ID: 1172393363

View in Genome Browser
Species Human (GRCh38)
Location 20:34581721-34581743
Sequence GAGTCAGGAGTCTCTAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172393363_1172393374 20 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393374 20:34581764-34581786 ATCCTCAGGGGACTTCAGGAAGG 0: 1
1: 0
2: 2
3: 61
4: 234
1172393363_1172393375 21 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393375 20:34581765-34581787 TCCTCAGGGGACTTCAGGAAGGG 0: 1
1: 0
2: 3
3: 14
4: 187
1172393363_1172393373 16 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393373 20:34581760-34581782 AATAATCCTCAGGGGACTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 240
1172393363_1172393371 8 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393371 20:34581752-34581774 GAACCAAAAATAATCCTCAGGGG 0: 1
1: 0
2: 1
3: 23
4: 220
1172393363_1172393370 7 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393370 20:34581751-34581773 TGAACCAAAAATAATCCTCAGGG 0: 1
1: 0
2: 0
3: 25
4: 284
1172393363_1172393369 6 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393369 20:34581750-34581772 TTGAACCAAAAATAATCCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 186
1172393363_1172393378 26 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393378 20:34581770-34581792 AGGGGACTTCAGGAAGGGGCTGG 0: 1
1: 0
2: 1
3: 57
4: 488
1172393363_1172393377 22 Left 1172393363 20:34581721-34581743 CCTACCCTAGAGACTCCTGACTC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1172393377 20:34581766-34581788 CCTCAGGGGACTTCAGGAAGGGG 0: 1
1: 0
2: 1
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172393363 Original CRISPR GAGTCAGGAGTCTCTAGGGT AGG (reversed) Intronic
900577516 1:3390631-3390653 GAACCAGGTGTCTCTCGGGTCGG + Intronic
903816924 1:26070818-26070840 GAGACAGGCAGCTCTAGGGTTGG - Intergenic
904412748 1:30334956-30334978 GAGTCCTGAGTCTCTGGGCTGGG - Intergenic
905174681 1:36128020-36128042 GAGTCAGGAGACCCAGGGGTGGG - Intergenic
905380310 1:37557146-37557168 GGGTCAGGAATCTCAAGGGACGG + Intronic
905851663 1:41279437-41279459 GTGTGAGGAGTCCCTAGAGTTGG - Intergenic
906536040 1:46551486-46551508 CAGACAGGAGTCCCAAGGGTGGG - Intronic
907329964 1:53664257-53664279 GAGGCAGGATGCTCTAGGCTAGG - Intronic
907417820 1:54326639-54326661 GAGTCAGAATGCTCTGGGGTCGG - Intronic
908829695 1:68166864-68166886 GAGTCTGGTATTTCTAGGGTAGG - Intronic
911335065 1:96572867-96572889 GAGGCAGGAGTCCCTACTGTGGG + Intergenic
911395586 1:97304206-97304228 GAGTCAAGAGACTCCAGAGTTGG - Intronic
914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG + Intergenic
916489508 1:165289055-165289077 GAGGCTGGAGTCTCTGGTGTGGG - Intronic
919871729 1:201827091-201827113 GAGTCAGGAGACTCTAGCTTAGG - Intergenic
920183306 1:204145912-204145934 GAGTCAGGCGTCTAAAGGCTTGG + Intronic
923036268 1:230287153-230287175 GAGTCAGGAGACTCAGGGGTGGG + Intergenic
1066535388 10:36385385-36385407 GAGTCTGGAGTCTGTAGGCCTGG + Intergenic
1067156557 10:43785911-43785933 GAATCAGAAGTCACTAGGGGTGG + Intergenic
1068118744 10:52762705-52762727 GAGCAAGGTGTCACTAGGGTTGG + Intergenic
1069903297 10:71718246-71718268 GGGACAGGAGTCCCTCGGGTGGG - Intronic
1070550566 10:77487876-77487898 AAGTCAGGAGTCCCCAGGTTGGG + Intronic
1070641377 10:78172874-78172896 GTGTCAGAAGTCTCCAGGTTGGG - Intergenic
1073101378 10:101008498-101008520 GAATCAGGAGTCTGGAGGGCTGG + Intronic
1073204179 10:101759988-101760010 GAGTCAGGAGCCTCTCTGGGAGG + Intergenic
1073256016 10:102151866-102151888 GAGGCAGGAGTCTGGAGGCTGGG + Intergenic
1073440900 10:103552158-103552180 GAGGCAGGAGGCTCAAGGGGAGG - Intronic
1075329768 10:121565502-121565524 GAGGCCGGAGTCTCTAGGCGTGG + Exonic
1075571998 10:123552895-123552917 GAGTCAGCAGCCTCCAAGGTTGG - Intergenic
1079509438 11:21194195-21194217 GAGTCTGGAGGCTACAGGGTAGG - Intronic
1084685070 11:70688489-70688511 GGGTCATGAGTCTCTTGGGATGG - Intronic
1087771971 11:102220653-102220675 GGGTCTGGAGTCTCTGAGGTTGG + Intronic
1087880729 11:103413011-103413033 GATTCAGTAGTCTGGAGGGTAGG - Intronic
1088556877 11:111070819-111070841 GAGGCAGGAGACTCCAGGCTGGG + Intergenic
1089173721 11:116533767-116533789 GAGGCAGGAGGCTGGAGGGTGGG - Intergenic
1089277981 11:117352381-117352403 GAGTCAGGCCTCCCTAGTGTGGG + Intronic
1089359438 11:117876362-117876384 GAGAGAGGAGCCTCTAGGGGAGG - Intronic
1095954458 12:47798360-47798382 GTGTCTGGAGGCTCTAGGGAGGG - Intronic
1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG + Intergenic
1096622641 12:52874196-52874218 GCGTCAGGGGTCTCTCGGGGCGG + Intergenic
1098291915 12:68964653-68964675 GAGTCATGAGTCAGTAGCGTCGG - Intronic
1099085087 12:78235942-78235964 GAGTCAGGATTCTCCAGAGAAGG - Intergenic
1099891169 12:88590166-88590188 GATTCAGGAGACTCTAAAGTAGG - Intergenic
1104768879 12:131347510-131347532 GAGACAGGAGTCTCTCTGGAAGG + Intergenic
1109763373 13:66860690-66860712 GTGCCATGAGTCTCTAAGGTAGG - Intronic
1113730062 13:112635304-112635326 GAGTCAGGGGCTTCTAGGGTGGG + Intergenic
1114798810 14:25747335-25747357 GAGTCAGGAGTCCCATGGGAAGG + Intergenic
1115314594 14:32012865-32012887 GAATTAGGAAGCTCTAGGGTGGG + Intronic
1116511063 14:45747374-45747396 GAGACATGAGAATCTAGGGTTGG - Intergenic
1119357459 14:74019114-74019136 GTGTCAGGAGTCGCTGCGGTCGG - Intronic
1120815027 14:88847100-88847122 GAGTCAGAATCCTCAAGGGTAGG + Intronic
1121006511 14:90494130-90494152 GAGTCCCGTGTCTCTGGGGTAGG - Intergenic
1121284892 14:92727494-92727516 GAGTGTGGAGACTCCAGGGTTGG - Intronic
1124038827 15:26081800-26081822 GAAGCAGGAGTCACTAGGGCTGG - Intergenic
1125521086 15:40348218-40348240 TGCCCAGGAGTCTCTAGGGTGGG + Intergenic
1126756545 15:51930874-51930896 GAGGCAGGAATCACTAGGATGGG - Intronic
1127112436 15:55688955-55688977 GAGTAAGTAGTCTCTAGCTTAGG - Intronic
1132829226 16:1919317-1919339 GATTCAGGGGCCTCTCGGGTGGG + Intergenic
1133041603 16:3063871-3063893 GAGTCATGAGGGGCTAGGGTTGG + Intergenic
1134061966 16:11204759-11204781 GAGTCAGGGGTCTGTGGGGGAGG + Intergenic
1134163782 16:11914984-11915006 GAGCCAGGAGTCATTTGGGTGGG - Intronic
1137053037 16:35729271-35729293 CAGTCAGGAGTCTCTAGCATTGG + Intergenic
1139526145 16:67518105-67518127 GAGCCAGGAGTCCCTCGGGCTGG + Intergenic
1141157393 16:81606809-81606831 GGGTCATGAGTCTAGAGGGTGGG + Intronic
1144209846 17:13004965-13004987 TAATGAGGGGTCTCTAGGGTGGG - Intronic
1150803616 17:68301557-68301579 GAGTTAGGAGTCTCTTGCATGGG - Intronic
1150966367 17:69973682-69973704 CAGTCAGGAGACACTAGGTTAGG + Intergenic
1151846614 17:76660352-76660374 GAATGAGGAGTCTCCAGGGCTGG + Intergenic
1156496466 18:37529023-37529045 GAGGATGGAGGCTCTAGGGTAGG + Intronic
1157319106 18:46620632-46620654 CTGTCAGGTGTCTCTAGGGATGG - Intronic
1165144116 19:33720742-33720764 GTGTCAGGAGCCTCCAGGGCAGG + Intronic
1166259005 19:41625231-41625253 GAGTCAGGAGTCCTGAGGCTGGG + Intronic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1167739082 19:51312911-51312933 GAGGCAGGAGGCTGGAGGGTGGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
926766469 2:16326490-16326512 GAGGCAGGATTCTCTAGGACAGG - Intergenic
926935401 2:18082709-18082731 GAGTCAGAAATCTCTAAGGTGGG + Intronic
927743163 2:25590611-25590633 CAGACAGGAGACTCTGGGGTGGG + Intronic
929788958 2:45010140-45010162 GAGTCCAGAGTTTCTAGGATGGG - Intergenic
929874923 2:45788419-45788441 GAGTCAGGATTCTCTAATGAAGG - Intronic
931432566 2:62219909-62219931 GAGTCATGAGTCTCTAGTCTGGG + Intronic
933007556 2:77015191-77015213 AAGTCTGAAATCTCTAGGGTAGG - Intronic
933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG + Intergenic
934989781 2:98913211-98913233 GACTGAGGATTCTCAAGGGTGGG - Intronic
935366413 2:102296153-102296175 CAGTTAGAAGTCTCTTGGGTGGG + Intergenic
941032761 2:160532051-160532073 CAGACAGGAGCCTGTAGGGTGGG + Intergenic
943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG + Intronic
944314144 2:198267297-198267319 GAGTCATGAGTCTCAAAGCTGGG + Intronic
945211319 2:207386070-207386092 GAGTCAGAAGTCTGTAGAGCAGG + Intergenic
946054525 2:216889210-216889232 GAGTCTGGAGTCTCAAGAGATGG + Intergenic
946198872 2:218058858-218058880 TAGTCAGGAGTGTCAGGGGTGGG - Intronic
947584213 2:231342638-231342660 GATCCAGGAGGATCTAGGGTCGG - Intronic
1170306822 20:14947640-14947662 GAGTCAGAACTCTGCAGGGTGGG - Intronic
1170325261 20:15149845-15149867 GAGTCAGGAAGAGCTAGGGTGGG + Intronic
1170452302 20:16496080-16496102 CTATCAGGAGTCTGTAGGGTTGG - Intronic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1174922866 20:54723318-54723340 GGGGCAGAAGTCTCTAGGATTGG - Intergenic
1175084435 20:56446752-56446774 GATTCAACAGTCTCTGGGGTTGG - Intronic
1175309981 20:58005107-58005129 GAGGTGGGAGTCTCCAGGGTAGG - Intergenic
1175780226 20:61677401-61677423 GAGGCAGGAGTCTGGAGGGAAGG - Intronic
1177357802 21:20031523-20031545 CAGACAGGAGACTCTGGGGTGGG + Intergenic
1178381766 21:32115721-32115743 AAGTCTGAAGTCTCTAGGGCAGG - Intergenic
1181823265 22:25492769-25492791 GAGTCAGGAGTCTCCTGCCTTGG + Intergenic
1182038054 22:27214774-27214796 GAGTGTGGAGTCTCTAGATTTGG + Intergenic
1184749495 22:46477146-46477168 GAGTTTGGTGTCTCCAGGGTCGG - Intronic
1184852491 22:47128382-47128404 GAATCAGGAGTGGCTAGGGGAGG + Intronic
950124031 3:10500699-10500721 GAGTCAGGAGCCAGCAGGGTTGG - Intronic
950125258 3:10506452-10506474 GGGTGAGGAGTCGGTAGGGTTGG + Intronic
950680882 3:14584376-14584398 GAGTCAGGAGCCTCCACGGTGGG - Intergenic
951834033 3:26961410-26961432 GAATGAGGAGACTCTAGGGAGGG + Intergenic
952252252 3:31666049-31666071 GAAAAAGGAGTCTCCAGGGTGGG + Intronic
958897799 3:99848890-99848912 GAGTGAGGACTCTCTGTGGTTGG + Exonic
962381006 3:134898070-134898092 GATTCCGGAGTCTGTGGGGTGGG + Intronic
964232554 3:154487481-154487503 CAGTCAGGAGTCACGGGGGTTGG - Intergenic
965072193 3:163928334-163928356 GCATCAGGAGGCTCTAGGTTAGG - Intergenic
969460694 4:7327251-7327273 GAGTCAGGAGGCTTTGGGGGAGG + Intronic
970504931 4:16718670-16718692 TTGTCATGAATCTCTAGGGTAGG - Intronic
974686743 4:65241578-65241600 GGCTCAGGAGTCTCTAGGTCTGG + Intergenic
981080026 4:140630607-140630629 GAGACAAGAGTTTCTTGGGTGGG - Intronic
981713734 4:147732765-147732787 GGGCCAGGAGTGCCTAGGGTCGG - Intronic
982104863 4:152003021-152003043 GAGTCATGAATTTCCAGGGTAGG - Intergenic
984521246 4:180803724-180803746 GAGTGAGGAGCCTTTAGGGTTGG + Intergenic
985836669 5:2276977-2276999 GAGTCAGGAGGCACCAGGGATGG + Intergenic
987121986 5:14776343-14776365 GAGTCTGGAGTCTGGAGGGTCGG + Intronic
987361684 5:17112812-17112834 AAGAGAGGAGTCTCTAGGATGGG - Intronic
987706202 5:21464172-21464194 GGTTCAGGAGTGTCTAGGCTGGG + Intergenic
988285622 5:29212593-29212615 GAGTCAAGAATCACCAGGGTGGG + Intergenic
988704994 5:33717040-33717062 GAGTCATAACTCTATAGGGTAGG - Intronic
989058260 5:37385222-37385244 GGTTCAGGAGTGTCTAGGCTGGG + Intronic
993884621 5:93401103-93401125 GATTCAGGAGGCTTTGGGGTGGG + Intergenic
995250910 5:109992314-109992336 TACTGAGGAATCTCTAGGGTAGG - Intergenic
998090462 5:139364121-139364143 GATTCAGACATCTCTAGGGTGGG - Intronic
998998737 5:147895818-147895840 GAGTCAGGAGTGTCGGGGTTGGG + Intronic
1001601162 5:172929431-172929453 GAGCCAGCAGTCTCTAGGAATGG + Intronic
1002168053 5:177360209-177360231 GGGTCGGGAGTGTCTAGGATAGG - Intronic
1002282930 5:178143726-178143748 GAGTAAGGAGGCCCTTGGGTGGG + Exonic
1005103502 6:22198938-22198960 GAGTCATGAGTCACGAGGCTGGG + Intergenic
1006303361 6:33205591-33205613 GAGTCAGGAGTCTCAAGGAGGGG - Intronic
1009021923 6:57955474-57955496 GGTTCAGGAGTGTCTAGGCTGGG - Intergenic
1015582997 6:134746600-134746622 GAGTCTCCAGTCTCTAAGGTTGG - Intergenic
1015585811 6:134775110-134775132 GTGTAAGGAGTGTGTAGGGTGGG - Intergenic
1019744355 7:2691299-2691321 GAGTCAGGGGTCTCTGTGCTGGG + Intronic
1019774628 7:2905350-2905372 GAGTCAGGATTCTCTTAGGAAGG + Intergenic
1020272465 7:6605551-6605573 GAGTCAAGAGTCTCCAGGGCAGG - Intronic
1024122630 7:46260588-46260610 GTGTCAGGTGTCCCCAGGGTTGG + Intergenic
1026614384 7:71888674-71888696 GAGTTAGTCGTTTCTAGGGTAGG + Intronic
1029514602 7:101017631-101017653 GAGTCAACAGTCTCCAGGGTGGG - Exonic
1033030440 7:137820880-137820902 GGGTGAGGAGTCTCTAGTTTCGG + Intronic
1033254150 7:139785026-139785048 GACTCAGGAATCTCTGGGGGTGG + Intronic
1033437026 7:141342454-141342476 GAGTGAGGAATCTCTTGGGAGGG + Intronic
1034916322 7:155042833-155042855 AAGTCAGAGGTCTATAGGGTGGG - Intergenic
1037839976 8:22237791-22237813 GAGTCAAGAGTCGCAAGGCTGGG + Intergenic
1038749778 8:30284736-30284758 GAGGCGGAAGTCTCTAGGCTGGG - Intergenic
1039923022 8:41906463-41906485 GAGTAAAGAGTCCCTGGGGTGGG + Intergenic
1040815990 8:51508989-51509011 GAGTAAGGAGGCAGTAGGGTAGG - Intronic
1041527313 8:58821921-58821943 GAGTCTGTAGTCTCTGGGGCGGG - Intronic
1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG + Intergenic
1042490649 8:69393867-69393889 GAGATAGGAGTCTCTAAAGTTGG - Intergenic
1047519081 8:125580576-125580598 CGGGCAGGAATCTCTAGGGTGGG + Intergenic
1049281079 8:141745160-141745182 TAGTCAGGATTCTCCAGGGTAGG - Intergenic
1052720423 9:32166567-32166589 GAGTCAGGAAGAGCTAGGGTGGG + Intergenic
1053015952 9:34662254-34662276 GAGTCAGGGGTATCAGGGGTGGG + Intronic
1057233131 9:93337220-93337242 GAGTCAGGAAGCTCTAGGCTTGG - Intronic
1058138737 9:101336162-101336184 GAGTCAAGGCTCTCCAGGGTTGG + Intergenic
1058376814 9:104331911-104331933 GAGTCAGGAGTGTGCATGGTGGG + Intergenic
1060822522 9:126669766-126669788 GGGTCAGTTGTCTCTAGGGCAGG + Intronic
1060921354 9:127422722-127422744 GATTCAGGACTCTCAAGTGTGGG + Intergenic
1189146943 X:38665172-38665194 GAGACATTAGGCTCTAGGGTGGG + Intronic
1190402944 X:50057183-50057205 AGTTCAGGAGTTTCTAGGGTAGG + Intronic
1191232054 X:58103771-58103793 GAGCCAGGAGTCTCTCCCGTTGG - Intergenic