ID: 1172408144

View in Genome Browser
Species Human (GRCh38)
Location 20:34704380-34704402
Sequence CGGCGGGGCCGCGGTCGCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172408144_1172408161 24 Left 1172408144 20:34704380-34704402 CCGGAGCGACCGCGGCCCCGCCG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1172408161 20:34704427-34704449 CGGCCCGGCCTGTGAGCGGCCGG 0: 1
1: 0
2: 2
3: 11
4: 167
1172408144_1172408157 9 Left 1172408144 20:34704380-34704402 CCGGAGCGACCGCGGCCCCGCCG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1172408157 20:34704412-34704434 CGAGTCCCGGCGATGCGGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1172408144_1172408160 20 Left 1172408144 20:34704380-34704402 CCGGAGCGACCGCGGCCCCGCCG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1172408160 20:34704423-34704445 GATGCGGCCCGGCCTGTGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 102
1172408144_1172408149 -4 Left 1172408144 20:34704380-34704402 CCGGAGCGACCGCGGCCCCGCCG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1172408149 20:34704399-34704421 GCCGCCTCCCCCGCGAGTCCCGG 0: 1
1: 0
2: 3
3: 20
4: 153
1172408144_1172408154 4 Left 1172408144 20:34704380-34704402 CCGGAGCGACCGCGGCCCCGCCG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1172408154 20:34704407-34704429 CCCCGCGAGTCCCGGCGATGCGG 0: 1
1: 0
2: 0
3: 1
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172408144 Original CRISPR CGGCGGGGCCGCGGTCGCTC CGG (reversed) Exonic
900163001 1:1233264-1233286 GGGCCGGGCCGCGGCGGCTCAGG - Exonic
902067468 1:13700214-13700236 CGGCGCGGCCGCGGGCGCCGGGG + Intronic
905727734 1:40268689-40268711 CTTGGGGGCCGCGGTGGCTCTGG + Intronic
906214259 1:44030148-44030170 GGGCAGGGGCGCGGTCGGTCTGG + Intronic
906615824 1:47232213-47232235 GGGCCGGGCCGCCGCCGCTCAGG - Intronic
906627013 1:47333796-47333818 CGACAGGGCCGCGGACGCCCGGG + Exonic
907050583 1:51327227-51327249 AGGCGGCGGAGCGGTCGCTCAGG + Intronic
908148884 1:61278794-61278816 AGGCGGGGCGGCGGAAGCTCAGG + Intronic
917359311 1:174159306-174159328 CTGCGTGGCCGCGGTTGCGCCGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
920914867 1:210251619-210251641 GGGCCGCGCCGCGCTCGCTCCGG - Intergenic
923086285 1:230705802-230705824 GGGCAGGGCCGCGGTGGCACGGG - Intronic
923506461 1:234609781-234609803 CGGCGGGGCGGCGGGCGCGGCGG + Intergenic
923684202 1:236142629-236142651 CCGCGCGGCCGGGGACGCTCGGG - Exonic
924198956 1:241640188-241640210 CGGCGGGGCCGCGGGCGCTGAGG - Exonic
924436700 1:244048961-244048983 CGGCGGGGACGCGGTGACTTAGG + Intronic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1064167754 10:13001459-13001481 CGGCGCGGCAGCCCTCGCTCAGG + Exonic
1066022843 10:31319831-31319853 CGGCGCCGTCGCTGTCGCTCGGG + Intronic
1069698349 10:70404333-70404355 CGGCGGGGCCGGGGCTGCTTCGG - Intergenic
1072891698 10:99330049-99330071 CTGCGTGGCTGCGGGCGCTCGGG + Exonic
1072915575 10:99535670-99535692 AGCCGGGGCCGCGTGCGCTCAGG + Exonic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1076096502 10:127737831-127737853 CCGCCGGGCCGCGGGCACTCCGG + Intronic
1077010282 11:376532-376554 CGGCGGGGCGAGGGTGGCTCCGG - Exonic
1077038475 11:506920-506942 AGGCGGGGCCGAGGTTGCGCTGG - Intronic
1080503833 11:32893349-32893371 CGGCGGGGTCGCGGTGGACCAGG + Intronic
1083538237 11:63491117-63491139 CGGCGGAGCCGCGGAAGCTTGGG + Exonic
1084684082 11:70683623-70683645 CGGCAGGGCCACGCTCCCTCAGG + Intronic
1084968148 11:72755142-72755164 CGGCGGGGCGGCGGGCCCACAGG - Exonic
1085474854 11:76783340-76783362 CGGCCCGGCCGCGGGCCCTCCGG - Intronic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1088462057 11:110092896-110092918 CGGCGCGGCTGCGGTGGCTGCGG + Intergenic
1090780384 11:130002201-130002223 CGGCGGTTGCGCGGGCGCTCCGG - Intronic
1091024749 11:132132141-132132163 GGGCGGGGCAGTGGTCGCACAGG - Intronic
1092861515 12:12724045-12724067 CGGCGGAGGCGCGGCCGCCCGGG - Intergenic
1095810961 12:46372826-46372848 GGGCGGGACCGCGGCCGCCCGGG + Exonic
1096583134 12:52601238-52601260 CGGCGGGGCGGCGGCCGCCTGGG - Exonic
1096674379 12:53218778-53218800 GGGCGGGGCGGCGGGCGCTGGGG - Intronic
1096788917 12:54033347-54033369 CTGCAGCGCCGCGGCCGCTCCGG + Exonic
1097872104 12:64610416-64610438 AGGCGGGGTCGCGGGCGCACCGG + Intergenic
1102371013 12:112382309-112382331 CGGCAGGGCCGGGGTCTCCCGGG - Intronic
1103432967 12:120903911-120903933 CGGCGGCGGCGGGCTCGCTCGGG + Exonic
1104692779 12:130839153-130839175 CGGCCGGGCCTCGGGCTCTCCGG + Exonic
1104857774 12:131909924-131909946 CAGCGGGGCCGAGGTCTCCCGGG - Exonic
1113841536 13:113364130-113364152 CGGCGGGACCGCGGGCGCGTGGG + Exonic
1114458466 14:22872219-22872241 CGGCGGAGCCCCGGGCGCCCAGG - Exonic
1115320744 14:32077124-32077146 CGGCGCGGCGGCGGGCGCTGGGG + Intronic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1117803229 14:59465342-59465364 CGGAGGGGTGGCGGTCGCTGGGG + Exonic
1122130917 14:99604244-99604266 GGGCGGGGCGGCGGGGGCTCCGG - Intergenic
1122418693 14:101562309-101562331 CGTCGGGGCCACGGCCGCCCTGG - Exonic
1122582082 14:102777395-102777417 GGGCGGGGCGGCGGGCGCGCCGG + Intergenic
1123016193 14:105376857-105376879 TGTCGGGGCCGCTGTCGCTGGGG - Exonic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1123050172 14:105537680-105537702 CCGGGGGGCCGGGGTCACTCAGG - Intergenic
1127997666 15:64163032-64163054 GGGTGGGGCCGCGGTGGCTAGGG + Exonic
1129761468 15:78131410-78131432 CGGCGGAGTCGCTGCCGCTCCGG - Exonic
1130564540 15:84982135-84982157 CGGCGGCGCCGCGGACACGCTGG - Exonic
1131215238 15:90530342-90530364 CGCCGAGGCCGCGGCCGCTCCGG - Intronic
1132342352 15:101086516-101086538 CGGCGGAGCCGCGGCCGCGCAGG - Intergenic
1132828934 16:1918278-1918300 CGGCGGGGCCGGGGGCGGCCAGG - Exonic
1133188265 16:4115712-4115734 CCGCGTGGCCGCCGTGGCTCCGG + Exonic
1136933427 16:34437587-34437609 CGGCAGGACCGCGCTCCCTCAGG - Intergenic
1136971145 16:34974227-34974249 CGGCAGGACCGCGCTCCCTCAGG + Intergenic
1141015376 16:80444168-80444190 CAGCAGGGCCGTGGTCTCTCTGG - Intergenic
1141452727 16:84116666-84116688 CGGCGGCGGCCCGCTCGCTCAGG - Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1143508223 17:7381157-7381179 CGGCGGAGCAGCCGTCGCTGGGG + Intronic
1143862973 17:9904750-9904772 GGGCGGTGCCGGGGTCGCTCCGG - Intronic
1146812923 17:35918037-35918059 AGGCGGGGCCGCGGTTGCTAAGG - Intergenic
1148356471 17:46978932-46978954 CGGCGGCGCCGGGGCCGCCCTGG - Exonic
1149955434 17:61044164-61044186 AGGTGGGGGCGCGGTGGCTCAGG + Intronic
1152283967 17:79401842-79401864 AGGCAGGGCCGCGCTCCCTCGGG - Intronic
1160204583 18:76822526-76822548 CGGCGGGGGCGCGCACGCGCGGG - Intergenic
1160552683 18:79705097-79705119 GGGTGGGGCCGCGGCTGCTCTGG + Intronic
1160730510 19:639816-639838 GGGCGGGGCCGGGTTCGCTGGGG - Intergenic
1160734190 19:654359-654381 CACCGGGGGCGCGGTGGCTCAGG + Intronic
1160766823 19:812545-812567 CGGCGGGGCCGGGGGCGGGCGGG - Exonic
1160784471 19:893003-893025 CGGCTGCGCCGCGTTCCCTCGGG + Intronic
1162373694 19:10293122-10293144 CGGCGGGGCCGTGCTGGCTCTGG + Exonic
1162572147 19:11480039-11480061 CGGCGGGCCCGCGGGGCCTCCGG + Intronic
1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG + Intronic
1163708633 19:18832398-18832420 CGGCGCGGGCGCGGGCGCTGCGG + Exonic
1165076624 19:33283040-33283062 CAGCGGGGCAGTGGTGGCTCAGG + Intergenic
1165349765 19:35269245-35269267 AGCCGGGCCCGCGGCCGCTCGGG - Intronic
1166796413 19:45428828-45428850 CGGCGGGGCCGGGGACGCAGGGG + Intronic
1167268247 19:48493874-48493896 CGGCGGGGCCGCGGGGCCCCGGG - Exonic
1167369500 19:49072218-49072240 CGGCGGGGCAGGGGGCGCTCGGG + Exonic
1167473882 19:49689438-49689460 CGGCGGGGAAGCGCTGGCTCTGG - Exonic
1167593314 19:50415757-50415779 CGTAGGGGACGCGGTCGCCCAGG - Exonic
1168316025 19:55485144-55485166 GGGCGGGGCGGCGCCCGCTCCGG - Exonic
925140580 2:1547303-1547325 CTGTGGGGCCGCGCTCCCTCTGG + Intergenic
928091831 2:28379271-28379293 CGGCAGGGCCTCGCTCCCTCTGG + Intergenic
930872771 2:56184692-56184714 GGGCGGGGCCGCGGACGAGCCGG - Exonic
942047428 2:172108068-172108090 AGGCAAGGCCGCTGTCGCTCTGG + Intergenic
946370559 2:219279216-219279238 AGGCGGGGCCGCAGTCTCCCAGG + Intergenic
947418478 2:229921693-229921715 CGGCGGGGCCGCGGAAGGACCGG - Intronic
947418571 2:229921958-229921980 CGGCGCGGCGGCGGCGGCTCCGG + Exonic
1172408144 20:34704380-34704402 CGGCGGGGCCGCGGTCGCTCCGG - Exonic
1172644551 20:36461622-36461644 TCGCGGGGCCGCGGCTGCTCCGG - Intronic
1173279950 20:41618709-41618731 GGGCGGGGCCGGGGTCCCGCGGG + Intergenic
1175429198 20:58890649-58890671 CGCAGAGGCCGCGGGCGCTCCGG + Intronic
1175911505 20:62407318-62407340 CGGCGGGCGCGCGGGCGCGCGGG - Intergenic
1176156985 20:63626923-63626945 CGGGGGGGCCGCGGGCTCGCCGG + Intronic
1176157040 20:63627110-63627132 CGGCGGGGCCGCGCACGCACGGG + Intergenic
1178992603 21:37367637-37367659 GGGCGGGGCCGCGGCCGGGCCGG - Intronic
1179490862 21:41740867-41740889 CGGCGGGGCCATGGCCGCCCTGG + Exonic
1179605707 21:42513985-42514007 CTGCGGGGCAGCCGGCGCTCAGG + Exonic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180064560 21:45405774-45405796 GGGCGGGGCCGCGGGGTCTCGGG + Intronic
1180866332 22:19122066-19122088 GAGCGGGGCCGGGGTCGCCCCGG - Intronic
1180980490 22:19876084-19876106 CGGCGGGGCCGCGCTCGATAGGG - Intronic
1181239719 22:21469549-21469571 GGGCGCGGCCGCGGTCCCCCAGG + Intergenic
1182445562 22:30387417-30387439 GGGCGGGGCCGCGGCCGGACGGG + Intronic
1185278593 22:49960568-49960590 CGGCGGGCGCGGGGCCGCTCCGG - Exonic
950297783 3:11846851-11846873 CGGGTGGGCGGCGGTCGCACAGG + Intronic
953436413 3:42881046-42881068 CAGAGGGCCCGCGGGCGCTCGGG + Intronic
967055286 3:185824971-185824993 CGGGGGAGCCGCGGGCTCTCGGG - Exonic
968985298 4:3871608-3871630 CGGCCAGGCAGCGGTCGCGCAGG - Intergenic
969438786 4:7204888-7204910 CGGCGCGGCCGCGCTTGCTAAGG + Intronic
970333284 4:15004656-15004678 CGCCGGGGCCGCGGGCGGCCGGG + Intronic
970456183 4:16226427-16226449 CGTCGGCGACGCGGCCGCTCCGG - Exonic
972733146 4:41814739-41814761 CGGCAGGGCCGTGCTCCCTCTGG + Intergenic
973728164 4:53796530-53796552 CGGCAGGGCCTCTGTCTCTCTGG - Intronic
981315588 4:143336958-143336980 AGCCGGGGCCGCGGGCGCGCCGG - Exonic
983581449 4:169313449-169313471 TGGCAGGGCCACGGTCCCTCTGG - Intergenic
983919833 4:173333880-173333902 GGGCTGAGCCGCGGCCGCTCGGG - Intronic
987132345 5:14871564-14871586 CGGCGGGGCCTCGGGCGCGGCGG + Exonic
989591961 5:43120910-43120932 TGCCGGGGCCGCGGCCGCCCGGG + Intronic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
997305024 5:132830511-132830533 CGGCGGGGCTGCGGGCGGACGGG - Intronic
998797521 5:145835497-145835519 CCGCGGGGCCCCGGGTGCTCTGG - Intergenic
1000296376 5:159916560-159916582 CGGCGGTGCCCAGCTCGCTCGGG - Intergenic
1002443405 5:179275719-179275741 CGGCAGGGCTGCGCTCCCTCTGG - Intronic
1002449905 5:179312790-179312812 CGGCAGGGCCGCGCTCCCTCCGG - Intronic
1004216784 6:13711257-13711279 CGGCGGGGCCGCGGTGGCCGGGG + Exonic
1005040437 6:21595548-21595570 CGGCGCTGCTGCGGCCGCTCAGG - Exonic
1007465584 6:42048930-42048952 CGGCGGGGCCGGGGCAGCACGGG + Intronic
1008956538 6:57222027-57222049 CGGCGGGTCCGCGGCCGGTGGGG - Exonic
1013619325 6:111873024-111873046 CGGCGCGGCCGAGGCGGCTCCGG + Exonic
1014280838 6:119441269-119441291 CGGTGGGGCCGGGGAGGCTCAGG - Intergenic
1014844450 6:126258293-126258315 GGGCGGGGCAGTGGTGGCTCAGG - Intergenic
1019054393 6:169213141-169213163 CGGCGGGGCCTCCGGCTCTCGGG + Intergenic
1019453125 7:1109938-1109960 CGGCGAGGCTGCGCTCGCACTGG - Intronic
1020192329 7:6009568-6009590 CGGTTGGGACGCGCTCGCTCCGG - Intronic
1021828057 7:24573766-24573788 CGGCGGCGCCGCGGTCGGGGAGG + Intronic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1026787524 7:73311293-73311315 CGGCAAGGCCGCGCTCCCTCTGG - Intergenic
1027106410 7:75407773-75407795 CGGCAAGGCCGCGCTCCCTCTGG + Intronic
1029629913 7:101743817-101743839 GGGCGGATCCGGGGTCGCTCTGG - Intergenic
1031629727 7:124032547-124032569 CGGCGGGGCGGGGGTCGCGGTGG - Exonic
1031886596 7:127251690-127251712 GGGCGTGGGCGCGGGCGCTCGGG - Intronic
1033062541 7:138122398-138122420 CGGCGGGGCCGCGGTCGTCGCGG + Intergenic
1034159673 7:148983443-148983465 CGGCGGGGCCTCAGTCTCACAGG - Intergenic
1034338307 7:150337433-150337455 GGGCTGGGCCTCGGTGGCTCTGG - Exonic
1035435661 7:158857058-158857080 CTGCGGGGCCGGGGTGGCTGAGG + Intronic
1036910812 8:12755528-12755550 CGGCGGGGCTGCGCGCGCCCGGG + Intronic
1044306536 8:90646151-90646173 GGGCGGGGCCGCGGGCGATGGGG + Intronic
1045277636 8:100721854-100721876 CTGCGGGGCCGCGGGCGGGCGGG + Exonic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1048966475 8:139618535-139618557 CGGCTGGGCCGCGGCTCCTCAGG + Exonic
1049336669 8:142090206-142090228 AGGCGGGGCCGCGGCTGCACAGG + Intergenic
1049405440 8:142450079-142450101 CGGCGGGGCCGCTGCTGCTGGGG + Exonic
1049419584 8:142510862-142510884 CGGCGGGGACGCGGGCGCCCCGG - Intronic
1049801178 8:144518111-144518133 GGGCGGGGCACCGGTCGCTCGGG + Intronic
1053157623 9:35791758-35791780 GGGCGGGGCCGCCGTAGCTCCGG + Intergenic
1057619104 9:96619418-96619440 CGGCGGGCGCGCGGGCGCGCGGG - Exonic
1059691158 9:116687360-116687382 CGTCGGAGCCGCGGGCGGTCAGG + Exonic
1061134196 9:128723960-128723982 GGGTGGGTCCGGGGTCGCTCGGG + Intronic
1062008158 9:134252143-134252165 GGGCGGGGCCGAAGTAGCTCAGG - Intergenic
1187826286 X:23335261-23335283 CGCCGCGGCCGCGGTCGGGCTGG + Intronic
1190881569 X:54495712-54495734 CGGCGGGGCCGGGGGCCCGCTGG + Exonic
1196965118 X:121047437-121047459 CGGCGAGGCCGCGGCGGGTCCGG + Intergenic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1200873607 Y:8128608-8128630 CGGCGGGGTCGGGGAGGCTCAGG + Intergenic