ID: 1172400183

View in Genome Browser
Species Human (GRCh38)
Location 20:34643966-34643988
Sequence CTTTACTAACAGATAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 337}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172400183_1172400190 15 Left 1172400183 20:34643966-34643988 CCCTTCTTTATCTGTTAGTAAAG 0: 1
1: 0
2: 2
3: 32
4: 337
Right 1172400190 20:34644004-34644026 GGGGTTGATCATTCCAGAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 131
1172400183_1172400187 -6 Left 1172400183 20:34643966-34643988 CCCTTCTTTATCTGTTAGTAAAG 0: 1
1: 0
2: 2
3: 32
4: 337
Right 1172400187 20:34643983-34644005 GTAAAGCTGTCTTGTGGGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 119
1172400183_1172400191 24 Left 1172400183 20:34643966-34643988 CCCTTCTTTATCTGTTAGTAAAG 0: 1
1: 0
2: 2
3: 32
4: 337
Right 1172400191 20:34644013-34644035 CATTCCAGAGCTGGCTGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 190
1172400183_1172400188 -5 Left 1172400183 20:34643966-34643988 CCCTTCTTTATCTGTTAGTAAAG 0: 1
1: 0
2: 2
3: 32
4: 337
Right 1172400188 20:34643984-34644006 TAAAGCTGTCTTGTGGGTTTGGG 0: 1
1: 0
2: 1
3: 26
4: 160
1172400183_1172400189 -4 Left 1172400183 20:34643966-34643988 CCCTTCTTTATCTGTTAGTAAAG 0: 1
1: 0
2: 2
3: 32
4: 337
Right 1172400189 20:34643985-34644007 AAAGCTGTCTTGTGGGTTTGGGG 0: 1
1: 0
2: 1
3: 28
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172400183 Original CRISPR CTTTACTAACAGATAAAGAA GGG (reversed) Intronic
904512085 1:31019650-31019672 CTTTACTTTCAGATTCAGAAGGG - Intronic
906632998 1:47388045-47388067 CTTTCATAACAGGTAAAGGAAGG + Intergenic
907245572 1:53106325-53106347 CTTTCCTACTAGATAAAAAACGG + Intronic
907519691 1:55015131-55015153 ATATACTAACAGATACAAAAGGG + Intergenic
908143251 1:61209978-61210000 CTGTACTAACAGAAAAAGGCTGG - Intronic
909065984 1:70936442-70936464 TTTTACTAACAAGTATAGAATGG + Intronic
909314004 1:74192203-74192225 ATGTCCTAACAGATAAGGAAAGG - Intronic
909968329 1:81946994-81947016 TTTAACTAACACATACAGAATGG - Intronic
910451581 1:87352066-87352088 CTCTACTCTCAGAGAAAGAAAGG - Intergenic
911055731 1:93706839-93706861 CTTTAGTAATAGATCATGAATGG - Intronic
911462191 1:98205080-98205102 CTTTAATGACAGAGAAACAATGG + Intergenic
911488947 1:98538113-98538135 CTTTAGTAAGAGACCAAGAAAGG - Intergenic
911974189 1:104471000-104471022 CTTTACTAACAGTTATTGATGGG - Intergenic
912082149 1:105950105-105950127 CTGTACTTAAAGATACAGAATGG - Intergenic
912178858 1:107193480-107193502 TATTACTAAAAGATTAAGAAAGG - Intronic
913015485 1:114729620-114729642 TTTTACTAACAGATGGAGACAGG - Intronic
914974220 1:152344384-152344406 CTTGATGAACATATAAAGAAAGG + Intergenic
919492003 1:198215592-198215614 CTTAACTAAAAGATACAGATTGG + Intronic
919719664 1:200819706-200819728 GTTTACTAACATATCGAGAAGGG - Intronic
920638512 1:207728669-207728691 CTTTCCTCACAGAAAGAGAAGGG + Intronic
920784177 1:209024679-209024701 CTTTATTAGCAGAGTAAGAATGG + Intergenic
920896799 1:210059161-210059183 CTTTACTAACAGAAAGTGACTGG + Intronic
923250920 1:232179043-232179065 CTTCTAAAACAGATAAAGAAGGG + Intergenic
924411025 1:243805769-243805791 CTTTACTAACAGGGAATGAGAGG - Intronic
1064038238 10:11934335-11934357 TTTTCCTCACAGATAGAGAATGG + Intronic
1064437740 10:15326092-15326114 CTTTCCCAACAGATAAATTAGGG - Intronic
1064829814 10:19450295-19450317 CTTTACTTTCAGACAGAGAAAGG + Exonic
1065148943 10:22801964-22801986 CTATACTAACAGCCAAAGAGGGG + Intergenic
1065315474 10:24459612-24459634 TCTTATTTACAGATAAAGAAAGG + Intronic
1065592425 10:27278930-27278952 CCTTAGTAACAGCTAAATAAGGG - Intergenic
1065651072 10:27892476-27892498 TTTTCCTATCAGATAATGAATGG + Intronic
1066108886 10:32179172-32179194 CTTGACTAACTGCTAAACAAGGG + Intergenic
1066486788 10:35853576-35853598 CTTTACTGTCAAACAAAGAATGG - Intergenic
1066676360 10:37891641-37891663 CTTTACTGACAGAAAAATAGAGG - Intergenic
1068338575 10:55670422-55670444 CTTTAGTCACAGATCAACAAAGG + Intergenic
1068354613 10:55895423-55895445 CTTTACCAGCAGAGAAGGAAAGG - Intergenic
1068434723 10:56975273-56975295 CTTGACTAAAAGAGAAAAAAAGG - Intergenic
1068491951 10:57735550-57735572 CTTTTGTAACAGATACAGAGGGG + Intergenic
1068623447 10:59211808-59211830 CTTTAGTAAAAGCTAATGAAAGG + Intronic
1068719915 10:60233239-60233261 CTTTATTTTCAGATAGAGAAAGG + Intronic
1069349342 10:67507007-67507029 CTAGACTAACAAAAAAAGAATGG + Intronic
1069453869 10:68538398-68538420 CTATACTGACAAGTAAAGAAGGG - Intergenic
1071849679 10:89556299-89556321 CTTTACTAACTGAAACAAAAAGG + Intronic
1072340562 10:94444423-94444445 CTTTACCAAAAGAAAAAAAAAGG - Intronic
1076172217 10:128329371-128329393 CTTTAATAAAAGATGAATAAAGG + Intergenic
1076743583 10:132500581-132500603 CTTTACTAACAGTGTGAGAACGG + Intergenic
1077527783 11:3078119-3078141 ATTTACGGACAGAAAAAGAAAGG - Intergenic
1077706670 11:4493316-4493338 CGTTACTAACAGACCCAGAAAGG - Intergenic
1077801508 11:5543306-5543328 TTTTAATAACAGCCAAAGAATGG + Intronic
1078976055 11:16478301-16478323 CTTCACTTCCACATAAAGAATGG + Intronic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079217070 11:18523251-18523273 CTTTACTATCAGATATAAAACGG + Intronic
1080057445 11:27920843-27920865 CTTTACTTACAGACAAAAACTGG - Intergenic
1080794943 11:35554481-35554503 CTTTAGTAACAGATAGACTAGGG - Intergenic
1082628430 11:55513000-55513022 CTATTCTAACACAAAAAGAAAGG + Intergenic
1084944516 11:72631560-72631582 CTTTACTGACAGACAACCAAGGG + Intronic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1087501869 11:98966998-98967020 CTTTACTCAAAGAGAAAGGACGG + Intergenic
1087506252 11:99026303-99026325 CTTTTCTAAAAGATATAGACTGG + Intronic
1088014510 11:105042579-105042601 CTATACAATCAGATAAACAAAGG + Intronic
1088122459 11:106386310-106386332 ATTTACAAACAGAAAAAGGAAGG - Intergenic
1089516377 11:119034686-119034708 CTTTACTAAGGGATAATAAAAGG + Intergenic
1089721375 11:120426523-120426545 GTTTAGAAACAGCTAAAGAAAGG + Intronic
1090543626 11:127736995-127737017 TTTTTCTAACTGATTAAGAAAGG + Intergenic
1090988769 11:131796981-131797003 CTTTACTAAGAGAAAACAAAAGG - Intronic
1091929231 12:4381587-4381609 CTTTACTAATAGCCACAGAATGG + Intergenic
1092461700 12:8692869-8692891 CTTGACTAGCAAATAAGGAACGG - Intronic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1094553917 12:31479198-31479220 CTTTACTAATCCATAAAGAATGG + Intronic
1095316495 12:40767738-40767760 TTTAAGTAACATATAAAGAAAGG - Intronic
1095359021 12:41313252-41313274 CTTTTGTAACAGATGAAGGATGG - Intronic
1095592816 12:43923171-43923193 GTTTCCTTCCAGATAAAGAACGG - Intronic
1097392615 12:59033867-59033889 CTTTATTAGCAGCTTAAGAACGG + Intergenic
1097808077 12:63987410-63987432 CTTTTCTATCAGTGAAAGAATGG - Intronic
1099017281 12:77359042-77359064 CTCTACAAATAAATAAAGAAAGG - Intergenic
1099334311 12:81334024-81334046 ACTTAGTAACAGATAATGAAAGG - Intronic
1101334761 12:103786522-103786544 TTTTACTCAGAGAGAAAGAAAGG + Intronic
1101341863 12:103849197-103849219 CTGTAGTAAAAGATGAAGAATGG - Intergenic
1101710089 12:107256954-107256976 CTTTACTAAGTGATTATGAATGG + Intergenic
1102040358 12:109796857-109796879 CTTGGTTTACAGATAAAGAATGG + Intronic
1105973157 13:25449712-25449734 ATTTAATAACAGATATATAATGG - Intronic
1106999178 13:35523698-35523720 CTATAATAACTGATATAGAAGGG - Intronic
1107246028 13:38295097-38295119 CTTGACTAATAAAAAAAGAAAGG + Intergenic
1107246292 13:38300255-38300277 CTTTACCAACAACAAAAGAAAGG + Intergenic
1107866927 13:44712240-44712262 CTTTACTAATAGTTAATCAATGG - Intergenic
1108085812 13:46791410-46791432 CTTTACTAATAGGAAAAGAATGG - Exonic
1108354306 13:49616495-49616517 TTTTCCTAACAGACAAAGAGAGG + Intergenic
1110259874 13:73473238-73473260 CTTGAATTTCAGATAAAGAATGG + Intergenic
1110289294 13:73785607-73785629 CTTTACTAAAAAAAAAAAAATGG - Intronic
1110997058 13:82123460-82123482 ATTTAATAATAGATAAATAAGGG - Intergenic
1111105030 13:83634044-83634066 CTTTGCTAACAGACAGGGAAAGG - Intergenic
1112534815 13:100242303-100242325 CTATTCTAAGAGACAAAGAAGGG + Intronic
1112604454 13:100890429-100890451 CTGTACTCACAGTTACAGAAGGG + Intergenic
1113080409 13:106513897-106513919 ATTCACTAAGAGATAAAGCAAGG + Intronic
1114222878 14:20712745-20712767 CCTTACTAACTGATAAACCAGGG - Intergenic
1114834524 14:26187906-26187928 CTTAATTAACAGAAAAAGAAAGG + Intergenic
1114937777 14:27565374-27565396 CTCTAATAACAGAAAAATAAAGG + Intergenic
1115227897 14:31124038-31124060 CCTTAGTAACAGAAAAAAAATGG + Intronic
1115784312 14:36806990-36807012 CTTTGCTAAAACAAAAAGAAGGG + Intronic
1115978928 14:39028509-39028531 ATTTAATAAAAGATAAAGAAAGG + Intergenic
1117456284 14:55900056-55900078 CTGTATTAAAAGATAAAAAATGG + Intergenic
1119042522 14:71287850-71287872 CTTTCCTAAAAAAGAAAGAAAGG + Intergenic
1119605855 14:76015813-76015835 CTTTACTAACGGATATCAAATGG - Intronic
1120061491 14:79988655-79988677 CTTTTCTAACAGATTAAATATGG - Intergenic
1120490434 14:85172173-85172195 CTTTACTATCAAATAAAAATTGG - Intergenic
1121171258 14:91856320-91856342 CTTTACTAAAAAATACAGAAAGG + Intronic
1121691260 14:95878481-95878503 CTTTACTAACAGAGACACAGAGG - Intergenic
1121904668 14:97728717-97728739 CTCTACAAAGAGATAAACAATGG + Intergenic
1123507443 15:20958370-20958392 GTTTAATAACAAATAAACAAAGG - Intergenic
1123564670 15:21532112-21532134 GTTTAATAACAAACAAAGAACGG - Intergenic
1123600923 15:21969402-21969424 GTTTAATAACAAATAAACAAAGG - Intergenic
1125734641 15:41915902-41915924 ATATACAAACAGAAAAAGAAGGG + Intronic
1126118938 15:45233960-45233982 CTAAACTTAGAGATAAAGAAGGG + Intergenic
1126342370 15:47655128-47655150 CTTCAGTAAGAGATCAAGAAAGG - Intronic
1126520566 15:49589605-49589627 CTTTACTAACACAAAAAATAAGG + Intronic
1126941522 15:53771893-53771915 CTTTACAAACAGAAAAAGAATGG + Intergenic
1127180609 15:56412785-56412807 GTTTTCTAATAGATAAAGTAAGG + Intronic
1127835981 15:62791553-62791575 CATTAGTCACAGTTAAAGAAAGG - Intronic
1130536580 15:84789846-84789868 CTTTACTAAGAAGTTAAGAAGGG + Intronic
1131938173 15:97530979-97531001 CTTAACCAACAGAAAAAGATAGG + Intergenic
1202973031 15_KI270727v1_random:259222-259244 GTTTAATAACAAATAAACAAAGG - Intergenic
1135953070 16:26933386-26933408 CTTCACTAGCAGATGGAGAACGG - Intergenic
1137372126 16:47917230-47917252 ATTTATTAGCAGAGAAAGAATGG + Intergenic
1137894154 16:52193368-52193390 CATCACTCACAAATAAAGAAAGG + Intergenic
1138718527 16:59051847-59051869 ATTTACAAATAAATAAAGAAAGG - Intergenic
1139737689 16:69006059-69006081 GTTTACTGACAAATAAGGAAAGG + Intronic
1141040436 16:80668304-80668326 CTTGGCTAACAGATAAATAATGG + Intronic
1144173173 17:12679514-12679536 ATTTTCTAACATTTAAAGAATGG + Intronic
1144297810 17:13895719-13895741 CTTTACAAAAAGAAAAAAAAAGG + Intergenic
1145075427 17:19851010-19851032 CTCTACTAACAATTAAAAAATGG + Intronic
1145822429 17:27849645-27849667 CTTGACTGACAGATTAAGAAAGG - Intronic
1145857179 17:28171734-28171756 CTTTCCAAACAGTTAATGAATGG - Intronic
1147281309 17:39363509-39363531 CTATACAAACAGATAAATAATGG + Intronic
1147504849 17:41005817-41005839 CATCACTAACAGGTGAAGAAAGG - Intergenic
1149901174 17:60480874-60480896 CCTCACTAACAGATACAGGAAGG - Intronic
1150329139 17:64281073-64281095 TTTTACTCACAGATAAAATATGG + Intergenic
1150576283 17:66433709-66433731 CTCTACTAAAATATAAAAAATGG - Intronic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1153680226 18:7493538-7493560 ATTTACTAACAGCTAAATACTGG + Intergenic
1153955849 18:10095508-10095530 CTTTACCAACAGGTGAAGAGTGG - Intergenic
1154931725 18:21004711-21004733 CTTGGTTTACAGATAAAGAAGGG + Intronic
1155734176 18:29200786-29200808 CTAGACTAGCAGATAAAGAAAGG + Intergenic
1155948872 18:31886373-31886395 CTTTACTAAATGCTAAAGATAGG - Intronic
1156199728 18:34816851-34816873 TCTAACTAACAGATAAATAAGGG - Intronic
1156452865 18:37276369-37276391 CTGCTCTAACAAATAAAGAATGG + Intronic
1156803068 18:41142192-41142214 CTTTACTAAGGGATAAACTATGG - Intergenic
1157871809 18:51236426-51236448 CTATACAAATAGATAAGGAAAGG - Intergenic
1158762050 18:60401571-60401593 CTTTACACAGAGATAAGGAATGG + Intergenic
1158973879 18:62692920-62692942 CTTTACTTACAGTTCCAGAAGGG + Intergenic
1159009041 18:63040890-63040912 CTTTATTCACAGGCAAAGAATGG - Intergenic
1159206178 18:65255817-65255839 CTTCAAGAACAGATAGAGAAAGG - Intergenic
1159246623 18:65813594-65813616 CTTAAATAACACATAAAGAAAGG + Intronic
1159286996 18:66366722-66366744 CTTTATTAACAGAGTGAGAATGG + Intergenic
1166477124 19:43136920-43136942 TACTACTAACAGATAAAAAAAGG + Intronic
1167789489 19:51664466-51664488 CTTTATAAAGACATAAAGAAGGG - Intergenic
1168594051 19:57660552-57660574 TTTTACTTACAGATAAATATGGG + Intergenic
926088448 2:10034715-10034737 CATTTCTAACAAATAAAGTATGG - Intergenic
926530399 2:14038004-14038026 CTTTATTCAGAGATAAAGACAGG + Intergenic
926623750 2:15071686-15071708 CTTTGCTACCATATAAAGCAGGG - Intergenic
926950773 2:18240742-18240764 CTTTTATTACAGATAAGGAAAGG + Intronic
929773997 2:44916662-44916684 CTTTACTAACAGATAATTATTGG + Intergenic
931448695 2:62349384-62349406 CTTCAATAAAAGACAAAGAACGG - Intergenic
932150238 2:69364326-69364348 TTTTAATAACAGATAAAGTTAGG + Intronic
932926970 2:75987757-75987779 TTTTACTTACAAACAAAGAAAGG - Intergenic
933475672 2:82787179-82787201 CTTTAGTAACAAATATAAAAAGG + Intergenic
935137127 2:100316756-100316778 TTTTAGTAACTGATAAAGTAAGG - Intronic
935634393 2:105238541-105238563 CTTTCCCAGTAGATAAAGAATGG - Intergenic
935918251 2:107982523-107982545 CTTTACCATTAGGTAAAGAAAGG + Intergenic
938181374 2:129188223-129188245 CTTGACTTACAGACGAAGAAGGG - Intergenic
938419320 2:131131571-131131593 CTTTTCTTACAGATTAATAAAGG - Intronic
938505275 2:131873683-131873705 CTTTCTAAACAGCTAAAGAATGG - Intergenic
939295370 2:140256765-140256787 CCTTACAAAAAGAAAAAGAAGGG - Intronic
939685794 2:145198601-145198623 ATTTACTAACAAATAAAAAAGGG + Intergenic
939771249 2:146322185-146322207 CTGTACTAACATTTAATGAAAGG - Intergenic
941060948 2:160846334-160846356 CTATACCAAAAGATAGAGAAAGG + Intergenic
941249974 2:163149055-163149077 CTTTACTAAAATACAAATAAAGG + Intergenic
941393910 2:164950968-164950990 CTTAAATAACTGATAAATAAAGG - Intronic
941625757 2:167828556-167828578 CTTTCCTGAGAGACAAAGAAGGG - Intergenic
942582533 2:177434347-177434369 GTTTACCAACATTTAAAGAATGG + Exonic
942932230 2:181508807-181508829 CTTTTCTAACAGATACTGAATGG - Intronic
943493816 2:188592659-188592681 CATTAATAACAAATAAAGTATGG + Intronic
943821441 2:192327752-192327774 CTTTAATAAAAGAAAAGGAAGGG - Intergenic
943866822 2:192935666-192935688 CTATACAAAGAGATAAAGAAGGG - Intergenic
943879896 2:193130452-193130474 CTTTCCTAACAGAAAACTAAAGG - Intergenic
945193555 2:207216048-207216070 CTTTCCTAAAACATAAAGATGGG + Intergenic
945502559 2:210594523-210594545 TTTTTCTCACTGATAAAGAAAGG + Exonic
945502813 2:210598598-210598620 ATTTAAAAACAGACAAAGAAGGG + Intronic
946302730 2:218833904-218833926 GTTTACTAACAGCAGAAGAAGGG - Intergenic
947014028 2:225597882-225597904 TTTTAGTAAAAGATAAAGTAAGG + Intronic
948635022 2:239329281-239329303 TTTTACTAGCAGATAATGGAGGG - Intronic
1169584172 20:7061237-7061259 CCTTTGTAACAAATAAAGAAGGG - Intergenic
1170155653 20:13266951-13266973 CTTTGAGAAGAGATAAAGAAAGG + Intronic
1170278287 20:14617483-14617505 CTTTCCTAATACATAGAGAATGG - Intronic
1170639064 20:18135823-18135845 CTATACGAACAGAAAAAAAATGG - Intergenic
1171750310 20:29043003-29043025 CTTTATTAACAGGGATAGAAAGG + Intergenic
1172378748 20:34469711-34469733 TTTTACTTAAAGATAAAGGAGGG + Intronic
1172400183 20:34643966-34643988 CTTTACTAACAGATAAAGAAGGG - Intronic
1173028431 20:39331632-39331654 ATTTGCTAACTGAGAAAGAAAGG + Intergenic
1174340811 20:49893771-49893793 CTTTGCTTACAGAAAAAAAAGGG + Intergenic
1175664874 20:60849972-60849994 CTTGATTAGAAGATAAAGAATGG - Intergenic
1176314903 21:5232914-5232936 CTTTATTAACAGGGATAGAAAGG - Intergenic
1176692180 21:9927939-9927961 TTCTACTAACAAATACAGAAAGG + Intergenic
1177811815 21:25932691-25932713 TTTTAAGAACAGATAAGGAAAGG - Intronic
1178042970 21:28661919-28661941 CCTAACTAACAGAGAGAGAATGG - Intergenic
1178206793 21:30477274-30477296 CTTTATAAACATATAAAAAATGG - Intergenic
1178211055 21:30532487-30532509 AGTTTCTAATAGATAAAGAATGG - Intergenic
1179034978 21:37751985-37752007 CATTAGGAACAGTTAAAGAATGG + Intronic
1180392697 22:12298868-12298890 CTTTATTAACAGGGATAGAAAGG - Intergenic
1180407052 22:12565900-12565922 CTTTATTAACAGGGATAGAAAGG + Intergenic
1180517833 22:16164535-16164557 CTAGACTAACAGAGAAAAAAGGG - Intergenic
1181986927 22:26806445-26806467 CTTTTCTAACAGGTAAAGCAGGG + Intergenic
1183501139 22:38180200-38180222 CATCACTAAGAGATACAGAAAGG - Intronic
1184805073 22:46789771-46789793 CTTTAAAAAAAAATAAAGAAGGG - Intronic
1185264760 22:49895108-49895130 GTTTACTAACATAGAAAGATGGG - Intergenic
950924050 3:16722465-16722487 CTTTAATTAGAGATAAACAATGG - Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
951519823 3:23600988-23601010 ATTTACTAACTGATGAAGTAGGG + Intergenic
952707030 3:36389655-36389677 CTTTACTAATGGATAAGAAATGG - Intronic
952778924 3:37074581-37074603 CTGTACAAAAAGGTAAAGAATGG - Intronic
953425713 3:42795901-42795923 CTTTACTCACAGATAAAATAAGG + Intronic
953600206 3:44355653-44355675 CTTTACTAACTGATAGTGAATGG + Intronic
956189902 3:66598564-66598586 CTTTCCTAACAGAGAACGGAGGG + Intergenic
956363389 3:68472420-68472442 CTTTATTAACAGCATAAGAATGG + Intronic
957497055 3:81006380-81006402 ATTTACTAACAGAACAAGGAGGG - Intergenic
957509421 3:81168550-81168572 CTTTACCAACAGGTCCAGAAGGG - Intergenic
958132218 3:89442275-89442297 CTTTACTAATAGAAAAACAGGGG - Intronic
958726453 3:97911104-97911126 CTTTGATAACAGATCAAGTAAGG + Intronic
959510803 3:107209483-107209505 CTTTTGTAACAGATGAAGAAAGG - Intergenic
960402917 3:117225547-117225569 TTTGACTTAGAGATAAAGAATGG + Intergenic
960530542 3:118759055-118759077 GTTTTGTTACAGATAAAGAATGG - Intergenic
960741132 3:120835227-120835249 CATTACAGACATATAAAGAAAGG - Intergenic
962066890 3:131991108-131991130 CTTTACTAGCAGTTTGAGAATGG + Intronic
962351438 3:134659459-134659481 TTTTACTGACAGAGAAAGAAAGG + Intronic
964516906 3:157520795-157520817 CTTTACTACCCCATAAAGAATGG + Intronic
964528844 3:157645257-157645279 CTTTAGTAGCAAAGAAAGAATGG - Intronic
968856047 4:3123348-3123370 CTTTACTTACAGAAACAGACAGG + Intronic
970043804 4:11826969-11826991 CTTGAGTAACAGAAAAAAAAGGG - Intergenic
970085473 4:12341211-12341233 CTTGATTAAAAGATAAAGAAGGG + Intergenic
971017404 4:22502590-22502612 CTTTTTTAACAGAGGAAGAAAGG + Intronic
971017418 4:22502753-22502775 TTTTACTATCAGATGAAGAGTGG + Intronic
972373789 4:38451078-38451100 CTTTAGAAACAGATAAAAGAAGG + Intergenic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
973295185 4:48511030-48511052 CTTTACTTAAAGATGAAAAAAGG - Intronic
973545952 4:51982217-51982239 CTTTTCTAAGAGAAAAAGAATGG + Intergenic
974038245 4:56835964-56835986 CTTGCCTAGCAGATAGAGAAAGG + Intergenic
974411125 4:61541744-61541766 CTTTGATAAGAGAGAAAGAAAGG - Intronic
974742636 4:66025969-66025991 CTAGACTAAGAAATAAAGAAAGG - Intergenic
975464517 4:74694281-74694303 CTTTTTTAACATATAAACAAAGG + Intergenic
976564413 4:86537391-86537413 CTCTATTCACAGAGAAAGAACGG + Intronic
976753903 4:88477795-88477817 ATTTAATAAAACATAAAGAATGG - Intronic
977066705 4:92326473-92326495 TTTTACTAACAGATAAAGTAGGG - Intronic
977113492 4:92990625-92990647 ATTTACTAACACATTAAAAATGG - Intronic
977397690 4:96491036-96491058 CTTTACTAACAAATCATGATAGG + Intergenic
977749291 4:100589378-100589400 CTATAGTAGAAGATAAAGAACGG - Intronic
977927977 4:102722626-102722648 CTTAGGTAACAGAAAAAGAAAGG - Intronic
978045084 4:104115476-104115498 CTTTATTAGCAGATTGAGAATGG - Intergenic
978709642 4:111764027-111764049 CTTGACCAACAGAAAAAAAATGG + Intergenic
978915998 4:114126959-114126981 CTTCAAGAACAGATAAAGGAGGG + Intergenic
978987416 4:115030516-115030538 ATTATCTAACAGAGAAAGAAGGG + Intronic
979097142 4:116564855-116564877 CTCTACTAAAAGACAGAGAATGG + Intergenic
979541956 4:121894241-121894263 CTTTAAAAAGAGACAAAGAAAGG + Intronic
980019368 4:127690040-127690062 CTCTACTATCACAGAAAGAAGGG - Intronic
980330682 4:131407417-131407439 CTTTCGTAACACATAAAGACAGG + Intergenic
982971073 4:161987202-161987224 CTTAAATAACAAAAAAAGAAAGG - Intronic
985306566 4:188548549-188548571 CTTTGCTTGCAGATAAGGAAAGG - Intergenic
986118421 5:4804239-4804261 CTATACATACAGATAAAGACAGG - Intergenic
986186951 5:5452380-5452402 CTTTTCTAACAGGTTAATAACGG - Intronic
986274781 5:6264078-6264100 CTTTATTAACAGAGTGAGAATGG + Intergenic
987591370 5:19931952-19931974 CTTTGCTTAAAGATAAAGAGAGG - Intronic
987632021 5:20485989-20486011 TGAAACTAACAGATAAAGAAGGG + Intronic
987666625 5:20950438-20950460 GTTTACTAATTCATAAAGAAAGG - Intergenic
989273402 5:39558473-39558495 TTTTACTAACAAGAAAAGAAAGG - Intergenic
989412677 5:41138530-41138552 CTTGACTAGCAGATAAAGAGAGG + Intergenic
990059779 5:51633168-51633190 CTTTAAAAACAGAGAAAGACTGG - Intergenic
990914368 5:60887668-60887690 CTTTACTAACAAAGAAACAAAGG - Intronic
994069685 5:95586948-95586970 ATTTATTCACACATAAAGAAAGG + Intronic
994234682 5:97348200-97348222 CTATTCTAACAAATAGAGAAGGG - Intergenic
994585310 5:101701190-101701212 ATTTACAAACAGATAATGAGAGG - Intergenic
994681456 5:102893117-102893139 CTGTACTGACAAATAAAAAAGGG - Intronic
994921752 5:106054360-106054382 CTTTACTAAAAAACAAAGTAGGG + Intergenic
996615278 5:125433975-125433997 CTTAAGAAATAGATAAAGAATGG + Intergenic
997167235 5:131674235-131674257 CCTTACTAAAAGGAAAAGAAAGG + Intronic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
1000781097 5:165482586-165482608 CTGAAATAAAAGATAAAGAATGG + Intergenic
1001370095 5:171191373-171191395 GTTTTCTAACAGATAAACAATGG - Intronic
1007620470 6:43210426-43210448 CAAAATTAACAGATAAAGAAGGG - Intronic
1008230075 6:48975580-48975602 CTTTTCTAACAGATTAAAAGTGG - Intergenic
1010281192 6:74025480-74025502 CAGTAATAAAAGATAAAGAAGGG - Intergenic
1011287072 6:85736310-85736332 TTTGACTATCATATAAAGAATGG + Intergenic
1011933938 6:92751613-92751635 CTGTAATAAGAGAAAAAGAAGGG - Intergenic
1013575468 6:111480257-111480279 CTTTACTAACAAGTAAAATAAGG - Intronic
1013991276 6:116257046-116257068 CTTTACTAAAGTATAAAGATTGG + Intronic
1015377006 6:132521999-132522021 CTTTAAAAACATATAAAGTAAGG - Intergenic
1015701025 6:136036418-136036440 CCTTCCTAACAGGTGAAGAAGGG - Intronic
1016350330 6:143159857-143159879 CTTTGCAAACAGAGAAAGTATGG - Intronic
1016861245 6:148720908-148720930 CTTTCCTATAAGATAAAGCAAGG + Intergenic
1017336870 6:153271717-153271739 CCTTACTACCACATTAAGAAAGG - Intergenic
1019358161 7:591681-591703 CTCTATTAACAGAAAAAAAAAGG + Intronic
1019731954 7:2633461-2633483 GTTTCCTAACAGATGAGGAAGGG + Intronic
1021171445 7:17402658-17402680 CTTTACTCAGTGGTAAAGAATGG + Intergenic
1022267369 7:28770524-28770546 GTGGACTAACAGATAAAAAATGG - Intronic
1023004763 7:35852062-35852084 ATTTTCTCACAGAAAAAGAAAGG - Intronic
1023045058 7:36203376-36203398 CCTTTCTAACAGATAAGCAAGGG + Intronic
1024147818 7:46535198-46535220 ATTTTCCAACAGATTAAGAAAGG + Intergenic
1024394580 7:48850861-48850883 TTTTAGAAAGAGATAAAGAATGG - Intergenic
1024400680 7:48921780-48921802 TTTTAGAAAGAGATAAAGAATGG + Intergenic
1024940410 7:54758146-54758168 CTTTTCTAAAGTATAAAGAATGG + Intronic
1025218600 7:57083585-57083607 GTTTTCTCACAGAAAAAGAAAGG + Intergenic
1025629521 7:63257180-63257202 GTTTTCTCACAGAAAAAGAAAGG + Intergenic
1025652748 7:63486854-63486876 GTTTTCTCACAGAAAAAGAAAGG - Intergenic
1026119806 7:67526854-67526876 GTTTATTAAGAAATAAAGAATGG - Intergenic
1026770004 7:73190162-73190184 CTTTAATAACATATCAACAAAGG + Intergenic
1027010872 7:74743545-74743567 CTTTAATAACATATCAACAAAGG + Intronic
1027077170 7:75202495-75202517 CTTTAATAACATATCAACAAAGG - Intergenic
1027493921 7:78863681-78863703 CTTTGCTCACAGATAAATATAGG + Intronic
1027707942 7:81557495-81557517 CTTTACTAGCAAGTAAAGAAAGG - Intergenic
1030062835 7:105636642-105636664 CTGGCCTAACAGAGAAAGAAGGG - Intronic
1032579358 7:133090020-133090042 CTTTATTAACAGTGTAAGAAAGG + Intergenic
1033052819 7:138021823-138021845 AATTACTAAAAGATAATGAAAGG + Intronic
1036443449 8:8801586-8801608 CTTAACTCACATATGAAGAATGG + Intronic
1036527064 8:9545147-9545169 CTGAATTAACAGGTAAAGAAGGG - Intergenic
1038122923 8:24638672-24638694 CTTTATTAACAGTGTAAGAATGG - Intergenic
1038808382 8:30814801-30814823 CTTTCCAAACAGACAATGAATGG - Intergenic
1038977146 8:32712375-32712397 TTTTACTAAAGGAAAAAGAAAGG - Intronic
1039854752 8:41402605-41402627 CTGTGCTAACAGATAAAACAAGG - Intergenic
1044818445 8:96137204-96137226 CTTTAGTAAAAGATAAGGCATGG + Intergenic
1047704370 8:127482913-127482935 CTTTCCTGACAGAGAAAGAAAGG + Intergenic
1048213187 8:132474120-132474142 TTTCACTAACAGGCAAAGAAAGG + Intronic
1048450824 8:134532519-134532541 CTTTACGCACGGACAAAGAATGG + Intronic
1048938861 8:139379274-139379296 CTTTACTATGAGAGAAAAAAAGG - Intergenic
1049866926 8:144945437-144945459 CTCTACTAAAAAATTAAGAAAGG - Intronic
1050933004 9:11354010-11354032 CTTTACTGACTGTTATAGAAAGG + Intergenic
1050998588 9:12251685-12251707 CTTTTCTATCATACAAAGAATGG - Intergenic
1051598917 9:18852556-18852578 ATTAACTAACAAATAGAGAAAGG - Intronic
1051831447 9:21283111-21283133 TTTTATTATCACATAAAGAATGG - Intergenic
1051995435 9:23210261-23210283 CTCTTCTAGCAGATAGAGAAGGG - Intergenic
1053629122 9:39914039-39914061 TTCTACTAACAAATACAGAAAGG + Intergenic
1053721397 9:40950692-40950714 CTTTATTAACAGGAATAGAAGGG + Intergenic
1053776645 9:41549532-41549554 TTCTACTAACAAATACAGAAAGG - Intergenic
1054214765 9:62336663-62336685 TTCTACTAACAAATACAGAAAGG - Intergenic
1054344601 9:63901476-63901498 CTTTATTAACAGGAATAGAAGGG - Intergenic
1054365085 9:64328953-64328975 TTCTACTAACAAATACAGAAAGG + Intergenic
1054672716 9:67818686-67818708 TTCTACTAACAAATACAGAAAGG + Intergenic
1055100035 9:72454441-72454463 CTTTACAAACTGAAAAAGGAAGG - Intergenic
1055691556 9:78837337-78837359 CTTTACTAACTCATAAACAAAGG - Intergenic
1055755477 9:79553396-79553418 TGTTCCTCACAGATAAAGAATGG - Intergenic
1055791808 9:79930252-79930274 CTTTACTATCATAAAGAGAAAGG - Intergenic
1056388787 9:86121269-86121291 ATTTATTAAAAGATAAAGCATGG - Intergenic
1057417215 9:94875248-94875270 CTTCACTTCCAGTTAAAGAATGG + Intronic
1057559986 9:96119802-96119824 CTTTATTAACAGTGTAAGAATGG - Intergenic
1058331356 9:103764895-103764917 CATTATTAACAGATAAAAAATGG + Intergenic
1203453791 Un_GL000219v1:145454-145476 CTTTATTAACAGGGATAGAAGGG - Intergenic
1186187180 X:7032521-7032543 TACTACTAACAGATAAAAAAAGG + Intergenic
1186899646 X:14040086-14040108 CTCTACTAACAGATGAAGATAGG - Intergenic
1187222402 X:17341010-17341032 TTTTGCAAACAGATAAACAATGG - Intergenic
1187714736 X:22091729-22091751 CTTTATTAGGAGAAAAAGAATGG - Intronic
1188064983 X:25648049-25648071 CTTCCCAAACAGATAAAGCAAGG - Intergenic
1188213168 X:27447046-27447068 CTCTACAAAAAGATAAAAAAGGG - Intergenic
1188415706 X:29931211-29931233 CTTTACAAAATGAGAAAGAAAGG + Intronic
1189622329 X:42855395-42855417 GTTTATTAAAAGAAAAAGAAGGG + Intergenic
1189816617 X:44830528-44830550 AATTTCTAACAGATTAAGAAGGG - Intergenic
1192135659 X:68597226-68597248 GTTCACCAACAGATGAAGAAAGG + Intergenic
1192611229 X:72569508-72569530 TTCTATTAACAGATAAAAAATGG + Intronic
1192838904 X:74833660-74833682 CTTTACTAAAAGGAAAGGAAGGG - Intronic
1192944555 X:75951106-75951128 ATTTATGAACAGAAAAAGAAAGG + Intergenic
1193289084 X:79750657-79750679 CTTTACTAAAAGAAAAAATAAGG - Intergenic
1195857326 X:109345322-109345344 CTTGGATAACAGATGAAGAATGG - Intergenic
1197022056 X:121703176-121703198 CTTTAACAACAGAGAAAGAGAGG - Intergenic
1197268428 X:124400585-124400607 CTTTATTAAAAGAAAAACAATGG - Intronic
1198092029 X:133340981-133341003 TTCTACTAACAGAAAAAAAAGGG + Intronic
1201489071 Y:14522632-14522654 CTGTACTAACAGACAGAGATGGG - Intronic
1201939274 Y:19441971-19441993 CTTTACTTAAAGATACAGAATGG + Intergenic