ID: 1172392998

View in Genome Browser
Species Human (GRCh38)
Location 20:34578977-34578999
Sequence CTGAGGCTCTGAAGGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 1, 2: 3, 3: 78, 4: 596}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172392998_1172393007 27 Left 1172392998 20:34578977-34578999 CCACTTTCCCTTCAGAGCCTCAG 0: 1
1: 1
2: 3
3: 78
4: 596
Right 1172393007 20:34579027-34579049 AAATCCAGTCCAATCAGAAGGGG 0: 1
1: 0
2: 2
3: 8
4: 182
1172392998_1172393006 26 Left 1172392998 20:34578977-34578999 CCACTTTCCCTTCAGAGCCTCAG 0: 1
1: 1
2: 3
3: 78
4: 596
Right 1172393006 20:34579026-34579048 AAAATCCAGTCCAATCAGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 236
1172392998_1172393005 25 Left 1172392998 20:34578977-34578999 CCACTTTCCCTTCAGAGCCTCAG 0: 1
1: 1
2: 3
3: 78
4: 596
Right 1172393005 20:34579025-34579047 AAAAATCCAGTCCAATCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172392998 Original CRISPR CTGAGGCTCTGAAGGGAAAG TGG (reversed) Intronic
900055832 1:629966-629988 CTGGGACTCAGAAGTGAAAGGGG - Intergenic
900118368 1:1038223-1038245 CTGAGGCCCTGGAGGCAGAGGGG + Intronic
901795640 1:11677751-11677773 CTTAGCCTCTTGAGGGAAAGTGG - Intronic
901959077 1:12810323-12810345 CTGAGACTCTGAAAGGACTGGGG - Intergenic
902570473 1:17343832-17343854 CTGAGACTAGGAAGGAAAAGAGG - Intronic
902737294 1:18409526-18409548 AACAGGATCTGAAGGGAAAGAGG - Intergenic
902860024 1:19238567-19238589 CTGAGGCCCAGAGGAGAAAGTGG + Intronic
902922546 1:19675429-19675451 CTGAGGCTCAGAAAGGGTAGAGG - Intronic
903571377 1:24308123-24308145 CTGAGGTTCTGAAGTAACAGGGG + Intergenic
903649127 1:24912398-24912420 CTGAGGCTCTGAAGAGTGGGGGG - Intronic
903996311 1:27307315-27307337 CTGCTGCTCTGAGGGGAGAGGGG + Exonic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904452997 1:30628507-30628529 CTGAGGCTCAGAGAGGAAAAAGG - Intergenic
904612495 1:31733136-31733158 GTGAGGCCCTGAGGGGACAGTGG + Exonic
904616235 1:31751408-31751430 CTGAGGTTATGAAAGGGAAGAGG - Intronic
904691435 1:32296090-32296112 AGGAGGCTCTTTAGGGAAAGGGG + Intronic
905182420 1:36175459-36175481 CTGGGGCTCTGAAGACAGAGAGG - Intronic
905348835 1:37330481-37330503 CTGAAGCTCAGAGGGGAAGGAGG + Intergenic
905371732 1:37486100-37486122 CTGAGGCTCTGAGAGGGAAGTGG - Intergenic
905401510 1:37706963-37706985 CGCAGGCTCTGAATAGAAAGGGG - Exonic
905477852 1:38241588-38241610 CTGCAGCTAGGAAGGGAAAGGGG - Intergenic
905562806 1:38940922-38940944 CTGAGGCTCAGGAGGTAAACAGG + Intronic
905869056 1:41392519-41392541 CTGAGGCTCAGAGGGGGAAGTGG + Intergenic
905909925 1:41646698-41646720 CTGAGGCCATGATGGGGAAGAGG - Intronic
905928346 1:41768147-41768169 CTGAGACTCGGAAGAAAAAGAGG + Intronic
905988037 1:42305703-42305725 CAGAGGCTGGGAAGGGTAAGCGG + Intronic
906009570 1:42510942-42510964 CTGAGACTTTGAAGAAAAAGTGG - Intronic
906533239 1:46535798-46535820 CTGAGGCTCAGAGAGGGAAGTGG + Intergenic
906660545 1:47578473-47578495 CTGAGGCTGTGGAGGGCTAGGGG - Intergenic
906711150 1:47930809-47930831 CTGAGGCCCAGAAAGGAAAAGGG + Intronic
906916541 1:50017280-50017302 CTGGGACTCAGAAGTGAAAGGGG - Intronic
907248651 1:53123483-53123505 GTGGGGCTCAGAAGGGAATGAGG + Intronic
907272244 1:53297969-53297991 CTGAGGCCCAGAATGGGAAGGGG - Intronic
907328407 1:53655921-53655943 CTGAGGCTCTGGGAGTAAAGTGG + Intronic
907517213 1:55000402-55000424 CTGAGGCTCAGAGAGGAAAGGGG - Intronic
907707910 1:56848514-56848536 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
908383656 1:63619986-63620008 TTGAGGCTCAGAAGGACAAGGGG + Intronic
908404228 1:63798263-63798285 TTGACGCTCTGCAGGGAAATTGG + Intronic
908501578 1:64748261-64748283 CTGAGGCTGTGAAAACAAAGAGG - Intronic
908596563 1:65694520-65694542 CTGAGTCACTGAAAGTAAAGAGG - Intergenic
908788617 1:67758876-67758898 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
908951111 1:69564415-69564437 CTGAGGTTCTGAATAGAAAATGG - Intergenic
909346378 1:74592376-74592398 ATAAGACTCTGAAGGGAAAGGGG - Intronic
909502756 1:76353861-76353883 CTGGGGTTCTGAAGGTAAAGGGG - Intronic
909956662 1:81787176-81787198 CTGAGACTGGGAAGGAAAAGAGG - Intronic
910678193 1:89835963-89835985 AAAAGGCTCTGAAAGGAAAGAGG - Intronic
911102454 1:94105408-94105430 CTGTGGCTCTGGGGGGGAAGGGG + Intronic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913372971 1:118121145-118121167 GAAAGGCTCTGAAGGGAAAATGG + Intronic
914424510 1:147562712-147562734 ATGATGCTCTTAAGAGAAAGTGG + Intronic
915170221 1:153972531-153972553 CTGAGGCCAAGAAGGGAGAGAGG - Intronic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915322471 1:155063280-155063302 CTAAGGCTCTTTAGGGAAGGTGG + Intergenic
915563936 1:156703604-156703626 CTTTGGCACTGAGGGGAAAGAGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916065361 1:161132162-161132184 CTGAGGGTGTGAAGGGGAAGGGG - Intronic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
916400205 1:164439470-164439492 ATGAGGCACTGGAGTGAAAGTGG - Intergenic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
916897566 1:169181430-169181452 CTTTGGCACTGAATGGAAAGGGG - Intronic
918148164 1:181776086-181776108 TTGAGCATCTGAAGGGCAAGGGG - Exonic
918223339 1:182456017-182456039 ATGAGGGTCTAAAGGGAAAGGGG + Intronic
918693856 1:187517543-187517565 ATGAGGTTGTGAAGGGAAAATGG - Intergenic
919022346 1:192123323-192123345 CTAGGGCACTGAAGAGAAAGAGG + Intergenic
919034501 1:192289276-192289298 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
920147136 1:203871838-203871860 ATCAGGCTCTGAAAGAAAAGTGG + Intergenic
920496313 1:206457394-206457416 CAGATGCTCTGAAGGTACAGAGG + Intronic
920520523 1:206621446-206621468 CTCAGCCCCAGAAGGGAAAGTGG + Intergenic
922180206 1:223227482-223227504 TTGAAGCTCTAAAGGGAAACAGG - Intronic
922299732 1:224287254-224287276 CAGAGGCTGGGAAGGGAAGGTGG + Intronic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
922523760 1:226281260-226281282 CAGAGGCTGGGAAGGGAAAAGGG + Intronic
922704777 1:227784250-227784272 CAGAGGCTGGGAAGGGTAAGTGG - Intergenic
923121471 1:230996267-230996289 CTGGGGCTCTGAGGGTTAAGTGG + Intronic
924029730 1:239874082-239874104 CTGAGGCTCAGGAGGACAAGTGG + Intronic
1062958659 10:1557090-1557112 CTGAGGCAATGGAAGGAAAGAGG - Intronic
1063353023 10:5373842-5373864 CTGAGGCTGAGAAGGGCCAGTGG + Exonic
1063550691 10:7029966-7029988 CTGAGGCTGGGAAGAAAAAGAGG - Intergenic
1064461624 10:15540293-15540315 CAGAGGCTGGGAAGGGAAGGTGG - Intronic
1064509520 10:16074527-16074549 CTGGGGCTCTGAAGAGGAAGAGG - Intergenic
1064542866 10:16423005-16423027 CTGAGGTTCTGAAGGTTCAGTGG + Intergenic
1064854298 10:19748144-19748166 CTGAGACTCAGAAGTGAAAGGGG - Intronic
1065168723 10:23006982-23007004 GTGAGTCTCTGCAGGGAGAGGGG + Intronic
1065178689 10:23103886-23103908 CTGGGGCACAGAAGTGAAAGAGG - Intronic
1065445037 10:25789312-25789334 CTGAGGCAATGAATGGTAAGGGG + Intergenic
1065897285 10:30175134-30175156 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1068218228 10:54010447-54010469 CTCAGGCTCAGGAGGGAATGTGG + Intronic
1068510797 10:57963487-57963509 CTGAGGCTGGGAAGAAAAAGAGG + Intergenic
1069556040 10:69399181-69399203 CAGAGGCTCTGTTGGGTAAGTGG + Intronic
1069739727 10:70679686-70679708 CAGAGGCACTGAAGGCAAAGGGG - Intronic
1070313221 10:75288614-75288636 CTGGGGCTCTGCAGGCCAAGTGG - Intergenic
1070533178 10:77355244-77355266 CTGAGACTGTGAAGAAAAAGAGG - Intronic
1071511837 10:86266933-86266955 CAGAGGCTCTGTGGGGATAGGGG - Intronic
1072049432 10:91688696-91688718 ATGAGGCTGTGGAGAGAAAGGGG + Intergenic
1072462895 10:95636641-95636663 ATTAAGCTTTGAAGGGAAAGAGG - Intronic
1074030224 10:109679857-109679879 ATGAGGCAGTGAATGGAAAGTGG - Intergenic
1074481012 10:113820695-113820717 CTAGGGGTCTGAAGGGACAGTGG + Intergenic
1074854884 10:117466228-117466250 CTGACCCTCTCAAGAGAAAGAGG + Intergenic
1075687151 10:124372126-124372148 CTGAGACTGGGAAAGGAAAGAGG - Intergenic
1076977332 11:184206-184228 TTCAGGCTATGATGGGAAAGAGG + Intronic
1077637078 11:3850304-3850326 CTGAGGCTCAGGAGATAAAGTGG - Intergenic
1077796568 11:5498642-5498664 CTGTAACTCTGAAGGGAATGAGG - Intronic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1079298070 11:19252563-19252585 CTGAGGCTCAGAGAGGTAAGTGG - Intergenic
1079487296 11:20948632-20948654 AAGAGGCCGTGAAGGGAAAGGGG - Intronic
1079519518 11:21309625-21309647 CTGAGACTGGGAAGGAAAAGAGG + Intronic
1082020003 11:47524523-47524545 CTGAGGTTTTCAAGTGAAAGAGG - Intronic
1083096133 11:60253519-60253541 CTGATTCTCTTCAGGGAAAGAGG + Intergenic
1083206223 11:61150846-61150868 GTGAGGCTCTGGAGGGCAACTGG - Intronic
1083595089 11:63915359-63915381 TTGAGGCCCAGAAGGGAAGGAGG + Intronic
1083834176 11:65253912-65253934 CTGAGACTCAGAAGGGTGAGTGG + Intergenic
1084393875 11:68896370-68896392 CTGAGGCTCAGAAGGGACTTTGG - Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084791272 11:71476715-71476737 CTGTGGCTCTGACGTGAACGGGG - Intronic
1084923925 11:72496271-72496293 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
1085414439 11:76310894-76310916 CTGTGCCTCTGAAGGGCACGGGG + Intergenic
1085508319 11:77072608-77072630 CAGAGGCTCTGAGGGGAAAGAGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086085339 11:82947440-82947462 CAGAGGCTGAGAGGGGAAAGGGG + Intronic
1086423951 11:86665661-86665683 GAGAGGCGCTAAAGGGAAAGAGG + Intronic
1087049164 11:93868674-93868696 TTGAGGGTTTGAAGGGGAAGGGG + Intergenic
1087058883 11:93959359-93959381 CTGAGGCTCAGAGAGGAAAGTGG - Intergenic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089003796 11:115074157-115074179 CTGGGACTCAGAAGGGAATGTGG + Intergenic
1089078361 11:115757069-115757091 CTCAGGCTGTGATGGGAATGTGG + Intergenic
1089579228 11:119471058-119471080 CTGAGCCTCTGCAGGGAAACGGG - Intergenic
1089599242 11:119603322-119603344 CTGAGGGTCTCAAGGGCCAGAGG - Intergenic
1089630516 11:119781374-119781396 GTGAGGCCCAGAGGGGAAAGGGG + Intergenic
1090655736 11:128843448-128843470 CTGAGGCACTAAAGAAAAAGTGG - Intronic
1090839258 11:130474525-130474547 CTGAGGCTCTGCAGGTAGCGGGG + Exonic
1091261936 11:134241522-134241544 CTGAGGCTATAAGGAGAAAGGGG - Intronic
1091347515 11:134864964-134864986 CTGAGGCTCTGAAGGTGGTGGGG + Intergenic
1091373758 12:13268-13290 CTGAGGCTGAGGAAGGAAAGGGG + Intergenic
1091412567 12:253763-253785 CTGAGGCTCTGAAGAGGAGTTGG + Intronic
1091840166 12:3614994-3615016 CTGAGGCTCCTAAGGGCAAGGGG + Intronic
1092601540 12:10071649-10071671 CTTAGGGGCTGAAGAGAAAGAGG - Intronic
1092751812 12:11726245-11726267 GTGAGGAGCTGAAGGAAAAGAGG + Intronic
1093745702 12:22739121-22739143 CTGAGACTCTGTTGGGAAGGTGG - Intergenic
1094487193 12:30934421-30934443 CTGAGACTGGGAAGGAAAAGAGG + Intronic
1095135757 12:38600378-38600400 CTGAGACTGTGAAGAAAAAGAGG - Intergenic
1095481624 12:42642144-42642166 CTGAGGCTCTGAAAGGTTTGGGG - Intergenic
1095968900 12:47888016-47888038 CTGAGACTGGGAAGAGAAAGAGG + Intronic
1096617413 12:52841685-52841707 CTGAGGCTCAGAAAGAAGAGTGG + Intronic
1097566854 12:61280989-61281011 CTGAGATTCAGTAGGGAAAGGGG - Intergenic
1098360154 12:69646635-69646657 CTGATGCTCTGCAGGGAAAAAGG - Intronic
1100476748 12:94942174-94942196 CTGAGGCACTGTGGGGACAGTGG + Intronic
1101155631 12:101925018-101925040 GGGAGGGTATGAAGGGAAAGGGG - Intronic
1102026698 12:109717827-109717849 CTAAGGCTCAGAAGGGACAGGGG - Intronic
1102167559 12:110818816-110818838 CTGAGGCTGTTACTGGAAAGGGG + Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1102758923 12:115368066-115368088 CTGAGGCTGGGAAGAAAAAGAGG - Intergenic
1102797303 12:115699984-115700006 CTGAGGCTCAGAAGGACAAAGGG + Intergenic
1104185322 12:126425145-126425167 GTTAGGCTTTGAAGGGAAGGTGG + Intergenic
1104223956 12:126813053-126813075 GGGGGGCTCTGAAGGCAAAGGGG + Intergenic
1104250385 12:127088001-127088023 CTGAGGCTCTGAGCGGAAAAAGG + Intergenic
1104268859 12:127263960-127263982 CCAAGGCTCTGAGGGGAAAATGG - Intergenic
1104364256 12:128162736-128162758 CTGAGGCTGGGAAGAAAAAGAGG - Intergenic
1104675225 12:130707800-130707822 ATCAGGATGTGAAGGGAAAGTGG + Intronic
1104970347 12:132528098-132528120 CTGGGGCTCCAGAGGGAAAGCGG - Intronic
1105501926 13:20980397-20980419 ATGAGGCTCTGAAGGAAAAGTGG - Intronic
1106700206 13:32221157-32221179 CTGAGGCTCTGAAGGAGGACAGG - Intronic
1106726460 13:32491133-32491155 CTGAGATTCTGAAGGGAAAAGGG + Intronic
1108276229 13:48812540-48812562 CAGAGGCTGGGAAAGGAAAGAGG - Intergenic
1108708957 13:53014991-53015013 CAGAGGCTCTGTGGGGAAACTGG + Intergenic
1109224692 13:59678719-59678741 GTGAGGTCCTGTAGGGAAAGTGG - Intronic
1109610885 13:64763188-64763210 CTTAGGCTCTGTAGGTATAGAGG - Intergenic
1109721226 13:66278325-66278347 CTGAGGCTGGGAAGAAAAAGAGG - Intergenic
1110537723 13:76670882-76670904 CTGAAATTCTGAAGGGACAGTGG + Intergenic
1110649524 13:77926799-77926821 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
1110791941 13:79595601-79595623 CTGAGGCTCGGAAAGGTAATAGG - Intergenic
1110868604 13:80424214-80424236 CTGAGGCTATGAAGGGCAGCAGG + Intergenic
1111237716 13:85431042-85431064 CTGAGCCTCTGTGGGGAGAGGGG - Intergenic
1111389360 13:87571476-87571498 CTGAGAAGCTGAAGGAAAAGAGG + Intergenic
1111458071 13:88509104-88509126 CTGAGGCTGTGCAGGGCAATGGG + Intergenic
1112444536 13:99452079-99452101 CTGAGGCTGGGAAGAAAAAGAGG - Intergenic
1112577917 13:100653461-100653483 CTGAGGTCCTGAAGTGACAGAGG + Intronic
1113278373 13:108760731-108760753 CAGAGGCTGGGAAGGGGAAGAGG + Intronic
1113930417 13:113965311-113965333 CTGTGGCTCTGAGGGCAAAAGGG + Intergenic
1114695937 14:24627845-24627867 CTGTGGCCCTGGAGGAAAAGAGG + Intergenic
1116506112 14:45683763-45683785 CAGAGGCTGTGAAGGGTAATGGG - Intergenic
1118440104 14:65804440-65804462 CTGGGCCTCTGAAGGCAAACGGG + Intergenic
1118494147 14:66291510-66291532 CTCTGGCTATTAAGGGAAAGGGG + Intergenic
1119404236 14:74386767-74386789 CTGAGGCCCTGCAGAGAAAGGGG - Intergenic
1119495746 14:75077310-75077332 CTCAGGTTCTGTTGGGAAAGTGG + Intronic
1120340091 14:83208447-83208469 CTGCTGCTCTGAAATGAAAGAGG - Intergenic
1120485000 14:85102348-85102370 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1121967370 14:98323107-98323129 TCGAGTCTCTGAAGGCAAAGAGG + Intergenic
1121969352 14:98342349-98342371 TTTAGGGTCTCAAGGGAAAGGGG - Intergenic
1122061815 14:99141043-99141065 CTGAGGCTAGGAAGGGCCAGGGG - Intergenic
1122540224 14:102493824-102493846 CTGAGGTTCTGCGTGGAAAGTGG + Intronic
1122967449 14:105137965-105137987 CTGGGGGTCTGATGGGGAAGGGG + Intergenic
1122984364 14:105205467-105205489 CTGAGGCTCTGCAAGGGCAGAGG - Intergenic
1123772148 15:23539498-23539520 CTGTAACTCTGAAGGGAAAAAGG - Intergenic
1123887533 15:24741732-24741754 TTAAGACTCGGAAGGGAAAGAGG - Intergenic
1124076010 15:26444856-26444878 CTGCAGCTCTGAATGGACAGAGG - Intergenic
1124625892 15:31307325-31307347 GAGAAGCTCAGAAGGGAAAGGGG - Intergenic
1126349915 15:47734298-47734320 TTGATGCTTTGAAGGCAAAGGGG - Intronic
1126874312 15:53023107-53023129 CTGAGACTGGGAAGGAAAAGAGG - Intergenic
1127899618 15:63331284-63331306 CCGAGGCTCTGCTGGGAAACAGG - Intronic
1128207473 15:65865980-65866002 CAGAGCCTATGATGGGAAAGGGG - Intronic
1128378422 15:67093671-67093693 CTGCTGCTAAGAAGGGAAAGAGG + Intronic
1128449329 15:67794065-67794087 ATGAGGCTCTGCAGTGAAGGTGG + Intronic
1128688961 15:69708685-69708707 CTGAGGCTGGGAAGAAAAAGAGG + Intergenic
1128769213 15:70269196-70269218 CAGAGGCTGTGAAAGGACAGTGG + Intergenic
1129016432 15:72473577-72473599 CTGAAGCTCAGAAAGGAAAAGGG - Intergenic
1129464320 15:75715446-75715468 CTGAGGCTCTCAGTGGAAAAGGG + Intergenic
1130552284 15:84897787-84897809 CAGAGACTCTGAAGGGGAGGAGG - Intronic
1130995194 15:88899571-88899593 CTGGGGCTCTGAGGGGAGGGGGG - Intronic
1131248870 15:90818247-90818269 CTGAGGCTCTGGGTGGAAAGCGG - Intergenic
1131732998 15:95301758-95301780 CAGAGGCTTGGAAGGGTAAGGGG + Intergenic
1132256938 15:100384238-100384260 TTGAGGCTCTGAAGGGGACATGG + Intergenic
1132291223 15:100705178-100705200 CTGGGGCTCTGGAGGCAGAGAGG + Intergenic
1132776367 16:1597007-1597029 CTAAGGGGCTGATGGGAAAGTGG + Intronic
1132789109 16:1675251-1675273 CTGAGGATGAGAAGGCAAAGGGG - Exonic
1132845391 16:1998853-1998875 CTGGGGGTCAGAAGGTAAAGAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133200873 16:4203832-4203854 CTGAGGCTTAGAAGGCAAAGAGG + Intronic
1134098388 16:11434767-11434789 CTGAGGCACAGAAGGGCGAGTGG + Intronic
1134135632 16:11674718-11674740 CTAAGGCTCTGAAGGCAGAGAGG - Intronic
1134274771 16:12766357-12766379 CTCAGACTGTGAAGGAAAAGGGG + Intronic
1135674653 16:24405106-24405128 CTGTGACTCAGAAGGGAGAGCGG - Intergenic
1135968705 16:27056432-27056454 CTGAGACTGTGAAGAAAAAGAGG - Intergenic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1138448316 16:57078250-57078272 CTGAGGCTGAGAAGGGGCAGGGG - Intronic
1138497266 16:57416180-57416202 CTGAGGCTGAGAAGGGCACGTGG + Intergenic
1139269721 16:65670842-65670864 CTGAAGTTCCGAAGGGGAAGCGG + Intergenic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1140760426 16:78104013-78104035 CTGAGACTGTGAGGGGAGAGGGG - Intronic
1141434275 16:83990456-83990478 AAGAGGCACTGAGGGGAAAGGGG - Intronic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141753832 16:85978101-85978123 CTGTGGCACTAAAGAGAAAGCGG - Intergenic
1142157813 16:88540589-88540611 CTGGGGCTCTGAGGGGACAGAGG - Intergenic
1142284660 16:89166867-89166889 CTGAACCTCAGAAGGGCAAGTGG - Intergenic
1142427595 16:90008917-90008939 CAGAGGCTCTGAGGGCAGAGGGG + Exonic
1142442920 16:90112476-90112498 TTCAGGCTATGATGGGAAAGAGG - Intergenic
1142464783 17:128916-128938 TTCAGGCTATGATGGGAAAGAGG + Intergenic
1142658992 17:1414608-1414630 ATGAGGCTGGGAAGGGAAGGAGG + Intergenic
1143476972 17:7208421-7208443 CTGAGGCCCTGGCGGGAGAGGGG - Intronic
1143816766 17:9522761-9522783 CAGAGGCTGGGAAGGGCAAGAGG + Intronic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145302661 17:21652166-21652188 GTGAGGCTCTGTGGGGAGAGAGG + Intergenic
1145310766 17:21700069-21700091 CTGAGGCTGTGCTGGGAAAGGGG - Intronic
1145347641 17:22051022-22051044 GTGAGGCTCTGTGGGGAGAGAGG - Intergenic
1145388161 17:22433774-22433796 CTGAGGCTCAGAATGTAAATAGG - Intergenic
1145415947 17:22714306-22714328 GTGAGGCTCTGTGGGGAGAGAGG + Intergenic
1146385788 17:32371883-32371905 CAGAGGTTCAGAGGGGAAAGTGG - Exonic
1147261490 17:39211881-39211903 CAGAGGCTCTGTGGGGAGAGGGG + Exonic
1147340500 17:39750832-39750854 CTCAGGCTGTGAAGGGACACTGG - Intergenic
1147475387 17:40706878-40706900 CAGAGGCTGGGAAGGGAAACGGG - Intergenic
1148063321 17:44851362-44851384 CTGAGGCCCTGCAGGGAATGGGG + Exonic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148786263 17:50147709-50147731 GTGGGGTTCTGAAGGGAATGGGG - Intronic
1148820939 17:50359315-50359337 ATGAGCCTCTGGAGGGAAAGTGG + Intronic
1149028408 17:52056437-52056459 CTGAGGCTGGGCTGGGAAAGAGG + Intronic
1149424875 17:56545445-56545467 CTGAGGTGATGAAGGGATAGGGG - Intergenic
1150647399 17:66987758-66987780 AGGAGGCTCTGATGGAAAAGAGG - Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151545272 17:74789058-74789080 CTGAGGCTGAGACGGGAAAGTGG - Intronic
1151963874 17:77421239-77421261 CTGAGGGACTGAAGGAAGAGGGG - Intronic
1152111112 17:78358295-78358317 CTGTAGCTCTGGGGGGAAAGAGG - Exonic
1152242707 17:79168580-79168602 CTGAGGCTCTGAGGGGAGAGGGG + Intronic
1152466908 17:80471665-80471687 CAGAGGCTGGGAAGGGGAAGAGG - Intronic
1152523447 17:80873693-80873715 CTGAGGAGCTGAGGAGAAAGGGG + Intronic
1152740118 17:82015058-82015080 CTGGGGCTGGAAAGGGAAAGTGG - Exonic
1153796130 18:8623945-8623967 ATGAGGCTCTTGAGGGGAAGTGG - Intronic
1154338048 18:13481722-13481744 CTGAGGCTCTGAAGGGATCCAGG + Intronic
1154363941 18:13689115-13689137 GTGAACCTCTGAAGGAAAAGGGG - Intronic
1155623252 18:27805905-27805927 TTGAGGATTTGTAGGGAAAGGGG + Intergenic
1156506372 18:37597576-37597598 CAGAGGATCTCCAGGGAAAGAGG - Intergenic
1157088596 18:44608279-44608301 CTGAAGTTTTGAAGGGATAGTGG + Intergenic
1157451159 18:47790194-47790216 CTGGGACTCAGAAGGGGAAGTGG + Intergenic
1158043934 18:53132463-53132485 GTGAGGATCAGAATGGAAAGGGG - Intronic
1158583562 18:58707957-58707979 CTGAGACTCTGGATGTAAAGTGG - Intronic
1158678587 18:59545905-59545927 CTGAGACTCAGAAGAAAAAGAGG - Intronic
1159306040 18:66643655-66643677 CTGAGACTGGGAAGAGAAAGAGG + Intergenic
1159545359 18:69834363-69834385 CAGAGGCTTGGAAGGGAAAGTGG + Intronic
1159883778 18:73885066-73885088 CTCAGGCTCTGCAGGGAACAGGG - Intergenic
1160433962 18:78832013-78832035 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434013 18:78832201-78832223 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434024 18:78832247-78832269 CAGAGGCTGAGAAGGGAATGAGG - Intergenic
1160434061 18:78832389-78832411 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434096 18:78832527-78832549 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434145 18:78832757-78832779 CAGAGGCTGAGAAGGGAAGGGGG - Intergenic
1160434160 18:78832803-78832825 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434188 18:78832899-78832921 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160678269 19:401781-401803 CCGAGGCACAGAAGGCAAAGGGG - Intergenic
1160788937 19:913807-913829 CTGAGGCTAAGCAGGGGAAGGGG - Intergenic
1160817422 19:1042606-1042628 CTGAGGCTCTGAGAGGCAAAGGG - Intronic
1160878469 19:1308774-1308796 CTCAAGCTCCGAAGGGAACGTGG + Intergenic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161428987 19:4219880-4219902 CTGAGGCTCAGAAACGGAAGGGG + Intronic
1161918558 19:7249194-7249216 CTGAACCTCTGAAAGGAAAGAGG - Intronic
1162103585 19:8355717-8355739 CTGGTGCTCAGAAGGGAACGGGG - Intronic
1162375960 19:10305476-10305498 CCGGGGCTCTGAAGGGTCAGAGG + Exonic
1162894907 19:13759367-13759389 CTGAGGCTCAGAGGGTACAGTGG - Intronic
1163658941 19:18565063-18565085 CTGAGGCTCAGATGGGGAGGTGG - Intronic
1163821179 19:19497498-19497520 GGGAGGCTCTGAGGGGAAGGAGG + Intronic
1164755882 19:30689114-30689136 CTGAGGCTTTGGAAGGAAAGAGG + Intronic
1165700406 19:37933016-37933038 CTGAGGCCCAGAGAGGAAAGCGG - Intronic
1165888987 19:39099272-39099294 GTGTGTCTCTGAAGGGACAGGGG + Intronic
1166881758 19:45934362-45934384 CTGAGGCTCCTCAGGGAAATTGG + Exonic
1166898695 19:46041184-46041206 CTGAGGATCTGAAGGGTCTGAGG - Intronic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167511457 19:49897337-49897359 CTGAGGCTCTGGGTGGCAAGTGG - Intronic
1167608264 19:50493244-50493266 CTGAGGCTCGGGCGGGAAAGAGG - Intergenic
1168127585 19:54294599-54294621 CTCAGGATCTGCAAGGAAAGTGG + Intergenic
1168129410 19:54308006-54308028 CTCAGGATCTGCAAGGAAAGTGG + Intronic
1168186070 19:54700312-54700334 CTCAGGATCTGCAAGGAAAGTGG - Intronic
1168243397 19:55098268-55098290 CTGAGGCCCGGAAAGGAAAGTGG + Intronic
1168317401 19:55490198-55490220 CTGAGGGTCTGAAGTGATGGAGG - Intronic
1168511293 19:56975533-56975555 CTGAGGCACAGAGAGGAAAGGGG + Intergenic
1168714843 19:58520664-58520686 CAGAGGCTTTGAAGGTAGAGAGG + Intronic
925212041 2:2057564-2057586 GTGTGGCTCTGAAAGGAAAGAGG - Intronic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925619179 2:5774118-5774140 CTGAGGCTCAGAAAGGAGATAGG + Intergenic
927560239 2:24065823-24065845 GTGAGGCTCTGCAGGTAAACTGG + Intergenic
927844454 2:26464245-26464267 CTGAGGCACAGAAGGAGAAGTGG + Intronic
928845347 2:35665158-35665180 CAGAGTCTGTGAATGGAAAGTGG + Intergenic
928996719 2:37300363-37300385 CAGAGGCTCTGAAGGGTAGTGGG + Intronic
929028725 2:37630407-37630429 CTGATGCTCTCAAGGGAGGGCGG - Intergenic
929197777 2:39204022-39204044 AGGAGGAACTGAAGGGAAAGGGG - Intronic
929487381 2:42367084-42367106 CTGAGAATCTGAGGAGAAAGGGG - Intronic
929545831 2:42854796-42854818 GGGAGGATCTGAAGGAAAAGAGG + Intergenic
929557629 2:42935430-42935452 CTGAGGCTCTGAACAGACACTGG - Intergenic
929630080 2:43450931-43450953 CTGGGGCACTGGAGGAAAAGGGG + Intronic
929694039 2:44099036-44099058 TTCAAGCTCTGGAGGGAAAGTGG + Intergenic
930306491 2:49681098-49681120 CAGAGGCTGTGAAGGGTGAGAGG + Intergenic
930351111 2:50255591-50255613 CTTAAGCTCTGAAGTGAAAATGG + Intronic
931465601 2:62484077-62484099 CTTAAGCTTTGAAGGGAAAATGG - Intergenic
932306265 2:70705943-70705965 CTGAGGCTCCGAAGGGGCACAGG + Intronic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
932510526 2:72283650-72283672 CTGAGTCTCAGCAGGGAGAGGGG + Intronic
932764461 2:74461215-74461237 CTCTGGCTCTGAAGGGACAAAGG - Exonic
933168334 2:79098141-79098163 CTCAGGGTTTGAAGGGGAAGGGG + Intergenic
934525576 2:95049607-95049629 CTGAGGCGCTGAGGTAAAAGAGG - Exonic
934566185 2:95342872-95342894 CTGAGGCTGGGAAAGGAAATTGG + Intronic
935194913 2:100807511-100807533 CAGAGGCTCAGGAGGGAGAGAGG + Intergenic
936861449 2:117025404-117025426 CTGGGACTCAGAAGTGAAAGGGG - Intergenic
936935330 2:117834354-117834376 CTGAGTCCCAGAAGGGAGAGTGG - Intergenic
936966659 2:118133911-118133933 ATTAGGTTCTGAGGGGAAAGTGG + Intergenic
937020196 2:118643453-118643475 GGGAGGCTCTGAAGGATAAGAGG - Intergenic
937154784 2:119711179-119711201 TTGAGGCTTTGAAAAGAAAGTGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937899824 2:127011346-127011368 CTGATGCTTGGAAGGGAGAGGGG - Intergenic
939225138 2:139354627-139354649 CTGAGTCTCTGTAGGGAGTGTGG + Intergenic
939278374 2:140030978-140031000 CTGAGACTGTGAAGAAAAAGAGG - Intergenic
939307816 2:140431280-140431302 CTGAATCTGAGAAGGGAAAGTGG - Intronic
940495212 2:154418574-154418596 CAGACCCTCTGGAGGGAAAGAGG + Intronic
941456839 2:165719123-165719145 CTGAGGCTCTGAAAGGAATAAGG + Intergenic
941545928 2:166851485-166851507 CTGAGACTGGGAAGAGAAAGAGG + Intergenic
941759438 2:169225148-169225170 CAAAGTCTCTGAAGTGAAAGAGG - Intronic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
943256852 2:185605055-185605077 GTGAGGCTCAGAAAGTAAAGAGG + Intergenic
945807589 2:214509122-214509144 GTGAGACTAGGAAGGGAAAGAGG - Intronic
946401876 2:219472536-219472558 CTGAGGATGGGAAGGGAATGTGG - Intronic
946428555 2:219612923-219612945 CTGAGGCTCTGAGCGGGCAGGGG + Intronic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947328000 2:228999113-228999135 CTGAGGCTGGGAAGAAAAAGAGG - Intronic
947342915 2:229158920-229158942 CAGAGGCTGTGAAGGGTAGGGGG + Intronic
947698920 2:232216463-232216485 ATGTGGCTTTGCAGGGAAAGGGG - Intronic
948365689 2:237453133-237453155 TTGAGGCCCTGCAGGGAAAGTGG + Intergenic
1170237695 20:14126001-14126023 CTGACACCCTGAAGGGAAAAAGG - Intronic
1170716929 20:18839906-18839928 CTGAGCCTGATAAGGGAAAGAGG + Intergenic
1171116771 20:22531565-22531587 CTGAAGCTCTGAAAGGAACATGG + Intergenic
1171519257 20:25763697-25763719 GTGAGGCTCTGTGGGGAGAGAGG + Intronic
1171557669 20:26092794-26092816 GTGAGGCTCTGTGGGGAGAGAGG - Intergenic
1172029536 20:31972113-31972135 ATGAAGCTCTGAAGAGAGAGAGG + Intronic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1172569245 20:35956060-35956082 CTGAGGCCCTCAAAGGACAGGGG + Intronic
1173023407 20:39286521-39286543 CTGAGTCTGGGAAGGAAAAGAGG - Intergenic
1173285855 20:41670924-41670946 CTGGGCCTCTGAAGGGAACCTGG - Intergenic
1173565625 20:44036301-44036323 CTGAGGCTGTGCTGGGCAAGTGG + Intronic
1173883734 20:46438810-46438832 CTGAGGCTCTGTAGAAACAGAGG + Intergenic
1173893472 20:46531505-46531527 CTGAGGCTCAGAGAGGAGAGGGG + Intergenic
1174322425 20:49752463-49752485 TGGAGGCTCTGAAGGGTGAGTGG + Intergenic
1174407015 20:50309154-50309176 TTCAGGCTCTGGAGGGATAGGGG + Intergenic
1174631589 20:51962969-51962991 CAGAGGGTCTGAGGGGCAAGGGG + Intergenic
1174865889 20:54135374-54135396 CTGAGACTGGGAAGAGAAAGAGG + Intergenic
1175306001 20:57975905-57975927 CTGAGGCCATGAAGGAAAGGAGG + Intergenic
1175539115 20:59737160-59737182 CAGGGGCTATGATGGGAAAGGGG - Intronic
1175739898 20:61413130-61413152 CTGAGGCTGGGATGGGAAGGGGG - Intronic
1176374428 21:6080135-6080157 CAGAGGCTGAGAAGGGAAGGCGG + Intergenic
1176653398 21:9569978-9570000 GTGAGGCTCTGTGGGGAGAGAGG + Intergenic
1177508706 21:22053509-22053531 CTGAGGCTCTAATGGGTAGGAGG + Intergenic
1178347641 21:31845327-31845349 GTGAGGCTCTGACGAGAAGGTGG + Intergenic
1179316258 21:40246905-40246927 CTGAGGCTGGGAAGAAAAAGAGG + Intronic
1179419696 21:41225602-41225624 CTGGGGACCAGAAGGGAAAGGGG + Intronic
1179435953 21:41362262-41362284 AAGAGGCTCTGGAGGGGAAGTGG + Intronic
1181417213 22:22769080-22769102 GTGAGGATCTGAAAGGACAGTGG - Intronic
1181425532 22:22835212-22835234 CTGAGTCCCTGAGGAGAAAGGGG - Intronic
1181429776 22:22872082-22872104 CTGAGTCCCTGAGGAGAAAGGGG - Intronic
1181819627 22:25465577-25465599 CAGAGGCTGGGAAGGGAAGGTGG - Intergenic
1182080424 22:27524834-27524856 CTGAGGCCCAGAAGGGGAAACGG + Intergenic
1182288422 22:29261023-29261045 CAGAGGCTCAGAAAGGAAAAGGG + Intronic
1182422657 22:30256123-30256145 CTGAGACTCAGAATGGAGAGTGG + Intergenic
1182630311 22:31680145-31680167 CTGAGGCCAAGAAGGGAAACTGG + Intronic
1182777679 22:32842968-32842990 CTGATCCTCTGCAGTGAAAGTGG + Intronic
1183362663 22:37390749-37390771 CCGAGGCCCAGAAGGGAGAGGGG - Intronic
1183362856 22:37391704-37391726 TTGAGGCTCTGATGAGGAAGTGG - Intronic
1183498428 22:38163585-38163607 CTGAGGCTCTGAGTGGGAACAGG + Intronic
1183538441 22:38416345-38416367 CTGAGGCCCAGACAGGAAAGGGG - Intergenic
1183582976 22:38736496-38736518 CTGGGGCTCTGAAGAGAACCAGG + Intronic
1183854971 22:40625842-40625864 TTGTGGCATTGAAGGGAAAGAGG - Intronic
1183996977 22:41641606-41641628 CAGAGGCTGTGAAGGGTAAGGGG - Intronic
1184029497 22:41883605-41883627 GTGAGGCACTGAGGGGACAGAGG + Intronic
1184095212 22:42312696-42312718 CTGAGGCTCAGCAGGGATGGGGG - Intronic
1184104947 22:42362100-42362122 CTGAGCAAGTGAAGGGAAAGTGG + Intergenic
1184449950 22:44576904-44576926 CACATGCTCTGCAGGGAAAGTGG - Intergenic
1184606853 22:45579295-45579317 CTGAGGCCCGGAAGGGCGAGGGG + Intronic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
949226043 3:1697578-1697600 CTCTGGATATGAAGGGAAAGAGG + Intergenic
949543627 3:5053720-5053742 CTGAAGCTCTGAACGCAAAGGGG + Intergenic
949742910 3:7257005-7257027 CCAAGGCTCAGAAGTGAAAGTGG + Intronic
950031910 3:9859282-9859304 CTGAGACTGGGAAGGAAAAGAGG - Intergenic
950100803 3:10355562-10355584 CTGAGGCTCAGAGAGGGAAGTGG + Intronic
950113843 3:10438027-10438049 CTGAGGCTCTGCAGGGAGCCAGG + Intronic
952731143 3:36637706-36637728 CTTAGACTCTGAAGGGAGTGAGG + Intergenic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953290866 3:41660693-41660715 CTGAGGCTCCAAAGGTCAAGGGG - Intronic
953466562 3:43126781-43126803 CTAAGGCACTTAAAGGAAAGTGG - Intergenic
953937932 3:47062571-47062593 CTGAGTCTTTGGAGGGAAAGAGG - Intronic
954280885 3:49576908-49576930 TTGAGTCTCTGAAGGGACACAGG - Intronic
954456300 3:50601479-50601501 CTGAGACCCAGAAGAGAAAGGGG + Intergenic
958588121 3:96117891-96117913 CAGAGGCTCTGGAGAAAAAGTGG + Intergenic
958684613 3:97377384-97377406 CTGAGACTGTGAAGGAAAAGAGG - Intronic
958871374 3:99562792-99562814 CTGAGGCCCTAAAAGCAAAGAGG - Intergenic
959171878 3:102854125-102854147 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
959342665 3:105150096-105150118 CTGAGGCTGGGAAGAAAAAGAGG + Intergenic
959527763 3:107396961-107396983 CTCCTGGTCTGAAGGGAAAGAGG - Intergenic
960499901 3:118424461-118424483 CAGAGGCTGGAAAGGGAAAGGGG + Intergenic
961457972 3:127033574-127033596 CTGGGGCTCACCAGGGAAAGGGG + Intronic
961593475 3:127998207-127998229 CTGAGGATCTGGAAGGGAAGAGG + Intergenic
961824291 3:129590769-129590791 CTGAGGCTCAGAGGGGAAAATGG + Intronic
962028356 3:131572576-131572598 CTGGGGCACAGAAGGGAGAGTGG + Intronic
962299762 3:134228697-134228719 CTGAGGCGGGGAGGGGAAAGTGG + Intronic
963174252 3:142281604-142281626 CTGAGACTTTGAAGGAAAAGTGG + Intergenic
963234840 3:142946589-142946611 CTCATGCTGTGAATGGAAAGGGG + Intergenic
963972693 3:151447020-151447042 GTGTGGATCTGAAGGGAACGTGG + Exonic
964022157 3:152025515-152025537 CAGAGGCTGGGAAGGGTAAGGGG + Intergenic
964605152 3:158553059-158553081 TTGAGGCACTGCAGGGAAAGAGG - Intergenic
964793485 3:160474196-160474218 ATGTGGCTCTGAAGGGGAGGAGG - Intronic
965067115 3:163864249-163864271 CGGAGGCACTGCAGAGAAAGAGG + Intergenic
965135511 3:164761742-164761764 CAGAGGCTGGGAAGGGCAAGGGG + Intergenic
965520521 3:169664849-169664871 CAAAGGCTGTGGAGGGAAAGGGG + Intergenic
965548323 3:169937964-169937986 CTTTGGCTCTGAAGGCAATGGGG - Intronic
966054062 3:175660661-175660683 CAGAGGCTGGGAAGGGAAAAGGG - Intronic
966660427 3:182408536-182408558 CTGAGTCCCTGAGAGGAAAGTGG + Intergenic
966921292 3:184613296-184613318 CAGAGGTTCTGGAGGGAATGAGG - Intronic
967688151 3:192441427-192441449 CTGAGGCACAGAAGGAGAAGAGG - Intronic
967999622 3:195195910-195195932 CTGAGGCAGTGAGGAGAAAGAGG - Intronic
968252094 3:197228009-197228031 CTGAGGCACTGCAGTGAAAAAGG - Intronic
968363192 3:198163436-198163458 TTCAGGCTATGATGGGAAAGAGG - Intergenic
968603875 4:1522420-1522442 CTGTGGCTGTGACGGGACAGAGG - Intergenic
968830070 4:2928717-2928739 CTGAGGCTCTGAGAGGACAAGGG - Exonic
969189674 4:5506929-5506951 CTGAAGTTCTGTAAGGAAAGAGG + Intergenic
969606788 4:8205887-8205909 CTGAGACCCTGAAGGGGACGAGG + Intronic
970050780 4:11912627-11912649 CAGAGGGTCAGTAGGGAAAGTGG + Intergenic
970578154 4:17447845-17447867 CTTGGGCTCTGAAGTGAAACTGG + Intergenic
971386114 4:26141804-26141826 TGGAGGCTGGGAAGGGAAAGGGG - Intergenic
971742603 4:30539707-30539729 CTGCGGCTCTGAAGAGGAATAGG + Intergenic
971783109 4:31064532-31064554 TAGAGGCTCTGAAGGGATCGTGG - Intronic
971884253 4:32423388-32423410 CTGAGGCCCTGAAGGGCAGGAGG + Intergenic
972354064 4:38264088-38264110 CTAGGGCTCTAAAGGGAAATGGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973022773 4:45224326-45224348 CTGAGACTGGGAAGGTAAAGAGG - Intergenic
973890938 4:55366708-55366730 CTGAGGCTCTGGAGCCAAGGGGG - Intronic
974269468 4:59632418-59632440 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
974834907 4:67236713-67236735 GTGGGGCTATGAAGAGAAAGGGG + Intergenic
975355203 4:73394343-73394365 CTGAGTGTGTGAGGGGAAAGAGG - Intergenic
976340241 4:83939184-83939206 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
977371768 4:96145986-96146008 CTGAGGCTCTCAAAAGCAAGGGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
979397637 4:120207508-120207530 ATGAGGCTCTGGTGGGAGAGAGG + Intergenic
979721935 4:123910710-123910732 CATAGTGTCTGAAGGGAAAGTGG - Intergenic
980335441 4:131468065-131468087 CTGAGGCTGGGAAGAAAAAGAGG - Intergenic
980443667 4:132880434-132880456 ATGAGGGTGTGAAGGGAAAGTGG + Intergenic
980920040 4:139075039-139075061 CTGAGGCTCTGAAGAGAGCGAGG - Intronic
981121110 4:141051917-141051939 CTGAGGCTGGGAAGAAAAAGAGG + Intronic
981953847 4:150446154-150446176 CTGAGGCCAGGAAGGGTAAGGGG + Intronic
982064663 4:151643592-151643614 CAGAGGCTGGGAAGGGAAGGGGG - Intronic
982288846 4:153760113-153760135 CTGAGGTTCTGAAGGAACCGGGG - Exonic
982443397 4:155462320-155462342 CTGAGACTCAGAAGTGAAAGGGG + Intergenic
983289072 4:165778417-165778439 CAGAGGCTGGGAAGGGAATGAGG - Intergenic
983959321 4:173733116-173733138 ATGAGGGTATAAAGGGAAAGGGG - Intergenic
984024391 4:174525358-174525380 CAGAGGCTGGGAAGGGTAAGGGG - Intergenic
984241356 4:177223915-177223937 ATGAGGCTCTCAAGAAAAAGAGG + Intergenic
984771536 4:183440886-183440908 TTGAGGATCTGAAGAAAAAGAGG - Intergenic
984840681 4:184064772-184064794 CTGATGCACTGAAGGGACAACGG - Intergenic
984940217 4:184924752-184924774 CTGGAGCTTTGAGGGGAAAGGGG - Intergenic
985545031 5:505149-505171 CAGAGGCTCTTAAGGGAGGGAGG + Intronic
985570546 5:642495-642517 CCCAGGCTCAGAAGGGCAAGGGG - Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985646323 5:1086297-1086319 CTGAAGCCCTGCAGGGACAGCGG + Intronic
985650029 5:1103101-1103123 CTGAGGCTCTCAAGGGGCACAGG + Intronic
985807609 5:2058746-2058768 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
986939295 5:12930945-12930967 CTTAGGATCTCAAGGGAAAGTGG + Intergenic
987148840 5:15018390-15018412 CTGAGCATTTGAAGGCAAAGGGG - Intergenic
987939669 5:24517389-24517411 CTGAAGAATTGAAGGGAAAGTGG + Intronic
988099488 5:26658969-26658991 CTGAGTCCTTGGAGGGAAAGAGG - Intergenic
988666226 5:33330823-33330845 AAGGGGTTCTGAAGGGAAAGGGG - Intergenic
988700811 5:33672823-33672845 CTGAGGCCCTTCAGGGAAATGGG - Intronic
988809552 5:34770977-34770999 CTGAGGCTCTCAAGGGATTGTGG + Intronic
989427482 5:41313504-41313526 CTGAGTCTCTGAAGGGAATAGGG - Exonic
990449841 5:55924153-55924175 CTGAGGCTCTAAGCGGGAAGTGG + Intergenic
990836717 5:60029721-60029743 CAGAGACTCAGAAGGGTAAGAGG - Intronic
991937941 5:71820774-71820796 CAGAGGCTGGGAAGGGGAAGGGG - Intergenic
992163055 5:74020995-74021017 CTGACTCTCAGAAGGGAAGGAGG - Intergenic
992961213 5:81958114-81958136 CTGACTCTGAGAAGGGAAAGTGG - Intergenic
993539430 5:89130254-89130276 CTTAGGCTCTCATTGGAAAGTGG + Intergenic
993959705 5:94281800-94281822 CTGAGACTCAGTAGGGAACGGGG - Intronic
994053389 5:95388023-95388045 GTGAGGCTGGGAAGGGTAAGGGG + Intergenic
994782023 5:104102018-104102040 CAGAGGCTCAGAGGGGAAAGGGG + Intergenic
995595392 5:113742526-113742548 CTGAAGCTCTGTGAGGAAAGGGG + Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
996192399 5:120561916-120561938 CTGAGGCTAGGAAGAAAAAGAGG - Intronic
996361092 5:122647636-122647658 CAGATGCTGTGAAGGGTAAGGGG + Intergenic
997601242 5:135139990-135140012 CAGAGGCTGTGGATGGAAAGTGG + Intronic
997648236 5:135495611-135495633 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
997714381 5:136030931-136030953 TCTGGGCTCTGAAGGGAAAGAGG - Intronic
997882712 5:137604623-137604645 CTGAGCCTCAAAAGGGATAGGGG + Intergenic
998106559 5:139472743-139472765 CGGTGGCTCTGTAGGGAGAGTGG - Intergenic
998676315 5:144412507-144412529 CAGAGGCTAGGAAGGGTAAGGGG + Intronic
998677697 5:144428023-144428045 CAAGGGCTATGAAGGGAAAGAGG - Intronic
998699571 5:144682842-144682864 CTGACTCTCAGAAGGGAATGTGG + Intergenic
999412681 5:151366161-151366183 TTGAGGCTCCCAAGGGGAAGTGG + Intergenic
999869596 5:155735483-155735505 CTGAGGCTCAGAGGGGGAAAGGG + Intergenic
999885832 5:155921519-155921541 CTGAGACTCTGGAAAGAAAGGGG + Intronic
1000272308 5:159697574-159697596 GTGAGGCTCAGAAAAGAAAGAGG + Intergenic
1000297856 5:159927782-159927804 CTGAGGCTCTGGTGTGAAACTGG - Intronic
1000433823 5:161183324-161183346 CAGAGGCTGGGAAGGGTAAGAGG + Intergenic
1001934503 5:175694723-175694745 CTGAGCCTCTGGATGGGAAGTGG + Intergenic
1001953925 5:175835047-175835069 CTGAGGCTGTGAAGGCAAGCAGG + Intronic
1001995339 5:176152932-176152954 CTGAGGATCTGAAAGCAGAGGGG + Intergenic
1002339745 5:178507446-178507468 CTGAGGCTTTGCACGGGAAGTGG - Intronic
1002643537 5:180641691-180641713 CTTAAGCTCTGAAGGCACAGGGG - Intronic
1002840162 6:898548-898570 CTGACCCATTGAAGGGAAAGGGG - Intergenic
1003491784 6:6628415-6628437 ATGCAGCTCTGAAGAGAAAGTGG - Intronic
1004280120 6:14273407-14273429 CTGTGCCTCTGAATGGAAAATGG + Intergenic
1005025104 6:21455110-21455132 AGGTGCCTCTGAAGGGAAAGAGG + Intergenic
1005926784 6:30451507-30451529 AGGAGGCTCTGAAGGAAGAGGGG + Intergenic
1006113568 6:31763270-31763292 CTGAGGACCTGGAGGGCAAGGGG - Intronic
1006228278 6:32559016-32559038 CAGAGAGACTGAAGGGAAAGAGG + Intronic
1006459575 6:34150606-34150628 CTGAGGCTGGGGAAGGAAAGAGG - Intronic
1006718699 6:36136369-36136391 CTGAGGCCCAGAAGGGGAAGGGG + Intronic
1007078564 6:39083223-39083245 CTGGTGCTCTGAAGGGAGACAGG - Intronic
1007293876 6:40806521-40806543 CAGAGGCCATGAAGGAAAAGAGG + Intergenic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007603030 6:43095525-43095547 CTGAGGCCCAGGAAGGAAAGGGG + Intronic
1007662972 6:43497729-43497751 CAGAGGGCCTGAGGGGAAAGCGG - Intronic
1008595829 6:53040732-53040754 CTCAGGTTGTGAAGGGCAAGGGG + Intronic
1009793375 6:68433626-68433648 CTGAGACTGGGAAGGAAAAGAGG + Intergenic
1011364019 6:86560673-86560695 TTTGGGCTCTGGAGGGAAAGTGG - Intergenic
1011445334 6:87433085-87433107 CAAAGGCTCTGAGGTGAAAGTGG - Intronic
1011650276 6:89499788-89499810 CTGAGGAGCAGCAGGGAAAGGGG - Intronic
1012063111 6:94512062-94512084 CTGAGCCCCTGGAGGGAAGGGGG + Intergenic
1013313418 6:108918705-108918727 CTGAGGCTCAGAGGGTAAAGTGG - Intronic
1014436589 6:121427466-121427488 CAGAGGCTTGGGAGGGAAAGAGG + Intergenic
1015549580 6:134398151-134398173 CTGAGGCTGGGAAGGGTAAGAGG + Intergenic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1017181469 6:151556887-151556909 CAGAGGCTGGGAAGGGTAAGTGG - Intronic
1017296250 6:152798129-152798151 CAGAGGCTGGGAAGGGAAATGGG + Intergenic
1018203118 6:161413319-161413341 CTCAGGAAGTGAAGGGAAAGCGG - Intronic
1018266909 6:162035029-162035051 CTGAGGCTCTTAAGAGAAGCAGG - Intronic
1018334129 6:162766213-162766235 CAGAGGCTGGGCAGGGAAAGAGG - Intronic
1019252488 7:25275-25297 TTCAGGCTATGATGGGAAAGAGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1021788304 7:24174619-24174641 CTGGTGCTGTGAAGGGAAAGTGG + Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022499168 7:30871844-30871866 CTGAGGCTCAGAGGTGGAAGAGG + Intronic
1023398613 7:39774659-39774681 CTGAGGCTCTGGAAGGCCAGTGG + Intergenic
1024229903 7:47355847-47355869 CTGAGGCTCTGCTGGGAAGTGGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024423173 7:49193729-49193751 ATGAGGCCCAGAAGGGATAGGGG + Intergenic
1025279740 7:57618640-57618662 ATGAGGCTCTGTGGGGAGAGAGG + Intergenic
1025304992 7:57846861-57846883 ATGAGGCTCTGTGGGGAGAGAGG - Intergenic
1026151897 7:67794969-67794991 CTGAGGCTCAGGAGGCCAAGTGG - Intergenic
1026230408 7:68478325-68478347 CTCAGGCTCAGAAGGGCTAGAGG - Intergenic
1027221660 7:76218033-76218055 CTGAGGCTCAGAAAGGAAAAGGG + Intronic
1027507856 7:79040449-79040471 CAGAGGCTGGGAAGGGCAAGCGG + Intronic
1028256080 7:88599260-88599282 AGGAGGCTGAGAAGGGAAAGTGG + Intergenic
1028379136 7:90178389-90178411 TTCATGTTCTGAAGGGAAAGAGG + Intronic
1029409074 7:100397503-100397525 CTGAGGACCTGGAGGGAATGGGG + Intronic
1029503064 7:100945783-100945805 CCCAGGCTCTGCAGGGAAAGTGG + Intergenic
1029687607 7:102159550-102159572 CTGTTGCTCTGAAAAGAAAGTGG + Intronic
1029712701 7:102308331-102308353 CGAAGCCTCTGAAGGGGAAGAGG - Intronic
1030603416 7:111613950-111613972 CTGAGACTCTGAAGGTTAACAGG + Intergenic
1031333863 7:120501514-120501536 GTGATGCTCTGAAAGGGAAGAGG - Intronic
1032350607 7:131159554-131159576 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033487261 7:141803146-141803168 CTGGGACTCAGAAGTGAAAGCGG + Intergenic
1033595962 7:142857748-142857770 ATGAGGCTATGAAGGGACAGAGG - Intronic
1033791480 7:144796664-144796686 CCGAGGTCCTGAGGGGAAAGGGG + Intronic
1034430444 7:151038644-151038666 CTCAGGCCCTAAAGGGGAAGTGG - Intronic
1035360287 7:158308163-158308185 CTGAGACTATGAAGGCCAAGAGG + Intronic
1036183995 8:6608582-6608604 CGGAGGCTCAGAAGAGCAAGCGG - Intronic
1037003204 8:13746695-13746717 CTGAGGCTGGGAAGAGAAAGAGG + Intergenic
1037026938 8:14050532-14050554 CAGAGGCTAGGAAGGGTAAGAGG - Intergenic
1037749945 8:21674980-21675002 CTGCCGACCTGAAGGGAAAGAGG + Intergenic
1037998425 8:23369829-23369851 GTGTGGCTCTGAAGGGAATCAGG + Intronic
1038238026 8:25780865-25780887 CTCAGGCTCTGCAGTGAAACTGG + Intergenic
1039344952 8:36693368-36693390 CTGAAGCTCAGGAGGGTAAGTGG + Intergenic
1039501404 8:38020574-38020596 TTCAGGCTATGAAGGGAAAGGGG - Intergenic
1039798432 8:40934593-40934615 CTTAGGATGTGAAGGGAGAGTGG - Intergenic
1040384191 8:46902265-46902287 CTGAGGCTCAGGAGGGTCAGAGG - Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1041132860 8:54721341-54721363 CTGGAGCTCTGAAGGGAAACAGG + Intergenic
1042035998 8:64534338-64534360 CTGAGGCAATGAAAGCAAAGAGG + Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1044723820 8:95175985-95176007 CTCAGGCCATGATGGGAAAGAGG + Intergenic
1045060020 8:98403164-98403186 CTGAGTCTCTGGAGTCAAAGGGG - Intronic
1046454420 8:114440077-114440099 CTGAGACTGTGAAGAAAAAGAGG - Intergenic
1046768598 8:118097003-118097025 CTGAGGCTCTGAAGGTATAATGG + Intronic
1047498604 8:125426147-125426169 GTGAGGCTCGGAAGGGAAATGGG + Intergenic
1048027786 8:130602420-130602442 CTGAGGCACAGAAGGAACAGAGG - Intergenic
1048506890 8:135029867-135029889 CTGAGACTCAGAAGGGTAAGTGG - Intergenic
1048879321 8:138859739-138859761 CTGAGGATCTGCAGGCAAAGGGG + Intronic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1049569162 8:143360264-143360286 CTGCGACTCTGAAGATAAAGAGG + Intergenic
1050386392 9:5095550-5095572 CTGGGACTCGGAAGTGAAAGGGG - Intronic
1050546714 9:6715881-6715903 ACGAGGCTCTGATGGGAAACGGG - Intergenic
1050679036 9:8088636-8088658 CTGAGAGCCTGTAGGGAAAGTGG + Intergenic
1051162960 9:14229693-14229715 CTGAAGCCCGGAAGGGAAGGTGG - Intronic
1051619672 9:19037651-19037673 CTGAGACTTGGAAGGAAAAGAGG - Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052338239 9:27340672-27340694 CTGATGCACTGATGGGACAGGGG + Intronic
1052409311 9:28102574-28102596 CTGCAGCTGGGAAGGGAAAGGGG + Intronic
1052878819 9:33587627-33587649 ATGAGTCCCTGAAGGGAAATGGG - Intergenic
1053199557 9:36143256-36143278 CTGGGGCTCTGAAGAGGAGGGGG - Intronic
1053298392 9:36931258-36931280 CTGAGGCTGAGCAGGCAAAGGGG + Intronic
1053384290 9:37674600-37674622 CTGAGACTCGGAAGAAAAAGAGG + Intronic
1053497154 9:38556593-38556615 ATGAGTCTCTGAAGGGAAACGGG + Intronic
1055712041 9:79073916-79073938 CTGTGGATGTGAAGGGACAGGGG + Intergenic
1055846172 9:80565721-80565743 CTGGGACTCAGAAGTGAAAGGGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056843702 9:90019239-90019261 CTGAGACTCTCTAAGGAAAGGGG + Intergenic
1057606853 9:96504746-96504768 CTGAGACTCTGAGGGTCAAGAGG + Intronic
1057754569 9:97821730-97821752 CTGAGGCTAAGAGAGGAAAGGGG + Intergenic
1058401688 9:104626296-104626318 CTGAGACTGTGAAGAAAAAGAGG - Intergenic
1059421762 9:114196621-114196643 CTGATGCTCTGCAGGGGAAGGGG + Intronic
1059716065 9:116914653-116914675 CTGAGGCTCAGATAGGGAAGAGG + Intronic
1060026186 9:120173924-120173946 CTGAGGCTCTGTGAGGAAAAGGG + Intergenic
1060048444 9:120359331-120359353 CTCAGGCTCTACAGGAAAAGAGG + Intergenic
1060206755 9:121686819-121686841 CTGGGGCTCTGGAGGAAATGTGG - Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060934953 9:127509309-127509331 ATGAGGCTCTGAAGGCATGGAGG + Intronic
1062475812 9:136726622-136726644 CTAGGGGTCTGAAGGGATAGTGG - Intergenic
1062747879 9:138227096-138227118 TTCAGGCTATGATGGGAAAGAGG - Intergenic
1202629482 M:4796-4818 CTGGGACTCAGAAGTGAAAGGGG - Intergenic
1203631118 Un_KI270750v1:73425-73447 GTGAGGCTCTGTGGGGAGAGAGG + Intergenic
1185596104 X:1307954-1307976 CTGAAGGTCTAAAGGGGAAGGGG - Intronic
1185985064 X:4823547-4823569 CTGAGACTGGGAAGGAAAAGAGG - Intergenic
1187754762 X:22510642-22510664 CAAAGGCTGTGAAGGGAAAGGGG - Intergenic
1187922439 X:24218480-24218502 ATGAGGCTTTTAAGGGAAACTGG - Intergenic
1188521096 X:31038834-31038856 CAGAAGCTATGAAGGAAAAGGGG - Intergenic
1189257954 X:39654749-39654771 GTGAGGCTGGGAAGGGAGAGGGG + Intergenic
1189348813 X:40262168-40262190 CTGAGGCCCAGAAGGGCATGTGG - Intergenic
1190133796 X:47775454-47775476 CAGAGGCTGGGAAGGGTAAGGGG + Intergenic
1192554538 X:72079454-72079476 CTGAGGCTCAGAAAGGGAAAGGG - Intergenic
1192925162 X:75748204-75748226 CTGAGGCTCAGAAGTGGAAAGGG - Intergenic
1192947879 X:75985339-75985361 CTGAGGCTCAGAAGTGGAAAGGG - Intergenic
1194216859 X:91140877-91140899 CAGAGTCTGTGAAGGGATAGTGG - Intergenic
1194590775 X:95797624-95797646 CTGAGGCTCTGAAGGCAGTGGGG - Intergenic
1194662368 X:96641124-96641146 TTGGGGTTATGAAGGGAAAGTGG - Intergenic
1194973518 X:100370061-100370083 CAGAGCCACTGAAGGAAAAGAGG + Intronic
1195596089 X:106691526-106691548 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1196589954 X:117475360-117475382 CAGAGGCTCTGAAGGGTAATAGG - Intergenic
1198703397 X:139420965-139420987 ATGAGGCTAGGAAGGGAAATTGG - Intergenic
1198782531 X:140253058-140253080 CAGAAGCTATGAAAGGAAAGAGG + Intergenic
1199842982 X:151669548-151669570 CAGAGGCTAGGAAGGGAATGGGG - Intronic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200815125 Y:7523120-7523142 TTGAGGGTCTAAAAGGAAAGTGG + Intergenic
1201396555 Y:13554897-13554919 CTGAGACTCTGAAGAGAAAATGG + Intergenic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic
1202017219 Y:20422796-20422818 CTCAGGCCTTGAAGTGAAAGTGG + Intergenic