGGTTGGGGCCAGG + Intergenic
1151958484 17:77392632-77392654 AAGGCAGAGGGGGAGGGGACTGG + Intronic
1152059779 17:78063381-78063403 CAGGCTGAGGAGGAAGGGGAGGG + Intronic
1152252622 17:79219800-79219822 AAGGCACAGGATAAGGGGGAGGG + Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152697260 17:81803582-81803604 CCTGCAGAGCAGACGGGGGCTGG - Intergenic
1152745053 17:82034686-82034708 CAGGCAGAGGGGCAGGGTGGAGG + Intergenic
1152841550 17:82571998-82572020 GAGGAAGAGGAGTTGGGGGCCGG + Intronic
1152868508 17:82738049-82738071 CAGGCAGGGAAGAAGAGGGCTGG - Intronic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153687181 18:7557988-7558010 AAGGCAGGGGAGAATGGGACTGG - Intergenic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1154218736 18:12434095-12434117 TACGCAGAGCAGAACGGGGCGGG - Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1155170475 18:23263354-23263376 CCTGCAGAGGAGAAGGGATCTGG + Intronic
1155325309 18:24658511-24658533 GATGGAGAGGAGGAGGGGGCTGG + Intergenic
1156436710 18:37138628-37138650 CAAGAAGAGGAGAATGGGGGCGG - Intronic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156894926 18:42235149-42235171 AAGGCAGAGGAGAGGCTGGCTGG - Intergenic
1157310181 18:46546843-46546865 GAGGCAGAGGGGAGGGGTGCTGG + Intronic
1157317119 18:46601522-46601544 CAGGAAGGGGAGGAGGGGGTGGG - Intronic
1157529633 18:48409842-48409864 CCGGCAGAGGCGAGGGGGCCAGG + Intronic
1157579038 18:48762884-48762906 CATGCAGAGGAGAGGGTGGGTGG - Intronic
1157592702 18:48845130-48845152 AAGGAAGAGAAGAAGGGGGTTGG + Intronic
1157709647 18:49841386-49841408 CAGACAGTGAAGAAGGCGGCAGG + Exonic
1157863515 18:51161904-51161926 TGGGCAGGGGAGAATGGGGCAGG + Intergenic
1157884191 18:51350576-51350598 CAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1158525502 18:58209343-58209365 GAGGAGGAGGAGGAGGGGGCAGG - Intronic
1158714562 18:59866544-59866566 GAGGCAGAGGTGATGGGGGGGGG - Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1160074416 18:75658672-75658694 TGGGCAGATGAGAAGGGGACTGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160495516 18:79372186-79372208 GAGGCAGGGGACGAGGGGGCAGG - Intronic
1160495525 18:79372208-79372230 GAGGCAGGGGACGAGGGGGCAGG - Intronic
1160495534 18:79372230-79372252 GAGGCAGGGGACGAGGGGGCAGG - Intronic
1160506651 18:79430952-79430974 CAGGCAGAAGGAAAGGCGGCTGG - Intronic
1160515645 18:79478063-79478085 CAGGCAGGGGGGCAGGGGGCAGG - Intronic
1160773614 19:844496-844518 CAGGCAGGGGAGAGGCGCGCAGG - Intronic
1160774174 19:847641-847663 CAGGCAGCCAGGAAGGGGGCTGG - Intronic
1160804416 19:985735-985757 CAGGAAGAGGAGTCGGGAGCAGG - Intronic
1160819760 19:1052478-1052500 GAGGGAGAGGAGGAGGGGGAGGG + Intronic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1160965606 19:1745842-1745864 GAAGCAGAGGAGAGGGGAGCAGG + Intergenic
1160965660 19:1746003-1746025 GAGGGAGAGGAGGAGGGGGAAGG + Intergenic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161017645 19:1991170-1991192 CAGGCAGAGGTGAGGTGGCCGGG + Intronic
1161267431 19:3370836-3370858 CAGGCAGGAGAGTGGGGGGCGGG - Intronic
1161288153 19:3479241-3479263 CAGGCAGAGGCTCAGGGGGAGGG + Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161458416 19:4381594-4381616 GAGGCAGGGGAGACGGAGGCAGG - Intronic
1161478605 19:4499623-4499645 AAGGCCGAGGAGAAGCTGGCCGG + Exonic
1161587673 19:5114344-5114366 AAGGCAGAGCAGGAGGGGACAGG - Intronic
1161591618 19:5131591-5131613 GGGGCAGGGGAGGAGGGGGCAGG + Intronic
1161610129 19:5237828-5237850 CAGGAAGGAGGGAAGGGGGCCGG + Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161772734 19:6240161-6240183 CAGGCAGGCGTGAAGGGGCCTGG - Intronic
1162091628 19:8284048-8284070 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162093865 19:8298896-8298918 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162187220 19:8915036-8915058 CAGGCAGAAGTGAGGTGGGCAGG + Intronic
1162404892 19:10467677-10467699 GAGGCAGAGGAGGAGGTGGTCGG - Exonic
1162453555 19:10768930-10768952 AAGGCAGGGGAGGAGGGGGCTGG + Intronic
1162753147 19:12841035-12841057 GAGGCAAACGAGAAGTGGGCGGG - Exonic
1162853526 19:13450423-13450445 CAGGCAGGGGTGAGGGGTGCTGG - Intronic
1162947592 19:14053430-14053452 CAGGCAGTGGGCAAGGGGTCTGG + Exonic
1162958402 19:14112479-14112501 CAGGGAGAGCCCAAGGGGGCTGG - Intronic
1162964404 19:14149159-14149181 CAGGCTGGAGAGGAGGGGGCCGG + Exonic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163557475 19:18000976-18000998 CAGGCAGGGGCGGAGGTGGCTGG - Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164617232 19:29674494-29674516 GAGGCGGAGGAGCAGGGCGCGGG + Exonic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164834646 19:31349566-31349588 AGGCCAGAGGAGGAGGGGGCGGG + Intergenic
1164912936 19:32027025-32027047 ATGGCAGAGGAAAACGGGGCAGG - Intergenic
1165094348 19:33402344-33402366 GAAGCAGAGGAGGAGGGGGCTGG + Intronic
1165112985 19:33513005-33513027 GGGGCAGAGGAGCAGGGGGGTGG - Intronic
1165148265 19:33745896-33745918 GAGCCAGAGGTGAAGGGTGCAGG - Intronic
1165312931 19:35039721-35039743 CTGGCAGAGGGGAAGGGGATTGG + Intronic
1165707459 19:37986721-37986743 CAGGAAGAGGGGAAAGGGGAAGG - Intronic
1165843802 19:38805428-38805450 CAGGCAGAGGGGCAGGGGCTGGG - Intronic
1166007554 19:39917752-39917774 CAGGCAGAGGGGTTGGGGCCAGG - Intronic
1166069074 19:40377163-40377185 CAGGCAGAGGGGTCGGGGCCAGG + Intronic
1166072558 19:40395497-40395519 AAGGCAGAGGCTGAGGGGGCTGG - Exonic
1166122328 19:40693129-40693151 CAGGCAGATGAGAATGGAGGTGG - Intronic
1166137795 19:40787672-40787694 CAGGCAGAGGCAGAGGGGTCAGG + Intronic
1166291505 19:41866520-41866542 CAGGCAGTGGCGTAGGGGGTAGG + Intronic
1166536063 19:43575518-43575540 CAGGGAGAGTGGGAGGGGGCGGG + Exonic
1166554087 19:43686596-43686618 CAGGCAGGAGAGAAGGAAGCAGG - Intergenic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1166669986 19:44703983-44704005 GAGACAGAGGGGGAGGGGGCCGG - Intronic
1167078683 19:47264747-47264769 CAGGCAGCAGAGCAGGGGGTTGG - Intronic
1167130489 19:47582171-47582193 GAGGAAGAGGAGGAGGGGGGAGG - Intergenic
1167295580 19:48646944-48646966 GAGGGAGAGGAGGAGGGGGAGGG + Intergenic
1168097991 19:54126345-54126367 CAGGAAGAGGGGATGAGGGCAGG - Intronic
1168121119 19:54253165-54253187 CAGGCTGAGGAGCCTGGGGCAGG - Intronic
1168315495 19:55483173-55483195 CAGCCAGTGGAGCAGGGGGCTGG - Exonic
1168692522 19:58385694-58385716 CAGGGATGGGAGTAGGGGGCAGG + Intergenic
1202712713 1_KI270714v1_random:26629-26651 TAGGGAGAGGCGCAGGGGGCGGG - Intergenic
925174168 2:1770708-1770730 CAGGCAGAGGGGAAGGCTGTGGG + Intergenic
925410130 2:3635085-3635107 CAGGCAGGGGAGAGGGGGACAGG - Intronic
925587192 2:5475545-5475567 GAGGGAGAGGAGAAGGGGCCTGG + Intergenic
926004902 2:9366046-9366068 CAGGCAGAAACCAAGGGGGCAGG - Intronic
926083331 2:10006247-10006269 CAGTAAGAGGTGAAGCGGGCTGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926198025 2:10775265-10775287 CAGGCGGTGGAGCTGGGGGCGGG + Intronic
926240810 2:11083600-11083622 CAGGCAGAGGAGGTGAGGGTGGG - Intergenic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926685001 2:15691486-15691508 CAGGAAGATGACAAGGGGGACGG - Intronic
927194059 2:20535698-20535720 CCAACACAGGAGAAGGGGGCAGG + Intergenic
927211425 2:20641295-20641317 CAGGCAGAGGGGCAGCAGGCGGG - Intronic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927481830 2:23459977-23459999 CAGGTAGAGGAGAAGCTGGAAGG + Intronic
927486194 2:23489859-23489881 AAGGGAGAGGAGGAGGTGGCTGG + Intronic
927510437 2:23641008-23641030 GAGGAAGGGGAGTAGGGGGCAGG - Intronic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927640293 2:24841498-24841520 CAGGCAGAGGCCATGAGGGCAGG + Intronic
927756989 2:25716635-25716657 CAGGCAGAGGAGAAAGGGCCTGG - Intergenic
927954459 2:27198939-27198961 AGGGCAGAGGTGAAAGGGGCTGG + Intergenic
928076441 2:28269275-28269297 GATGGAGAGGAGAAGGGGGAAGG - Intronic
928096300 2:28407147-28407169 GAGGCAGAAAAGAAGGAGGCTGG - Intronic
928151822 2:28837821-28837843 CAGGGAGAGGAGAAGCTGACTGG + Intronic
928389258 2:30896800-30896822 GAGACAGAGGAGAAGAGGGAGGG - Intergenic
928395839 2:30942721-30942743 CACGCAGAGGAGAAGGGCTGAGG + Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
930022842 2:47011913-47011935 CAGGCAGCGGAGCACAGGGCAGG - Intronic
930088321 2:47514138-47514160 CAGGCAGAGGAGCAGTGTGTGGG - Intronic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931671714 2:64653822-64653844 CAGGCAGCGGAGGAGGAAGCAGG + Exonic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932088128 2:68780598-68780620 AAGGAAGGGGAGAAGGGGGAAGG - Intronic
932457519 2:71858769-71858791 CAGGGAGAGGGGAAGGGCCCAGG - Intergenic
932574440 2:72955016-72955038 CAGCCAGAGGGGCAGAGGGCAGG + Intronic
932757262 2:74417432-74417454 CAGGCAGACGGTAAGGGGGCTGG + Exonic
932993121 2:76812770-76812792 GAGGGAGAGGAGGAGGGGGAGGG - Intronic
933280374 2:80326470-80326492 CAGGGAGAGGCAAGGGGGGCAGG - Intronic
933747936 2:85584446-85584468 CAGGCAGAGAAGCCGGGAGCGGG + Exonic
933978589 2:87531714-87531736 GAGGAAGAGGAGAAGGAAGCAGG + Intergenic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
934678444 2:96265996-96266018 GAGGCAGAGGAGGAGGAAGCCGG - Intergenic
934936004 2:98465896-98465918 CAGCCAGAGAGGAAGGGGGAGGG - Intronic
934986756 2:98893096-98893118 CAGGCACAGCAGCAGGGAGCGGG + Intronic
935043852 2:99461535-99461557 CAGCCAGCTGAGAAGGGGACAGG + Intronic
935064186 2:99633768-99633790 AGGTCAGAGGAGAAGTGGGCAGG - Intronic
936029937 2:109062856-109062878 CGGGTGGAGGTGAAGGGGGCTGG + Intergenic
936089028 2:109489089-109489111 CAGGCAGTGGAGTTGGAGGCTGG + Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936315243 2:111419088-111419110 GAGGAAGAGGAGAAGGAAGCAGG - Intergenic
936561269 2:113541721-113541743 CTGGCAGCGGAGAAGGTGGGCGG + Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937061477 2:118983244-118983266 CAGGCAGAGGACAGGGGTGGAGG - Intronic
937480105 2:122249378-122249400 CAGTCAGAAGAGAAGTGGGTAGG - Intergenic
937877695 2:126837656-126837678 CAGGCAGAGGAAAAGGTGCCAGG + Intergenic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938062343 2:128263240-128263262 CTGGCAGGATAGAAGGGGGCAGG + Intronic
938070006 2:128303303-128303325 CATGCAGAGGAGCTGGGAGCAGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938137165 2:128769048-128769070 TAGGAAGAAGAGAAGGGGGAGGG + Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938339226 2:130524197-130524219 CTAGCTGAGGAGAAGGGAGCAGG - Intronic
938350611 2:130596553-130596575 CTAGCTGAGGAGAAGGGAGCAGG + Intronic
938631090 2:133168534-133168556 CAGGCAAAGCGGAAGGGAGCTGG - Intronic
940011537 2:149060025-149060047 AAGGAGGAGGAGGAGGGGGCAGG + Intronic
940212630 2:151271252-151271274 AAGGAAGAGGAAAAGGGAGCAGG + Intronic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
941038220 2:160590576-160590598 GAGGGAGAGGAGAAGGGGAAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941809240 2:169739003-169739025 GAGGGAGAGGAGATGGGGGAGGG - Intronic
942251837 2:174053882-174053904 CTGGAAGAGAAGTAGGGGGCGGG + Intergenic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
943342160 2:186694199-186694221 CAGGCCGAGAAGCAGGGTGCAGG - Exonic
943593096 2:189822159-189822181 CGGGCAGTGGAGGAGGAGGCGGG + Intronic
944107855 2:196098840-196098862 AAGGCAGAAGAGAGGAGGGCAGG - Intergenic
944661284 2:201923837-201923859 CTGGCACAGGAGCAGGGGACTGG + Intergenic
945147135 2:206750204-206750226 GAGGCAGAGGAGAAGCAGGAAGG - Intronic
945236999 2:207640254-207640276 CAGGAACAAGAGAGGGGGGCAGG - Intergenic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
946148554 2:217748927-217748949 CAGGAAGAGGAGGAGGCAGCAGG - Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946200544 2:218068564-218068586 GGGGCAGAGGAGCAGGGGCCTGG - Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946519089 2:220446627-220446649 AAGGGAGGGGGGAAGGGGGCAGG - Intergenic
946519117 2:220446687-220446709 GAGGGAGGGGAGAAGGGGGGAGG - Intergenic
946716501 2:222559177-222559199 CAGCGAGAGGAGCAGGGGCCGGG - Exonic
947374423 2:229481383-229481405 GAGGCAGAGGACAAGGAGCCAGG + Intronic
947608601 2:231507547-231507569 GAGGAAGAGGAGGAGGGGGAAGG - Intergenic
947762604 2:232614377-232614399 GAGGCAGAGGAGGAAGGGGAGGG - Intronic
947792637 2:232876818-232876840 CAGGCAGAGGAGGCGGCGCCGGG - Intronic
947838485 2:233191759-233191781 GAGGCAGAGGAGAATGCGCCTGG + Intronic
947843148 2:233221759-233221781 CAGGCAGAGGAGATGGGAGAAGG - Intronic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948164739 2:235852273-235852295 GAGGCAGCGGAGAAGGGCCCGGG + Intronic
948237744 2:236403119-236403141 AAGGAAGAGGAGGAGGGGGAGGG + Intronic
948504283 2:238417799-238417821 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504294 2:238417841-238417863 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504316 2:238417925-238417947 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504338 2:238418009-238418031 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504349 2:238418051-238418073 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504360 2:238418093-238418115 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504371 2:238418135-238418157 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504382 2:238418177-238418199 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504392 2:238418219-238418241 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504402 2:238418261-238418283 CACACACAGGAGAAGGGCGCAGG - Intergenic
948523402 2:238556446-238556468 GAGAGAGAGTAGAAGGGGGCAGG + Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948593688 2:239066511-239066533 CTGGAAGAGGTGCAGGGGGCAGG - Intronic
948600712 2:239106163-239106185 CAGGCAGAGGAGCCGAGGGCGGG + Intronic
948603251 2:239119439-239119461 CAGGCTGAGGACATGGGGACAGG + Intronic
948856859 2:240734277-240734299 CAGGGAGAGGGGAGCGGGGCTGG + Intronic
948981018 2:241494839-241494861 CAGGCAGAGGAGAATGCAGGTGG - Exonic
948990732 2:241552596-241552618 GAGACACAGGAGACGGGGGCGGG - Intergenic
949086825 2:242162769-242162791 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086842 2:242162840-242162862 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086859 2:242162911-242162933 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
949086875 2:242162982-242163004 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086894 2:242163057-242163079 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1168995486 20:2129807-2129829 CAAGCAGAGGAGGAGGGAGCCGG + Intronic
1169208142 20:3751456-3751478 GGGGCAGAGGAGAAGGGGCGGGG - Intronic
1169256768 20:4105717-4105739 CGGGCAGAGGCGCAGAGGGCAGG + Intergenic
1169326295 20:4679381-4679403 CAGGCAGAGAAGAGAGAGGCAGG + Intergenic
1169634135 20:7668326-7668348 TAGGCAGAGCAGAAGGGAGACGG + Intergenic
1169790023 20:9400199-9400221 CAGGCACAGGAGGAGGGTGAGGG - Intronic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1170526094 20:17239450-17239472 TAGGCAGAGGAGAAGGGACAGGG + Intronic
1170699991 20:18695405-18695427 GAGGCGGAGGGGGAGGGGGCTGG - Intronic
1170802374 20:19601170-19601192 CAGGTAGAGGAGAAGGCGAATGG - Intronic
1170843052 20:19939591-19939613 ATGGCAGAGGAGAGGGGTGCTGG - Intronic
1171109247 20:22465242-22465264 CTGCCAGAGGAGAAGGAGGTGGG - Intergenic
1171407045 20:24918387-24918409 CCGGCACAGGGGAGGGGGGCGGG + Intergenic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1172008030 20:31830800-31830822 CTGGCTGAGGAGAAAGGGGGTGG - Exonic
1172031551 20:31985433-31985455 CAGGGAGAGGAGGAGCAGGCAGG + Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172393609 20:34583460-34583482 CAGGCAGAAGAGAAGACAGCAGG + Intronic
1172692040 20:36796746-36796768 CAGGAAGAGGGCAAAGGGGCGGG + Intronic
1172843333 20:37915150-37915172 CAGGCAGCGGAGGAGAGGGAGGG + Intronic
1172889781 20:38255889-38255911 AAGGCAGAGGAAAAGGGGAGAGG - Intronic
1172892833 20:38279050-38279072 CAGGCAGAGGGGAAGTGGTCAGG + Intronic
1173465212 20:43275514-43275536 CAGGGAGTGGAGTAGGGGGTGGG - Intergenic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1173643906 20:44621960-44621982 CAGGCATATGAGAAGGGGAGGGG - Intronic
1173750089 20:45469810-45469832 CAGGCTGAGGAGGAGGGCGGCGG - Exonic
1173807993 20:45938745-45938767 CAGGCAGAGAAGAGGGGGAGGGG + Intronic
1173834713 20:46117932-46117954 GAGGCAGCGGAGAGCGGGGCAGG + Intergenic
1173849699 20:46210217-46210239 CGGGCAGAGGGGAGGAGGGCTGG - Intronic
1173929606 20:46807656-46807678 CAGGGGGAGGAGAAGGGAACAGG + Intergenic
1174049739 20:47759288-47759310 GAGGTCGAGGAGAAGTGGGCAGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174501687 20:50989575-50989597 GAGGCAGAGAAGGAGGAGGCTGG + Intergenic
1174571325 20:51503745-51503767 CAGGGAGAGGAGGCTGGGGCAGG + Intronic
1174597183 20:51693383-51693405 TAGGCAGAGGAGAGAGGGCCAGG + Intronic
1174823061 20:53744134-53744156 CAGGCAGGCGGGAAGGGGGAGGG - Intergenic
1175120092 20:56710616-56710638 GAGGTAGAGGGGAAGGGGGAAGG - Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1175891585 20:62318245-62318267 GAGGAAGAGGAGGAGGGGGAGGG + Intronic
1175943561 20:62548764-62548786 CAGGCAGGGTTGAGGGGGGCAGG - Intergenic
1175986429 20:62766182-62766204 CAGGCAGAGGTGGATGTGGCGGG + Intergenic
1176070974 20:63226333-63226355 CAAGCTGAGGAGGAGGGGACCGG + Intergenic
1176072960 20:63236289-63236311 GAGGAAGAGGAGGAGGGCGCCGG + Exonic
1176088193 20:63307490-63307512 CAGGCAGCGGAACTGGGGGCCGG - Exonic
1176090806 20:63317866-63317888 GAGGAAGAGGAGAGGGGGGCGGG - Intronic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176309329 21:5141495-5141517 CACGCAGAGGTGAAGGTGGAGGG - Intronic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177062231 21:16390257-16390279 GAGGCAGAGGACAAGTGGGATGG - Intergenic
1177782854 21:25639383-25639405 CAGGGCGAGGAGCTGGGGGCGGG - Exonic
1177833942 21:26170203-26170225 CAGACAGGGGGGAAGGGGGAAGG - Intronic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1178202970 21:30429174-30429196 CATGCAGAGGAAAAGAGGACTGG + Intergenic
1178236315 21:30845983-30846005 AATCCAGAGGAGAAGGAGGCAGG + Intergenic
1178321611 21:31610323-31610345 TTGGCAGGGGAGAAGGGGGAAGG + Intergenic
1178624181 21:34201931-34201953 CAGGGAGGGGAGTAGAGGGCGGG - Intergenic
1178846683 21:36179963-36179985 CAGGCAGAGGAGAGGGGCAAAGG - Intronic
1178930838 21:36817537-36817559 CAGGCGGAGGAGCAGGGTGAGGG - Intronic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179213835 21:39349316-39349338 CAGACCCAGGCGAAGGGGGCGGG + Intronic
1179434277 21:41349673-41349695 GAGGTAGAGGAGAAGGGGGCTGG + Intronic
1179444276 21:41420484-41420506 CAGGGGGCGGGGAAGGGGGCAGG - Intronic
1179480932 21:41678250-41678272 CAGGCAGGGGAGAAGAAGGTTGG + Intergenic
1179505669 21:41838663-41838685 TAGGCAGAGAAGATGGGGGCGGG - Intronic
1179586192 21:42375481-42375503 CAGGCAGAGGAGCTGGGGCCCGG - Intronic
1179681158 21:43022212-43022234 AAGGCCGAGGAGGAGGAGGCTGG - Intronic
1179831541 21:44000254-44000276 CAGGCATGGGAGAAAGAGGCAGG - Intergenic
1179847733 21:44120538-44120560 CACGCAGAGGTGAAGGTGGAGGG + Intronic
1179887142 21:44319015-44319037 AAGGCAGAGGCGAGGGGGCCGGG + Intronic
1180009489 21:45040261-45040283 CAGGCAGGAGAGAGGGTGGCGGG + Intergenic
1180064259 21:45404983-45405005 CGGGGAGGGGAGAGGGGGGCGGG - Intergenic
1180673010 22:17568067-17568089 AAGGCAGAGGAGAATAGGCCAGG + Intronic
1180845475 22:18978899-18978921 GAAGCAGATGAGAAGCGGGCTGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1180897845 22:19350274-19350296 CAGGCAGCAGTGAATGGGGCAGG - Intronic
1180994691 22:19959670-19959692 CCGCCAGAGGAGAAGAGCGCTGG - Intronic
1181050279 22:20235090-20235112 CGGGCAGAGGAGAAGCGGCAGGG - Intergenic
1181387683 22:22557815-22557837 GGAGCAGAGGAGAAGGGAGCAGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182268084 22:29135049-29135071 CAGGGAGAGAAGAAGGGTGTGGG - Intronic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
1183279818 22:36926040-36926062 CACGCAGCGGGGATGGGGGCAGG - Exonic
1183429597 22:37757674-37757696 AAGGCAGGGGAGCAGCGGGCGGG + Exonic
1183463560 22:37967798-37967820 TAAGCAGAGGGGAAGGGGGTTGG - Exonic
1183492442 22:38123710-38123732 GAAGCAGGGGAGGAGGGGGCAGG + Intronic
1183546659 22:38457760-38457782 CAGGGAGAGGAGGAAGGGGCAGG + Intergenic
1183623009 22:38985789-38985811 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183633014 22:39044918-39044940 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183858640 22:40653250-40653272 AGGGCAGGGGAGAAGGGGGAAGG + Intergenic
1184189553 22:42885743-42885765 CCAGGAGAGGAGAAAGGGGCAGG - Intronic
1184250241 22:43256005-43256027 AAGGCACAGGACAAGGGGACAGG + Intronic
1184291722 22:43500933-43500955 CAGGCAGAGGCCATGGGGGAGGG + Intronic
1184350891 22:43943516-43943538 CAGGCAGAAGGGGAGGGGGCTGG - Intronic
1184409905 22:44320400-44320422 CAGGCCGTGGATCAGGGGGCAGG + Intergenic
1184554685 22:45226824-45226846 CAGGCAGTGGAGGAAAGGGCGGG - Intronic
1184736029 22:46398268-46398290 AAGGCAGAGGGGCAGGTGGCTGG + Intronic
1184991567 22:48173736-48173758 CAGGCAGCGGGGAAGAGAGCTGG - Intergenic
1184993768 22:48187690-48187712 CAAGCACAGGAGGAGCGGGCAGG - Intergenic
1185047173 22:48534360-48534382 CAGGCAGGTGAGATGGGGCCGGG + Intronic
1185362189 22:50414969-50414991 CTGGCAGGGGAAAAGGAGGCAGG - Intronic
1203296104 22_KI270736v1_random:44434-44456 CAGGCAGAGGGGAATGAAGCAGG - Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949551559 3:5116203-5116225 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
949644992 3:6083326-6083348 CAGGCAGAGGAGGAGGGGTGTGG - Intergenic
950151976 3:10694831-10694853 GAGGGAGGGGGGAAGGGGGCAGG - Intronic
950188874 3:10962497-10962519 AAGGGAGAGGAGAAGAGGGTAGG + Intergenic
950404584 3:12796802-12796824 CGGGAAGGAGAGAAGGGGGCCGG - Intronic
950796729 3:15516318-15516340 CAGGCAGGGGAGCACGGGGCTGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950917864 3:16664034-16664056 GACCAAGAGGAGAAGGGGGCGGG + Intronic
951526423 3:23657248-23657270 AAGGCAGAGGAGACTGGGACAGG - Intergenic
952561123 3:34594756-34594778 GAGGCAGAGGAGAGGGAAGCAGG - Intergenic
952849678 3:37717569-37717591 GTGGCAGGAGAGAAGGGGGCTGG + Intronic
953082720 3:39635618-39635640 CACGCAGAGGAGGAGGAAGCAGG + Intergenic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
954076845 3:48187972-48187994 GAGGCAGAGGAAGAGGGAGCGGG - Exonic
954405738 3:50344112-50344134 CGGGCAGAGGATAAGGGTGCAGG - Intronic
954440046 3:50516803-50516825 CAGGCATGGGAAAAGGGGGAAGG - Intergenic
954460955 3:50626628-50626650 CAGGCAGTGGCACAGGGGGCAGG + Intronic
954619715 3:51988634-51988656 GAAGGAGAGGAGTAGGGGGCTGG - Intronic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
954634363 3:52063581-52063603 CAGGACGAGGAGAAGAGGGAGGG - Intergenic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
954790054 3:53125755-53125777 TAGGCTGAGGAGAAGCGTGCAGG - Intronic
955038524 3:55292509-55292531 CTGGAAGAGGACCAGGGGGCTGG - Intergenic
955371050 3:58352235-58352257 GAGGCAGTGGAAAAGGGGGAAGG + Intronic
955945215 3:64187387-64187409 AAGGGAGGGAAGAAGGGGGCAGG - Intronic
955978226 3:64498367-64498389 AAAGCAGAGGAGAATGGGGCAGG - Intergenic
956446637 3:69332211-69332233 CTTGCAGAAGAGAAGGGAGCAGG + Intronic
956737334 3:72247808-72247830 CAGCCAGGAGAGGAGGGGGCAGG - Intergenic
958076680 3:88690199-88690221 CAGGCCGAGTTGGAGGGGGCAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960914601 3:122682668-122682690 GAGGAAGAGGAGTAGTGGGCTGG - Intronic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961209958 3:125118017-125118039 CAGGCAGACGTGGAGGGAGCGGG - Intronic
961236939 3:125375237-125375259 GAGGAAGAGGAGAAAGGCGCAGG - Exonic
961527328 3:127513548-127513570 CAGGCACAGGGGAAAGGGCCAGG + Intergenic
961662225 3:128475484-128475506 AAGGCAGGGAAGAAGGGGCCGGG + Intergenic
964546348 3:157838656-157838678 CAGGCAGCGGCGATGGGGGCTGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966809751 3:183833134-183833156 CAGGCAGGGGAGAGGAGGGCAGG + Intronic
966852755 3:184174877-184174899 CGGGCAGACGAGCAGGGGGCGGG + Exonic
966879393 3:184341452-184341474 CACCCAGAGGAGATGGAGGCAGG - Intronic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967316230 3:188154151-188154173 GAGGCAGAGGAGGAGGTGCCCGG - Intronic
968229260 3:196995670-196995692 CAGGAAGAGAAGGAGGGAGCAGG + Intronic
968603961 4:1522812-1522834 CAGGCAGAGGGGGAGGGGCCAGG - Intergenic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
968755324 4:2412906-2412928 CAGGCAGGGCAGACGGGGGAGGG - Intronic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
968904082 4:3443687-3443709 CAGGCAGGGGACAGGTGGGCAGG + Intronic
969048672 4:4356950-4356972 CAGACAGAGCAGAAAGGCGCAGG - Intronic
969091852 4:4700204-4700226 CAGGTAGAGGAGATGGTGGCTGG + Intergenic
969150156 4:5162463-5162485 GAGTCAGTGGAGAAGGTGGCTGG - Intronic
969483935 4:7461307-7461329 AAGGCAGAGGGGAAGGAGGGCGG - Intronic
969688398 4:8689725-8689747 CAGGCAGAGAGAAAGTGGGCTGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970644079 4:18099188-18099210 GAGGCAGAGGAGGAGGTGGTAGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972634851 4:40874494-40874516 AAGGCACAGGAGGCGGGGGCAGG + Intronic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973836911 4:54819023-54819045 TAGGAAGAGGAGAAGAGGGGAGG - Intergenic
974115800 4:57577933-57577955 CAGGCAAAGGAGCAGGGTTCTGG - Intergenic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976217503 4:82729015-82729037 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
976258618 4:83124813-83124835 CAGGCAGAGGAGAGGAGAGGAGG + Intronic
977295276 4:95202689-95202711 CAGGTGGAGGTGAAGAGGGCAGG + Intronic
977303799 4:95298521-95298543 CAGGCAGAGGGGACAGCGGCTGG - Intronic
977900241 4:102414122-102414144 CAAGCAAAAGAGGAGGGGGCAGG - Intronic
977990980 4:103442304-103442326 GGGGAAGAGGAGAAGGGGGAAGG - Intergenic
978105907 4:104901595-104901617 CAGGCAGAGGAGCAGAGGAGTGG + Intergenic
979192085 4:117874269-117874291 CAGGAAGAGGAGAAGGGAGGAGG - Intergenic
979398147 4:120214471-120214493 TATGCAGGGGAGAAGGGGGATGG + Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981292975 4:143097907-143097929 CACGCAAAGGGGAAGAGGGCAGG - Intergenic
981767054 4:148263027-148263049 CAGGGAGTGGAGATGGTGGCAGG - Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
983000030 4:162402831-162402853 GAAGCAGAGGAGGAAGGGGCAGG - Intergenic
983500815 4:168497391-168497413 AAGGCAGAGATGAAGTGGGCAGG - Intronic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
984217059 4:176926579-176926601 CAGTGAGAGGAAAAGAGGGCCGG + Intergenic
984451678 4:179911330-179911352 GAGTCAGAGGACAAGGGGACAGG - Intergenic
984709635 4:182874316-182874338 CAAGCCGAGCAGAACGGGGCAGG - Intergenic
985278757 4:188266625-188266647 GAGTCAGAGGTGAAGGGGGATGG - Intergenic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985955517 5:3262691-3262713 CAGTCAGAGGAGCTGTGGGCCGG + Intergenic
986387521 5:7249041-7249063 AAGGCAGAGGAGAAGGCGGCTGG + Intergenic
986700621 5:10404732-10404754 GAGGAAGAGGAGGAGGGGTCAGG + Intronic
986721392 5:10563740-10563762 CGGGCAGAGGAGCCGGGCGCGGG - Intergenic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
988449770 5:31330000-31330022 CAGGTAGAGGAGTGTGGGGCAGG + Intergenic
989084902 5:37665891-37665913 GAAGCAGAGGAGAGGGTGGCGGG - Intronic
989145934 5:38250247-38250269 AAGCCAGAGGAGAAGGTGGGTGG - Intergenic
989178413 5:38553058-38553080 CAGGCAGAAGAAGAGTGGGCTGG - Intronic
989724668 5:44574185-44574207 TAGGGAGAGGTGAAGGGGACTGG + Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990786029 5:59420879-59420901 CAGTCAGGGTAGCAGGGGGCAGG + Intronic
991609292 5:68434288-68434310 CAGGCAGAGGGGACGTGGGCGGG + Intergenic
992230056 5:74655021-74655043 CAGGCACAGGAGCAGGGACCAGG + Intronic
992488530 5:77218568-77218590 CAGGCAGAGGGAAGGGGAGCAGG + Intronic
992989974 5:82274271-82274293 AAGGCAGTGGGGAAAGGGGCTGG + Exonic
993386398 5:87267954-87267976 CAGGCAGATGAGAGGGGTGGGGG - Exonic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
994354519 5:98779982-98780004 CATGCAAAGTAGAAGGGGCCTGG + Exonic
994732041 5:103503651-103503673 CAGGAAGAGAAGAAGGGAGTGGG + Intergenic
995061097 5:107812697-107812719 CCGGCAGAAGCGAAGGGGGGTGG - Intergenic
995539274 5:113168778-113168800 CAGGCAGCAGAGAACGGGGCAGG + Intronic
995848780 5:116522773-116522795 AAGACAGAGAACAAGGGGGCAGG - Intronic
996094040 5:119379489-119379511 CAGGCAGGGATGAAGGGGGAAGG + Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997013620 5:129905474-129905496 CAGGCAGGGGTGGCGGGGGCTGG - Exonic
997296684 5:132773063-132773085 GAGGCAGCGGAGGACGGGGCAGG - Intronic
997440707 5:133906948-133906970 AAGGAAGTGGAGAAGAGGGCGGG + Intergenic
997528264 5:134567180-134567202 AAGGAAGAGGTGAAAGGGGCTGG + Intronic
997583109 5:135029373-135029395 CAGGCGGTGGGGAAGGGGGTGGG - Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997903842 5:137794921-137794943 TAAGCAGGGGAGAAGTGGGCTGG - Intergenic
997981123 5:138467860-138467882 CCGGGAGAGGAGAAGGAGGTGGG - Exonic
998216780 5:140243469-140243491 CAATCAGAAGAGATGGGGGCAGG - Exonic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998500404 5:142627657-142627679 CAGGCAGGGGAGCAGGGCCCAGG + Intronic
998548289 5:143050892-143050914 CAGGCAAAGGTGATGGTGGCTGG - Intronic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999319798 5:150606850-150606872 CAGGCTCAGGAGTTGGGGGCAGG - Intronic
999375976 5:151086865-151086887 AAGACAGTGGAGAAGGAGGCTGG + Intronic
999660387 5:153856519-153856541 CAGCCAGAGAAGAAGGGAGGAGG - Intergenic
1001412082 5:171519160-171519182 CAGGCACAGGAGCAGGGGTGTGG + Intergenic
1001777206 5:174337716-174337738 CAGACAGAAGAGAAGGGAACAGG - Intergenic
1002058533 5:176612465-176612487 CAGTCAGTGGAGAAGCGGGGTGG + Intergenic
1002089083 5:176793965-176793987 CAGGCAGCGGAGGTGGTGGCAGG + Intergenic
1002118365 5:176983239-176983261 GAGGGAGAGGAGGAGGGGGAGGG - Intronic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002400554 5:178989409-178989431 CAGACAGGGAAGAAGGGGGAGGG + Intronic
1002433989 5:179220266-179220288 AACGCAGAGGAGGTGGGGGCCGG + Intronic
1002532802 5:179858696-179858718 CCGGAGGAGGAGGAGGGGGCTGG + Intronic
1002661434 5:180793156-180793178 CAGGTAGAGGAAATGGGGGCAGG + Intronic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003154697 6:3581443-3581465 CAGGCAGTGGAGAATGGGATTGG - Intergenic
1003914276 6:10771095-10771117 CAGGCAGAGGGCAAGTGGGCAGG + Intronic
1004017056 6:11741785-11741807 GAGAGAGAGGGGAAGGGGGCAGG - Intronic
1004129771 6:12908612-12908634 AAGGCAGATAAGAATGGGGCAGG + Intronic
1004294125 6:14394796-14394818 AAGGCATGGGAGAAGGGGGGCGG - Intergenic
1004324219 6:14659212-14659234 GCGGAAGAGGAGAAGGGAGCTGG - Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1006247214 6:32747888-32747910 AAGGGGGAGGAGCAGGGGGCTGG - Intergenic
1006299056 6:33184260-33184282 CAGGCAGAGGAATATGGGGAGGG - Intronic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006376998 6:33677156-33677178 CAGGGAGAGGCACAGGGGGCCGG - Intronic
1006391434 6:33761309-33761331 CAGGCAGGAGAGAAGGGGACGGG - Intergenic
1006402507 6:33826051-33826073 AAGGGAGGGGAGGAGGGGGCAGG - Intergenic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1006973505 6:38073116-38073138 GAGGCAGAAGAGAAGGGCACCGG + Intronic
1006981949 6:38154268-38154290 CAGGCAGAGGAGGGGGCGGGGGG - Exonic
1007323133 6:41041354-41041376 AAGGCAGAGGAGGGTGGGGCTGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007564557 6:42839585-42839607 CAGGCAGGGGCAAAGGGGGTGGG - Intronic
1007686485 6:43670151-43670173 CAGGCAGAGGGGAGTTGGGCTGG - Intronic
1007705160 6:43786537-43786559 GAGGAAGAGGGAAAGGGGGCGGG - Intergenic
1007714167 6:43844849-43844871 CAGGCACATGGGGAGGGGGCAGG + Intergenic
1007722208 6:43891707-43891729 CAGGTAGAGGAGCAGGGGAGGGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007927635 6:45663201-45663223 CAGGAAGAGGAGGAGGGAGATGG - Intronic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1009337198 6:62506319-62506341 CAGGCATAAGGGAAAGGGGCTGG + Intergenic
1010462170 6:76126013-76126035 AAGGCAGAGGAAGAGAGGGCAGG + Intergenic
1011406856 6:87024716-87024738 CAGGCAGAGAATAAGGGTGGGGG - Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011673475 6:89707777-89707799 GGAGCAGAGGAGTAGGGGGCTGG + Intronic
1012874545 6:104711153-104711175 CAGGCATATGTGAAGGAGGCAGG - Intergenic
1013089672 6:106888766-106888788 CAGGCAGAGGACAGGAGGACAGG - Intergenic
1014300683 6:119677711-119677733 GGGGCAGAGGAGAAGGGTGGTGG - Intergenic
1014465401 6:121750370-121750392 AAGGAAGAGGAAAATGGGGCAGG + Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1015101697 6:129489302-129489324 GAGGCAGAGGACAAGGGAGAAGG - Intronic
1015196251 6:130527394-130527416 CAGGCTTGGGAGAAGGGGCCAGG - Intergenic
1015519225 6:134114616-134114638 CAGGCTGAGGGCAAGGGAGCTGG + Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017000915 6:149996422-149996444 CCTGCAGAGGAGGAGGGGGCAGG + Intergenic
1017637428 6:156456324-156456346 GAGGAAGGGGAGAAGGGGGAGGG - Intergenic
1018188894 6:161291561-161291583 CAGGCAGTGGGGATTGGGGCAGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018304878 6:162444545-162444567 TAGGAAGAGGAGAAGGAGGGAGG - Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018935377 6:168270794-168270816 CACTCAGAGGAGCCGGGGGCAGG - Intergenic
1018955799 6:168409861-168409883 CAGGCAGTGGAGCAGTGGGAGGG + Intergenic
1019120179 6:169796155-169796177 CAGGCAGAGGAGGATGTGGATGG - Intergenic
1019406218 7:885564-885586 CACGCAGAGGGGCAGAGGGCGGG + Intronic
1019448978 7:1086707-1086729 CAGGCAGAGGACTGGGGTGCTGG - Intronic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020079041 7:5276699-5276721 GAGGCAGAGGGAGAGGGGGCTGG - Intronic
1020212796 7:6168441-6168463 GAGGCAGACGAGATGGGTGCAGG - Intronic
1020213577 7:6172320-6172342 CTGGCGGAGAAGAAGGGGCCTGG - Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1022008994 7:26292418-26292440 CAGGCCGGGTAGAAGGGGGTGGG + Intronic
1022015748 7:26346936-26346958 CAGGGAGAGGCTCAGGGGGCGGG - Intronic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022715211 7:32892097-32892119 CCGGCAGAGGAAAAGGGCGGGGG - Intronic
1023608829 7:41954401-41954423 CCTGGAGAGGGGAAGGGGGCTGG + Intergenic
1023745265 7:43317227-43317249 CAGGCAGTGGGGGTGGGGGCAGG + Intronic
1023968661 7:44976642-44976664 CCGGCAGGGGAGAGTGGGGCAGG - Exonic
1024196418 7:47063872-47063894 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1024800101 7:53067238-53067260 GATGCAGGGGAGCAGGGGGCAGG + Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1025110379 7:56211501-56211523 CAGGGAGAGGTGAGGGGAGCAGG + Intergenic
1025263376 7:57437663-57437685 CAGGCAGAGCACAACGGTGCAGG - Intergenic
1025635873 7:63318460-63318482 CAGGCAGAGCACAATGGTGCAGG + Intergenic
1025646823 7:63429720-63429742 CAGGCAGAGCACAATGGTGCAGG - Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1026578521 7:71594650-71594672 CAGGCAGAAGGGGAGGAGGCAGG + Intronic
1026631244 7:72039904-72039926 CAAGCAGAGCAGGAGAGGGCTGG - Intronic
1026662809 7:72317141-72317163 AAGGCAGGGAAGAAGGGAGCAGG + Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027250418 7:76395333-76395355 AGGGCAGGAGAGAAGGGGGCAGG + Intronic
1028715645 7:93964275-93964297 CAGGCACTGTAGAAGGGGGAAGG - Intronic
1029058122 7:97768081-97768103 CAGGCAGAGGAGGTGGTAGCTGG + Intergenic
1029116241 7:98238791-98238813 CAGGCACAGGAGATGCGGTCAGG - Intronic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029463518 7:100710672-100710694 CAGGCAGAAAAGAAGGGAGATGG + Intergenic
1029635044 7:101777961-101777983 CAGGAAGAGGAAGAGGGTGCCGG + Intergenic
1029657602 7:101937219-101937241 CAGGGGGAGGAGCTGGGGGCTGG - Intronic
1030614941 7:111729261-111729283 CAGATAGAGGAGAAAGGAGCTGG + Intronic
1030616858 7:111746295-111746317 CAGGCAAAATAGAAGGGGGTTGG + Intronic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1031543367 7:123023322-123023344 CAGATAGAGGAGATGGGGGTTGG + Intergenic
1031955396 7:127937446-127937468 GAGGGAGAGGAGAAGGGAGAAGG - Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032173544 7:129605812-129605834 CAGATAGAGGGGAAGCGGGCGGG - Intergenic
1032432325 7:131872146-131872168 AAGGCAGGGGAGATGGGGGAGGG - Intergenic
1032475607 7:132209536-132209558 CAGCCAGGGGAGGAGGGGGATGG + Intronic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032523366 7:132562349-132562371 GAGGCAGAGGAGGAGGAGGAAGG - Intronic
1032530440 7:132615401-132615423 CTGGCGGAGGGGACGGGGGCTGG + Intronic
1033138583 7:138804822-138804844 CTTGCAGAGGAGGAGAGGGCAGG + Exonic
1033308157 7:140239766-140239788 GAGGGAGAGAAGGAGGGGGCGGG + Intergenic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034345956 7:150385174-150385196 CGAGCAGTGGGGAAGGGGGCGGG - Intronic
1034488127 7:151379010-151379032 CAGGCGGTAGAGGAGGGGGCAGG + Intronic
1035038406 7:155910218-155910240 CAGGCAGAGGAGGAGGAGCAAGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035280779 7:157776696-157776718 GAGGCGGAGGAGAGGGAGGCAGG - Intronic
1035497832 8:68283-68305 AGGTCAGAGGAGATGGGGGCTGG - Intergenic
1035497850 8:68358-68380 AGGTCAGAGGAGATGGGGGCTGG - Intergenic
1035497867 8:68429-68451 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
1035497884 8:68500-68522 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
1035579761 8:732106-732128 CAGGGAGACAAGAAGGGGTCTGG - Intronic
1035793182 8:2326222-2326244 CAGGGAGAGGAGGTGGGGTCGGG + Intergenic
1035799622 8:2395483-2395505 CAGGGAGAGGAGGTGGGGTCGGG - Intergenic
1036017567 8:4802243-4802265 CAGGCAGAGGAAAAGGGAAAAGG - Intronic
1036125396 8:6057484-6057506 CAGGCAGAGCAGGGCGGGGCTGG - Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1037451982 8:19024698-19024720 CAGGAAGGGGAGAGGGGGTCTGG + Intronic
1037730375 8:21518963-21518985 GAGGCAGAGGAAGATGGGGCAGG - Intergenic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1037946318 8:22991710-22991732 AAGGCAGAGGGTAAGGGGGATGG + Intronic
1038522442 8:28244721-28244743 CAGGAAGAGGAGGAGGGGAGGGG + Intergenic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1039184306 8:34899702-34899724 AAGGTTGAGGAGAAGGTGGCTGG - Intergenic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039434049 8:37547471-37547493 CAGGCAGAGGGGCAGGGGAGTGG - Intergenic
1040079752 8:43274856-43274878 GAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1040370143 8:46762310-46762332 CAGGCAGAGGAGGTGGTAGCTGG - Intergenic
1041063326 8:54057659-54057681 CTGGAAGGGTAGAAGGGGGCTGG + Intronic
1041145571 8:54872767-54872789 CAGGGTGGGGAGAAAGGGGCAGG - Intergenic
1041170884 8:55141253-55141275 GAGGCAGAGGAGGAGGGAGGCGG - Intronic
1041262675 8:56035462-56035484 CAGGCAGAGGTGCGTGGGGCAGG + Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1042642426 8:70951121-70951143 CAGGCTCAGGAGAAAGGGCCTGG + Intergenic
1043780774 8:84332445-84332467 AAGACAGAGGACAAAGGGGCAGG + Intronic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1045089625 8:98728067-98728089 CTAGGAGAGGAGGAGGGGGCAGG - Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045491282 8:102671278-102671300 GTGGGAGAGGAGAAGTGGGCTGG - Intergenic
1046859916 8:119079096-119079118 AAGGAAGAGGACAAGGGGGAAGG - Intronic
1047227880 8:122971835-122971857 TAGGTAGAGGAAATGGGGGCAGG - Intronic
1047336817 8:123943814-123943836 CAGACAGAGGGCAAAGGGGCTGG + Intronic
1047522989 8:125609790-125609812 CATGCAGAGGGCAAGGGGGAAGG + Intergenic
1047537683 8:125734488-125734510 CAGGAAGAGGGGAAGGGAGAGGG - Intergenic
1047906686 8:129480260-129480282 GTGACAGAGGAGAAGGGGGAGGG - Intergenic
1049095808 8:140547439-140547461 CAGGCGGAGGTAAAGGGGCCGGG + Intronic
1049194754 8:141308828-141308850 CGGGCAGGGGCGGAGGGGGCGGG - Intergenic
1049226209 8:141451728-141451750 CAGGCAGAGGTGGAGCTGGCAGG + Intergenic
1049284889 8:141769227-141769249 CAGGCAGAGGCGAGGTTGGCAGG + Intergenic
1049303561 8:141884714-141884736 GAGGCAGAGAAGAGGTGGGCGGG - Intergenic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049683271 8:143929253-143929275 CAGGCAGAGGTGGAGGGGCTGGG - Exonic
1049820367 8:144629763-144629785 CAGGAAGAGGAGGAGGGCGCTGG + Intergenic
1049854248 8:144851626-144851648 TTGGCAGAGAAGTAGGGGGCAGG + Intronic
1049891423 9:73618-73640 CTGGCAGCGGAGAAGGTGGGCGG - Intergenic
1050293395 9:4180187-4180209 CAAGGAGAGGAGATGGGGACTGG + Intronic
1051017611 9:12499596-12499618 AAAGCAGAGGAGAAGGAGGCAGG + Intergenic
1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG + Intergenic
1051738152 9:20224680-20224702 AAGGCAGAGAAGAAGAGGGAGGG + Intergenic
1052834379 9:33239808-33239830 CAGGAGGCAGAGAAGGGGGCTGG - Intronic
1052916596 9:33928026-33928048 GAGGCAGAGGAGGAGGGTGCTGG + Intronic
1052996021 9:34552018-34552040 CCTGCAGAGGAGCAGGAGGCCGG - Exonic
1053044023 9:34898915-34898937 GAGGCAGAGGAGCAAGGGCCAGG - Intergenic
1053069837 9:35094812-35094834 GAGACAGAGGAGAAGGGATCTGG - Intronic
1053114424 9:35489445-35489467 CAGCCAGAGGGGGATGGGGCAGG - Intergenic
1053263860 9:36696078-36696100 CAGGGACAGGAGAAGGGGTGAGG - Intergenic
1053399397 9:37804478-37804500 AAGACAGAGGAAAAAGGGGCCGG + Intronic
1053411902 9:37921221-37921243 GAGGCCGTGGAGATGGGGGCAGG - Intronic
1053467125 9:38316701-38316723 CTGTCAGAGGATAAGGAGGCAGG + Intergenic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1053732845 9:41074692-41074714 CTGGCAGCGGAGAAGGTGGGCGG - Intergenic
1053754652 9:41293299-41293321 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054260173 9:62857603-62857625 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054695584 9:68356862-68356884 CTGGCAGCGGAGAAGGTGGGTGG + Intronic
1055372606 9:75616492-75616514 CAGGCAGTAGAGAAGGGGCTTGG + Intergenic
1055492032 9:76815136-76815158 CAGGTAGAGAAGATTGGGGCGGG - Intronic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056548628 9:87633921-87633943 GGAGAAGAGGAGAAGGGGGCAGG + Intronic
1056581467 9:87890111-87890133 GAGGCTGAGGACAAGGGGACAGG + Intergenic
1056586572 9:87931329-87931351 CAGGAAGAAGAGAAGAGAGCAGG + Intergenic
1056751326 9:89353522-89353544 GAGGCACAGGTGAAGAGGGCTGG - Intronic
1057181525 9:93033294-93033316 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181534 9:93033317-93033339 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181543 9:93033340-93033362 GAGGAAGAGGAGAAGGGGACGGG - Intronic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1058102542 9:100933264-100933286 CGGGGAGGGAAGAAGGGGGCAGG - Intergenic
1058723933 9:107784367-107784389 CAGGCAGTGGGGTGGGGGGCGGG + Intergenic
1058868551 9:109183249-109183271 CAGGCAGGGTACAAGGCGGCTGG + Intronic
1059217965 9:112584178-112584200 CACCCAGAAAAGAAGGGGGCAGG - Intronic
1059228521 9:112695766-112695788 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1059300669 9:113310393-113310415 AAGGCTGAGGGGAAGGGGGCAGG - Intergenic
1059336893 9:113574765-113574787 CAGGCAGAAAAGCAGGGTGCCGG + Intronic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059766187 9:117386041-117386063 CTGGCAGTGGAGAAAGGGACAGG - Intronic
1059798922 9:117730040-117730062 TAGCCAGAGGACAAGGGGACAGG + Intergenic
1060168751 9:121443194-121443216 CAGGCAGAGGAGTAGGTGGAAGG - Intergenic
1060180287 9:121529016-121529038 CAGGCAGAGAGGAAGGGTGGAGG + Intergenic
1060205771 9:121682040-121682062 CAGGCAGAGGACAAGGTGTTTGG + Intronic
1060390887 9:123275743-123275765 CAGGCACTGGGGAAGGGAGCTGG - Intergenic
1060397526 9:123326596-123326618 CAGGGAGAGGAGAGGTGGGGAGG - Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060484662 9:124039572-124039594 AAGGCAGGGGAGGAGGAGGCAGG + Intergenic
1060724116 9:125996023-125996045 CAGGCAGCAGTGAAGGGGCCAGG - Intergenic
1060813088 9:126620882-126620904 CAGCCAATGGAGAAGGGGGTAGG + Intronic
1061185271 9:129049297-129049319 CAGGCAGTGGAGGAGGGCTCAGG + Intronic
1061204125 9:129153192-129153214 CAAGCAGAGGAGCAGTGGGCTGG + Intergenic
1061261223 9:129482162-129482184 CTGGGAGGGGAGAGGGGGGCGGG - Intergenic
1061360420 9:130138454-130138476 AGGGCAGAGGAGGAGGGGGAGGG - Exonic
1061368228 9:130183427-130183449 CTGGCAGGGGAGCAGGGGGAGGG + Intronic
1061418115 9:130459002-130459024 CAGGAAGGGGAGAAGGGCCCTGG - Intronic
1061423254 9:130483708-130483730 CAGGCAGAGGTGAGACGGGCAGG - Intronic
1061504770 9:131025565-131025587 CAGGCAAAGGAGAGGAGAGCAGG + Intronic
1061507196 9:131038101-131038123 CAGGCAGAGGAAGAGGGGGCGGG - Intronic
1061520285 9:131113747-131113769 CAGGCAGAGGGGCAGCGAGCTGG + Intronic
1061664095 9:132150287-132150309 CAGGCTGTTGAGAAGGTGGCAGG - Intergenic
1061934966 9:133852388-133852410 AAGGCAGAGCAGAAGGGTGGGGG + Intronic
1062153595 9:135033936-135033958 CAGGCAGGGGACAGGGTGGCTGG - Intergenic
1062449137 9:136608255-136608277 GAAGGAGAGGAGAAGGGGGAAGG + Intergenic
1062460566 9:136660991-136661013 CAGGTGGGGGAGGAGGGGGCAGG + Intronic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1062562708 9:137148862-137148884 CAGGCGGAGGCGCAGGTGGCAGG + Intronic
1062670487 9:137706002-137706024 CAGGCAGAAGTGAAGGGTCCAGG - Intronic
1202798964 9_KI270719v1_random:155316-155338 CAGACAGTGAAGAAGGTGGCAGG + Intergenic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1185459506 X:328272-328294 CGGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1186269185 X:7866466-7866488 AAGGGAGAGAGGAAGGGGGCAGG - Intergenic
1186410686 X:9342509-9342531 AAAGCAGAGGAGGAGGGGGAAGG - Intergenic
1186463334 X:9765569-9765591 CAGGCAGCCGAGAAGGTCGCAGG + Exonic
1186604559 X:11076949-11076971 CAGGAAGAGTAGATGGGGGTGGG - Intergenic
1187219279 X:17308153-17308175 CGGCCAGAGGAGCAGGGGGTGGG - Intergenic
1187270329 X:17774959-17774981 AAGACAGAAGAGAAGGGGGGTGG - Intergenic
1188156589 X:26749044-26749066 CAGGTGGAGGGCAAGGGGGCTGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1190291772 X:48997735-48997757 CAGGGAGAAGAGGAGGGGTCAGG + Intronic
1190333872 X:49251262-49251284 GAGGCAGAGGTGGTGGGGGCAGG - Exonic
1190354289 X:49589940-49589962 CAGGCGGTGAAGAAGGGGCCTGG + Intronic
1190712084 X:53078579-53078601 CAGGAAGAAGAGTTGGGGGCTGG - Exonic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1190912926 X:54788802-54788824 CTGGGAGAGGAGCATGGGGCAGG - Intronic
1191836655 X:65470386-65470408 AAGGGAGAGGAGATGGGGGCTGG + Intronic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1191846213 X:65549977-65549999 CAGACACAGGAGGAGAGGGCAGG + Intergenic
1192260630 X:69504331-69504353 CACGGAGAGGAGGAGGGAGCGGG - Intergenic
1193331983 X:80245115-80245137 AAGGCAGAGGACAAGAGAGCAGG - Intergenic
1193369445 X:80676942-80676964 GAGGCAGAGGAAGAGGAGGCAGG - Exonic
1194012544 X:88580848-88580870 GAGGGAGAGGGTAAGGGGGCTGG + Intergenic
1194121906 X:89972841-89972863 GGGGTGGAGGAGAAGGGGGCAGG - Intergenic
1195283240 X:103357281-103357303 CAGGCAGAGGAAGAGGGGAAAGG - Intronic
1197209169 X:123815257-123815279 CAGGCAGAAGAGAGGGAGGGAGG - Intergenic
1200136193 X:153875887-153875909 CGGCCGGAGGGGAAGGGGGCTGG + Exonic
1200238903 X:154483471-154483493 CAGGTAGTGGAGGAGAGGGCTGG - Intergenic
1200397249 X:155998470-155998492 CAGGAAGAGAAAATGGGGGCAGG - Intronic
1200754115 Y:6973790-6973812 GGGGCAGAGGAGGAGAGGGCAGG - Intronic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1202196957 Y:22306775-22306797 CAGGCACAGAAGAAGTGGGGAGG + Intergenic