ID: 1172397117

View in Genome Browser
Species Human (GRCh38)
Location 20:34616054-34616076
Sequence GAGGAGTCCTGGGACAAACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172397114_1172397117 -10 Left 1172397114 20:34616041-34616063 CCTGGAGGAGATAGAGGAGTCCT 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1172397117 20:34616054-34616076 GAGGAGTCCTGGGACAAACAAGG 0: 1
1: 0
2: 2
3: 26
4: 265
1172397112_1172397117 4 Left 1172397112 20:34616027-34616049 CCAGCAAGTGCTTACCTGGAGGA 0: 1
1: 0
2: 3
3: 11
4: 117
Right 1172397117 20:34616054-34616076 GAGGAGTCCTGGGACAAACAAGG 0: 1
1: 0
2: 2
3: 26
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172397117 Original CRISPR GAGGAGTCCTGGGACAAACA AGG Exonic
900325024 1:2104492-2104514 GAGGAGTGAGGGGACAGACAGGG + Intronic
900947077 1:5837104-5837126 CAGAAGTCCTGGAAGAAACAGGG + Intergenic
900975540 1:6013893-6013915 GAGAAGTCCAGAGACAAATACGG - Intronic
901089580 1:6632417-6632439 GGACAGTCCTGGGAGAAACATGG + Exonic
901625886 1:10624815-10624837 GAGGGGTTCTGGAACAGACAGGG + Intronic
901786641 1:11629314-11629336 GAGGAGTCCTGGGACAACGTTGG + Intergenic
901800937 1:11707687-11707709 GGGGAGCACTGAGACAAACAGGG - Intronic
901974116 1:12930710-12930732 GTGTACTCCAGGGACAAACATGG + Intronic
902011062 1:13271058-13271080 GTGTACTCCAGGGACAAACATGG - Intergenic
902892002 1:19451280-19451302 CTGGAGTCATGGGACAAAAAGGG + Intronic
902908459 1:19577064-19577086 GAGGATTCCAGAGACAAACTGGG - Intergenic
903213754 1:21832071-21832093 GAGGAGTCCTCAGAGGAACAAGG - Intronic
903836086 1:26204051-26204073 AAGAAGTCCTGGCTCAAACAGGG - Intergenic
908772399 1:67608992-67609014 AAGGAGGCCTGGGAGAAATAAGG - Intergenic
909367891 1:74849526-74849548 GAGCAGTGCTGCAACAAACATGG + Intergenic
909386263 1:75060328-75060350 GAGCAGTGCTGCAACAAACATGG - Intergenic
909575829 1:77174828-77174850 GTGGAGTCCTTGGAGGAACAGGG - Intronic
911246041 1:95518692-95518714 GAGAACTTCTGGGACAAACACGG + Intergenic
912755147 1:112318208-112318230 GATGAGTCCTGGAACCAACGAGG - Intergenic
913526485 1:119698533-119698555 GAGAAGGCCTGGGGCAAAAATGG - Intronic
918148024 1:181774938-181774960 GAGGAGTCCTGGGGCAGAGCAGG + Intronic
918465109 1:184813103-184813125 GTGGAGTCCTTGGAAGAACAGGG - Intronic
920058014 1:203206635-203206657 GAGGAGGCCTAGGAAAAGCACGG + Intergenic
920157717 1:203968763-203968785 GTGGAGTCCTTGGAAGAACAGGG + Intergenic
920914523 1:210249397-210249419 GAGAAGTCCTGGGACCCCCATGG - Intergenic
921748601 1:218766604-218766626 GATTAGTCCTGGGAAAATCAGGG + Intergenic
921748678 1:218767366-218767388 GATTAGTCCTGGGAAAATCAGGG - Intergenic
922469277 1:225865935-225865957 GGGGAGTCCTGTGATGAACAGGG + Exonic
922759612 1:228119195-228119217 GCGGAGTCCTCGGAGGAACAGGG + Intergenic
923746443 1:236704955-236704977 AAGGAGTCCTGCCACAAACCTGG - Intronic
923776498 1:236983372-236983394 AAGGAGTTCTGGAACTAACACGG - Intergenic
1064521116 10:16202395-16202417 GAAGAGTGCTGCAACAAACATGG + Intergenic
1068348765 10:55817100-55817122 GTGGAGTCCTTGGAGGAACAGGG + Intergenic
1068532882 10:58209241-58209263 GTGGAGTCCTGGGGAGAACAAGG + Intronic
1069157053 10:65042601-65042623 GAGCAGTGCTGCAACAAACATGG + Intergenic
1069757168 10:70780386-70780408 GAGGAGTCCTGGCACCAAAAGGG - Intronic
1071462873 10:85915020-85915042 GAGGAGGCCAGGGCCAGACAGGG + Intronic
1072714698 10:97742979-97743001 GAGGAGGCCTGGAACACAGAAGG - Intronic
1073146120 10:101282990-101283012 GAGGAGGCCTGGGAGAAAGGAGG - Intergenic
1073184140 10:101605396-101605418 GAGGAGTCGTCTGTCAAACAGGG + Intronic
1073242681 10:102068458-102068480 GAGGAGTCCTGGGGAAAGGAAGG - Intergenic
1073890825 10:108098511-108098533 GATTAGTCCTGTGATAAACATGG - Intergenic
1075466731 10:122657040-122657062 CAGGAGTCCTTGGACAAGCAAGG - Intergenic
1076406244 10:130214158-130214180 GAGGAGGCCAGGGACGAATAGGG - Intergenic
1076452153 10:130563909-130563931 GTGGGATCCTGGGACAAAAAAGG - Intergenic
1076637486 10:131891829-131891851 GAGGAGTCCGGGGAAAGAAAAGG + Intergenic
1080330740 11:31134387-31134409 GAGGAGTCCTGTGACTCTCAGGG - Intronic
1080810632 11:35701049-35701071 GTGGAGTCCTTGGAAGAACAGGG + Intronic
1080985825 11:37463802-37463824 GAGTAGTACTGCAACAAACATGG - Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083312981 11:61794971-61794993 GAGGAGTCCAGGGACCATAATGG - Intronic
1083730109 11:64648296-64648318 GAAGAGTCCTGTGCCAACCAGGG - Exonic
1084803511 11:71563310-71563332 GAGCAGTGCTGTGATAAACATGG + Intronic
1085514677 11:77105324-77105346 GAGGAGGCCTGGAATAATCAGGG + Intronic
1086801299 11:91179584-91179606 GTGGGGTGCTAGGACAAACAGGG - Intergenic
1087078889 11:94150944-94150966 GAGGAGTGCTGAGAGAAACTGGG + Intronic
1087524831 11:99296649-99296671 GTGGAGCCCTTGGAAAAACAGGG + Intronic
1088374264 11:109122957-109122979 GAGCAGTGCTGTGATAAACATGG + Intergenic
1089193710 11:116678008-116678030 GAGTAGTGCTGTGATAAACATGG - Intergenic
1089794031 11:120966172-120966194 AAGGAGGACTGGGAGAAACAGGG + Intronic
1089829163 11:121310141-121310163 GAGGAGGTCTGGGAGAAAGATGG + Intergenic
1091644146 12:2260816-2260838 AAGGAGTCCTGAGACCAAAAAGG - Intronic
1092629719 12:10364399-10364421 GAGGAATCCTGGGGCAAGGAAGG + Intergenic
1093332943 12:17865295-17865317 GAGGAGTGCGGGGAAAAAAAAGG + Intergenic
1101279525 12:103238156-103238178 GAAGGGACATGGGACAAACATGG + Intronic
1102643019 12:114383187-114383209 GAGGGGTCCTGGGGGAGACATGG + Intronic
1103798196 12:123519642-123519664 GAACAGACCTGGGACAGACAGGG - Intronic
1105286516 13:19008816-19008838 GAGGAGTAGGGGGACAGACAGGG - Intergenic
1105435939 13:20378384-20378406 GAGAAGTGCTGGGACAGACGAGG - Intergenic
1105543761 13:21337280-21337302 GAGCAGGCCTGGAAGAAACAAGG - Intergenic
1105888297 13:24661632-24661654 GAATAGTGCTGGGATAAACATGG + Intergenic
1106254362 13:28009400-28009422 GAGGATGCCTGGGAAAAACAAGG - Intronic
1107161144 13:37229558-37229580 GAGGAGACCTGGAAAAAGCATGG + Intergenic
1108125361 13:47237068-47237090 CAGGAGTCCTGGGCAAACCAGGG - Intergenic
1108843492 13:54650589-54650611 TAGGAGTCCAGGGAAAAACATGG - Intergenic
1110428355 13:75395134-75395156 AAGGAGGCCTGAGACAGACATGG + Intronic
1110493940 13:76142952-76142974 GTGTAGTCCTGGCACTAACAGGG + Intergenic
1113636902 13:111925647-111925669 GAGGAGGCCTGGGACAAATGAGG + Intergenic
1115028047 14:28766023-28766045 GAGGAGCGCGGGGCCAAACAGGG - Intergenic
1115387451 14:32814021-32814043 GACTGGTGCTGGGACAAACAAGG + Intronic
1116678840 14:47940014-47940036 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
1117934142 14:60882523-60882545 GAACAGTCCTGTAACAAACATGG + Intronic
1119643418 14:76330829-76330851 GAGGAGTCCTGGGAGAATCTGGG + Intronic
1119776089 14:77249650-77249672 GAGGAGGCCCTGGACCAACATGG + Intronic
1119786013 14:77314932-77314954 GAGGGATCCTGGGACATAAAGGG - Intronic
1122852409 14:104543763-104543785 GAGGAGTGTTGGGACAAATAAGG - Intronic
1123037077 14:105475870-105475892 GAGGAGGGCCGGGACCAACAGGG + Intronic
1123041472 14:105491932-105491954 GAGGAGACCAGGGGCCAACAGGG - Intronic
1124040033 15:26093495-26093517 GTGGAGTCCTTGGAGGAACAGGG + Intergenic
1124424222 15:29549692-29549714 GAGGAGTCCAGGGATGAACTGGG - Intronic
1125877169 15:43159681-43159703 GAGCAGTGCTGCAACAAACATGG + Intronic
1127155346 15:56118635-56118657 GAATAGTGCTGGGATAAACATGG + Intronic
1129696990 15:77746472-77746494 AAGGAGTTCTGGGGCAATCAGGG - Intronic
1130209461 15:81909982-81910004 AAGGAGCCCTGGGGCCAACATGG + Intergenic
1132459225 16:42082-42104 AAGGAGTCCTGGGGCAAAGGAGG + Intergenic
1136147580 16:28324435-28324457 GAGGAATCCTGGTACACAAAAGG - Intergenic
1141303409 16:82838727-82838749 GAGAAGTACTGGGACAACCTAGG - Intronic
1141542709 16:84738465-84738487 GAGGCTTCCTGAGACACACATGG + Intronic
1143248361 17:5504110-5504132 GAGGAATCCTAGGACACACATGG + Intronic
1143565205 17:7716901-7716923 GGGGAGACCTGGGAAATACAGGG - Intergenic
1144799370 17:17914431-17914453 GAGCAGACCTGGGCCTAACAGGG - Intronic
1145995013 17:29100065-29100087 GAGCAGTCATTGGTCAAACAGGG + Intronic
1146537610 17:33666635-33666657 GAGGTGGACTGGGACAGACAAGG - Intronic
1146944282 17:36863406-36863428 AAGGTCTCCTGGGACAGACAGGG + Intergenic
1146948441 17:36889949-36889971 GAAGAGGCCTGGGACAGGCAGGG - Intergenic
1147214472 17:38891163-38891185 GAGGGCTCCTGGGACAAACCTGG + Intronic
1148115234 17:45171501-45171523 GAGGAGGCCTGGGACAAAGGTGG + Intergenic
1148174320 17:45550535-45550557 CTGGAGTCCTGGGACCACCAGGG - Intergenic
1148192975 17:45692733-45692755 GAGCAGTGTTGGGACGAACAAGG + Intergenic
1148274942 17:46294912-46294934 CTGGAGTCCTGGGACCACCAGGG + Intronic
1148297049 17:46512491-46512513 CTGGAGTCCTGGGACCACCAGGG + Exonic
1148361602 17:47016971-47016993 CTGGAGTCCTGGGACCACCAGGG + Intronic
1148698068 17:49573032-49573054 GAGGATTCCAGGGAGGAACAGGG - Intergenic
1149689296 17:58560792-58560814 GAGGAGTCCTAGGACACATGTGG - Intronic
1150784676 17:68152669-68152691 CAGGAGTCCTGGGACCACCCGGG - Intergenic
1152585401 17:81187297-81187319 GAAGAGGCCTGGGACACTCATGG - Intergenic
1153714417 18:7832067-7832089 CAGGAGTGCTGCAACAAACATGG + Intronic
1156387782 18:36621889-36621911 GACTAGTGCTGCGACAAACATGG - Intronic
1158963385 18:62604272-62604294 GGGGAGTCCTGGGAGCAGCAAGG + Intergenic
1161744229 19:6045307-6045329 GATGAAACCTGGGACACACATGG + Intronic
1162272520 19:9628048-9628070 GCGGATTCCTTTGACAAACAAGG - Intronic
1162802816 19:13120263-13120285 GAGGAGGCCTGGCACCACCAGGG + Intronic
1164547365 19:29179688-29179710 GAGCAGTGCTGCAACAAACACGG - Intergenic
1164908551 19:31986918-31986940 GAGGTGTACTGGGACCAACATGG - Intergenic
1167253019 19:48410960-48410982 GAGGAGTCCAGGGACACCCCCGG + Intronic
1168034664 19:53709848-53709870 CAGGCATCCTGGGACACACAGGG + Intergenic
926521790 2:13924400-13924422 GTGGAGTCCTTGGAATAACAGGG - Intergenic
927469052 2:23358598-23358620 GAGCTGCCCTGGGACAAGCAGGG + Intergenic
927653239 2:24924802-24924824 GGGGATTCATGGGACCAACATGG + Intergenic
927985317 2:27406105-27406127 GAGGACTCTTGAGACAAAAATGG - Intronic
928486122 2:31734045-31734067 GAGGAGTGCTGCAATAAACATGG - Intergenic
930229845 2:48832371-48832393 GAGCAGTGCTGCAACAAACATGG + Intergenic
932500172 2:72176320-72176342 GAGGAGTCCTGGGAGAAGGGAGG + Exonic
932965905 2:76474264-76474286 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
933242978 2:79943409-79943431 AAGAAGTCCAGAGACAAACATGG + Intronic
933770694 2:85742108-85742130 GAGGAGTCCGGGGATGGACAGGG - Intergenic
934060298 2:88286184-88286206 GAGGAGCCCTGGGAGAAGGAAGG + Intergenic
937261719 2:120590930-120590952 GAGCAGTCCTGGGCCCAGCAAGG - Intergenic
938155375 2:128934105-128934127 GAGGAGTGCTGCAATAAACATGG + Intergenic
938299286 2:130198737-130198759 GAGCAGGCCTGGGGCAATCAGGG - Intergenic
940600398 2:155851773-155851795 GAGGAGGTCTGAGAAAAACAAGG - Intergenic
941228156 2:162875067-162875089 GAGTAGTGCTGCAACAAACATGG - Intergenic
941639623 2:167972983-167973005 GTGGAGTCCTTGGAAGAACAGGG - Intronic
943228169 2:185208444-185208466 GAGGAATCCTGCTACTAACAGGG - Intergenic
943551762 2:189349251-189349273 GAGGAGTCTCAGGGCAAACATGG + Intergenic
944583219 2:201150951-201150973 GAGGAGTCCTGGAACCCAGAGGG + Intronic
944894266 2:204147937-204147959 GAGTAGTACTGAGATAAACATGG + Intergenic
945060733 2:205906608-205906630 CAGGAGGCCTGGAACAAACGCGG - Intergenic
946164235 2:217854125-217854147 CAGGGGTCCTGGCACACACATGG + Intronic
946201451 2:218073051-218073073 CAGGAGTCCTGGGAGCATCAGGG + Intronic
946372303 2:219288250-219288272 GAGGTGTCCTTGGACAAATGGGG - Intergenic
946635961 2:221726987-221727009 GAGAATTCCTGGGAGACACATGG - Intergenic
947039702 2:225902968-225902990 GAATAGTCCTGCAACAAACATGG - Intergenic
948775161 2:240283684-240283706 GAGCAGTGCTGCAACAAACATGG - Intergenic
1168767091 20:388984-389006 GAGGATTCCTGGCAGAAACCAGG + Intronic
1169646358 20:7814185-7814207 GAGCAGTACTGCAACAAACATGG + Intergenic
1171335498 20:24381773-24381795 CAAGGGTCCTGGGAGAAACAAGG - Intergenic
1171964274 20:31517477-31517499 CAGGAGTTCCGGGACAAAGAAGG + Intronic
1172388449 20:34549890-34549912 ATGGAGTCCTGGGGGAAACAGGG - Exonic
1172397117 20:34616054-34616076 GAGGAGTCCTGGGACAAACAAGG + Exonic
1173392516 20:42647681-42647703 AAGGAGTCATGGGAGACACAAGG + Intronic
1174499954 20:50977077-50977099 GAGGTTTCCAGGGAAAAACAGGG + Intergenic
1175711742 20:61226876-61226898 GAGGTTTCCTGTGAGAAACAAGG - Intergenic
1175921024 20:62450784-62450806 GGGGGGTCCTGGGACAAAGAGGG - Intergenic
1176129608 20:63491110-63491132 GAGGAGTCCTCAGACAAAGGAGG - Intronic
1177213448 21:18098775-18098797 GAGCAGTGCTGTAACAAACATGG - Intronic
1178049616 21:28733359-28733381 GAGGAATTCTGCTACAAACAGGG - Intergenic
1178721202 21:35011206-35011228 GAGTATTCTTGGGACAAACAGGG + Intronic
1181683568 22:24513427-24513449 GAGCAGTCCTGGGAAAGACCAGG + Exonic
1183830596 22:40416636-40416658 GAGGAGCCTTAGGACAAAAATGG - Intronic
1184926638 22:47645964-47645986 GAGTAGTGCTGGCATAAACATGG + Intergenic
1185010401 22:48309566-48309588 AAGGAGGCCTGGGAGAACCACGG - Intergenic
949242945 3:1892822-1892844 GAGCAGTGCTGCAACAAACATGG - Intergenic
950185016 3:10939537-10939559 GAGGTGGCCTGGGACAGAGAAGG - Exonic
950605707 3:14078168-14078190 GTGGAGTCCTTGGAAGAACAGGG + Intronic
953571349 3:44074249-44074271 GAGGAGTCCTAGCACCTACAGGG - Intergenic
957758911 3:84530203-84530225 GAGGTGTCTTTGGACAAAAATGG - Intergenic
958798305 3:98730047-98730069 GAGGACTCTTGGGACATGCAAGG - Intergenic
959872850 3:111348881-111348903 GTGGAGTCCTTGGAGGAACAGGG + Intronic
961011956 3:123442386-123442408 GAGGAGGCCTGGCCCGAACATGG + Intronic
961230069 3:125298172-125298194 GAGGAGTGCTGTGACCAAAAGGG + Intronic
962729617 3:138268300-138268322 CAGGAATCTTGGAACAAACAGGG + Intronic
964961714 3:162436181-162436203 GTGGAGCCCTTGGAGAAACAGGG + Intergenic
966244196 3:177788143-177788165 GTTGAGTCCTCTGACAAACAGGG - Intergenic
967038738 3:185669838-185669860 CAGGAGTCCTGGGCCCACCAGGG + Intronic
968209545 3:196837194-196837216 GGGTTGTCCTGGGACAACCAGGG + Intergenic
969344351 4:6562032-6562054 GAGGACACCTGGGACAGAGAAGG + Intronic
969467968 4:7368803-7368825 CAGGTGTCCTGGGAGAAACCCGG + Intronic
971446318 4:26753199-26753221 GAGGTGTCCTGATAGAAACATGG - Intronic
972590846 4:40485431-40485453 TTGGAATCCTGGAACAAACATGG - Intronic
973884209 4:55304418-55304440 GAGTAGTGCTGGGTCAAGCATGG - Intergenic
974179614 4:58366895-58366917 GAGCAGTCCTGGGATATTCATGG + Intergenic
974475594 4:62375156-62375178 GTGGATTCCTGGCACTAACATGG + Intergenic
976847583 4:89507814-89507836 GAGGAGTCCTTGGAAAAGCGGGG - Intergenic
977845920 4:101766793-101766815 GATGAGTGCTGCAACAAACATGG + Intronic
978105452 4:104896751-104896773 GTGTAGTCATGGGAAAAACAAGG - Intergenic
978438195 4:108708213-108708235 AAGGAGTCTTGGGTAAAACATGG - Intergenic
981201085 4:141980164-141980186 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
982318175 4:154052297-154052319 GAGTAGTTCTGTAACAAACATGG + Intergenic
982425623 4:155255574-155255596 GAGTAATACTGGGATAAACATGG - Intergenic
985271985 4:188202510-188202532 GAAGAGGCATAGGACAAACAGGG - Intergenic
985860737 5:2468864-2468886 GAGCATGCCTGGGACAACCAAGG + Intergenic
987166065 5:15199953-15199975 GTGGAGCCCTTGGAAAAACAGGG + Intergenic
987744519 5:21952591-21952613 CAGAAGTCCTTGGACAATCAGGG + Intronic
988075866 5:26353613-26353635 GAAGAGTCCTGCAATAAACATGG + Intergenic
988334095 5:29882803-29882825 GAGGACTCCGGGGACGAAGAAGG - Intergenic
988534075 5:32050476-32050498 GATGAATCCTGGGAGAAAAAGGG - Intronic
990290599 5:54346807-54346829 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
991764725 5:69962713-69962735 CAGAAGTCCTTGGACAATCAGGG + Intergenic
991782599 5:70155440-70155462 CAGAAGTCCTTGGACAATCAGGG - Intergenic
991843957 5:70837784-70837806 CAGAAGTCCTTGGACAATCAGGG + Intergenic
991875042 5:71155754-71155776 CAGAAGTCCTTGGACAATCAGGG - Intergenic
991985445 5:72281230-72281252 GAACAGTCTTGGGACAAAGAAGG - Intronic
993205975 5:84878608-84878630 GAACAGTCCTGCAACAAACATGG - Intergenic
994346234 5:98690313-98690335 GAAGAGTTCTGCAACAAACATGG - Intergenic
997143836 5:131411017-131411039 GAGCAGTGCTGTAACAAACATGG - Intergenic
997516783 5:134495651-134495673 GAGGAGTCCTGGGCCAAGAATGG - Intergenic
999325716 5:150642254-150642276 CAGGAGACCTGGGTCCAACAGGG - Intronic
1000582758 5:163054193-163054215 AATGAGGCCTGGGACAAAGAGGG + Intergenic
1001106392 5:168858247-168858269 GAGAAGTTCTGGGACATGCAAGG + Intronic
1002772161 6:299279-299301 GAGGAGACCTGGGAACCACAAGG - Intronic
1002856258 6:1040592-1040614 GAGGAGTGCTGGGACAGACAGGG + Intergenic
1003116534 6:3287262-3287284 GAGGAGACGTGGGAGAAATATGG + Intronic
1003408265 6:5840765-5840787 GAGCAGGCCTGGAAGAAACAAGG + Intergenic
1004199967 6:13538920-13538942 GATGAGTCCTGGGTGAAACAGGG + Intergenic
1005684948 6:28245339-28245361 GGGGAGTCCTGGGAAAGTCAGGG - Exonic
1006145096 6:31954251-31954273 GAGAAGTCCTGGGAGAATCCTGG - Intronic
1006819474 6:36880313-36880335 GTGGAGTCCTTGGAGGAACAGGG - Intronic
1007190552 6:40013251-40013273 GAGTAGTACTGCAACAAACATGG + Intergenic
1007512253 6:42382568-42382590 GTGGAGGCCTAGGAAAAACATGG - Intronic
1010303694 6:74291040-74291062 GAACAGCGCTGGGACAAACATGG + Intergenic
1012568953 6:100699214-100699236 GATGTGTCGTGGGACTAACACGG + Intronic
1014738563 6:125122875-125122897 GTGGAGTCCTTGGAGGAACAGGG - Intronic
1015377612 6:132528208-132528230 GTGGAATCCTTGGAAAAACAGGG - Intergenic
1015378414 6:132536747-132536769 GAGGAATCCTAGGAGTAACAAGG + Intergenic
1016234259 6:141843567-141843589 GAATAGTCCTGCAACAAACATGG + Intergenic
1016854473 6:148652714-148652736 GTGGAGTCCTTGGATGAACAGGG - Intergenic
1017722375 6:157252900-157252922 GCCAAGTCCTGGGCCAAACATGG - Intergenic
1018395501 6:163375199-163375221 GTGGAGTCCCGGGAGGAACAAGG + Intergenic
1021243371 7:18232390-18232412 GTGGAGGCTTGGGACAAACTTGG - Intronic
1021604895 7:22400107-22400129 GAGGAGTCCTGAGAGAAATATGG + Intergenic
1023847165 7:44128836-44128858 GGGGGGTCCTGGGAGAAGCATGG + Intergenic
1027960894 7:84943391-84943413 GTGGAGTCCTCGGAATAACAAGG - Intergenic
1028164066 7:87517828-87517850 GAGGTGTCCAGGCACGAACATGG - Intronic
1028420588 7:90628356-90628378 GAGGAGTCCTGGAAAAATCAGGG - Intronic
1029281658 7:99439313-99439335 GAGGAGTCCTGCGACCAAAGGGG - Intronic
1032520993 7:132545084-132545106 GAGGAGTCCTGGTACAGAATAGG - Intronic
1034706286 7:153148076-153148098 GAGGAGTTGAGGGATAAACATGG + Intergenic
1035383791 7:158457313-158457335 GAGGAGCCCTGGGAGGGACACGG - Intronic
1035479173 7:159168391-159168413 GAGTAGTCCTGTGGTAAACATGG - Intergenic
1035718318 8:1771013-1771035 AAGGAGTCCTGGGGCCAACACGG - Exonic
1036605688 8:10303614-10303636 GAGGGGTCCTGGGGCAGTCAGGG - Intronic
1039829649 8:41202616-41202638 GAGCAGGCCTGGGTCAAACAGGG + Intergenic
1040526464 8:48229478-48229500 GTGGAGCCCTTGGAGAAACAGGG - Intergenic
1040914152 8:52552051-52552073 GTGGCATCCTGGGACAAAAAAGG - Intronic
1047535698 8:125717683-125717705 GAGGTGCCCTAGGACAAAGATGG - Intergenic
1048296042 8:133214580-133214602 GAGGTGTCTTGGAACAAAAAAGG - Intronic
1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG + Intergenic
1049909428 9:251037-251059 GAGGAGTCTAGGGACAGACAGGG + Intronic
1050356686 9:4790606-4790628 GAAGAGTGCTGCAACAAACATGG - Intergenic
1050657911 9:7849082-7849104 GTGGAGTCCTTGGAAGAACAGGG - Intronic
1051875347 9:21787329-21787351 GAAGAGGCCAGGGACAAACTGGG + Intergenic
1052692046 9:31827370-31827392 GAGCAGTGCTGCAACAAACATGG - Intergenic
1053029336 9:34760699-34760721 CAGGGGTCCTGGGCCAAACGCGG + Intergenic
1054956497 9:70916995-70917017 TAGAAGTCCTGGGACAAACAAGG + Intronic
1055252037 9:74319346-74319368 GAGCAGTGCTGCAACAAACATGG - Intergenic
1055416631 9:76091149-76091171 GAGGACTCCTGGCTTAAACAAGG + Intronic
1055970836 9:81911272-81911294 GTGGAGTCCTTGGAAGAACAGGG + Intergenic
1056009554 9:82312821-82312843 GAATAGTGCTGGAACAAACATGG - Intergenic
1056041852 9:82676432-82676454 TGGCAGACCTGGGACAAACATGG + Intergenic
1057202873 9:93152248-93152270 GTGAAGTCCAGGGAGAAACAGGG + Intergenic
1057444197 9:95102673-95102695 GAATAGTCCTGGGAAAACCAAGG - Intronic
1059416072 9:114163370-114163392 GAGCACTCATTGGACAAACAGGG - Intronic
1059553864 9:115258848-115258870 AAGGATTCCTGGGAGAATCATGG - Intronic
1060306719 9:122420444-122420466 GTGGAGTCCTTGGAGGAACAGGG + Intergenic
1060681587 9:125569685-125569707 GTGGAGTCCTTGGAAGAACAGGG - Intronic
1061496477 9:130977754-130977776 GAGGAGTCCTCGGAAAGACCAGG + Intergenic
1062721730 9:138047821-138047843 GAGGAGACCTGGGAGAGAGAGGG + Intronic
1185810482 X:3104510-3104532 GAAGAGTGCTGCGATAAACATGG + Intronic
1187049944 X:15685861-15685883 GAAGAGCCCAGGGACATACAAGG + Intergenic
1188127034 X:26381679-26381701 GAGAAGTTCTGGGAAAAATAAGG + Intergenic
1188588800 X:31809021-31809043 GAAGAGTCCTGGGAAAATGAAGG + Intronic
1190477969 X:50847128-50847150 GTGGAGCCCTTGGAGAAACAGGG + Intergenic
1192002225 X:67165158-67165180 GAAGAGTGCTGAGACAAACATGG - Intergenic
1192068074 X:67907673-67907695 GAAGAGTGCTGCAACAAACATGG - Intergenic
1193321250 X:80124016-80124038 GAACAGTCCTGCAACAAACACGG + Intergenic
1193490090 X:82138756-82138778 GAACAGTCCTGTAACAAACATGG - Intergenic
1194010997 X:88560810-88560832 GAGGAGAAGTTGGACAAACAAGG + Intergenic
1194478793 X:94394168-94394190 GAAGAGTGCTGCAACAAACATGG + Intergenic
1199750677 X:150814694-150814716 GGGGAGTCCTGAGACAAAAAAGG + Intronic
1199916473 X:152347041-152347063 GAACAGTCCTGTGACAAACATGG - Intronic
1200073745 X:153541284-153541306 TAGGAGGCCTGGGACACACAAGG + Intronic
1201277518 Y:12312890-12312912 GAGGAGTCCTGGGGCAGGAAAGG + Intergenic
1201750076 Y:17422514-17422536 GATGAGTCCGAGGACTAACAAGG - Intergenic