ID: 1172409037

View in Genome Browser
Species Human (GRCh38)
Location 20:34709066-34709088
Sequence AGGGCGAGACGCCTGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172409030_1172409037 3 Left 1172409030 20:34709040-34709062 CCGCACGTCAGGTCCCCTAGGGC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1172409023_1172409037 23 Left 1172409023 20:34709020-34709042 CCTGGCGGCCCAGGAGAGGCCCG 0: 1
1: 0
2: 0
3: 50
4: 261
Right 1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1172409028_1172409037 4 Left 1172409028 20:34709039-34709061 CCCGCACGTCAGGTCCCCTAGGG 0: 1
1: 0
2: 1
3: 6
4: 52
Right 1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1172409025_1172409037 14 Left 1172409025 20:34709029-34709051 CCAGGAGAGGCCCGCACGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1172409033_1172409037 -10 Left 1172409033 20:34709053-34709075 CCCCTAGGGCAGCAGGGCGAGAC 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1172409024_1172409037 15 Left 1172409024 20:34709028-34709050 CCCAGGAGAGGCCCGCACGTCAG 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172409037 Original CRISPR AGGGCGAGACGCCTGGCCCG TGG Intronic
900533566 1:3166339-3166361 ACGGTCAGACGCCTGGCCTGTGG - Intronic
901323771 1:8355330-8355352 AGGGGGAGGAGCCTGGCCCTGGG + Intronic
902911020 1:19597240-19597262 AGGGCGAGCCGCCCGGGCCCCGG + Intronic
903500994 1:23800209-23800231 AGGGCGAGCCGCCTGGGGAGAGG - Intronic
903649527 1:24914362-24914384 AGGGTGGGGCGCCGGGCCCGAGG + Intronic
911150538 1:94593686-94593708 AGGGCGATTCGCCTGGCAGGTGG + Intergenic
911566225 1:99466019-99466041 AGACCGAGAAACCTGGCCCGTGG - Intergenic
1076750597 10:132540612-132540634 TGGGCCAGAAGCCTGGCCGGTGG + Intronic
1076878645 10:133229777-133229799 AGGGGGAGTCGCCAGGCCAGGGG - Intergenic
1077517765 11:3012121-3012143 CGGGGGAGACGCCCGGTCCGGGG + Intronic
1081677827 11:44981184-44981206 AGGGTGGGACGCTTGGCCAGTGG - Intergenic
1083479192 11:62932972-62932994 AGGTGGAGAAGCCTGGCCCAGGG + Intergenic
1084000169 11:66291820-66291842 AGGGCGGGGCGCCTGGCACCCGG + Intergenic
1085304554 11:75477744-75477766 AGGGCCAGGCGCCAGGGCCGTGG - Exonic
1085392290 11:76188694-76188716 AGGGAGAGGGGCCTTGCCCGTGG + Intronic
1092459600 12:8674563-8674585 AGGGCGAGACGCCGGACCCCTGG - Intergenic
1103862322 12:124025049-124025071 AGGGCGGGCCACATGGCCCGGGG - Intronic
1113433302 13:110268762-110268784 AGGACCACACGCCTGGCACGTGG + Intronic
1113896848 13:113770016-113770038 AGGGTGAGATGGCTGGGCCGCGG + Intronic
1114265690 14:21071373-21071395 AGGGGGAGAGGCCTTGCCAGGGG + Intronic
1119174500 14:72559391-72559413 ATGGGTAGATGCCTGGCCCGGGG - Intronic
1122829277 14:104387875-104387897 AGGGCGGGAGGCATGGCCCCTGG - Intergenic
1124675968 15:31686166-31686188 AGAGGGAGAGGCCTGGCCCAGGG + Intronic
1125180747 15:36879092-36879114 AGGGCAGGCCGCCTGGCCAGAGG - Intergenic
1127655122 15:61048476-61048498 AGGACAAGACTCCTGTCCCGGGG + Intronic
1130232896 15:82110011-82110033 AGGCAGAGACGCCTGGTCCATGG - Intergenic
1131180130 15:90233811-90233833 TGCGCGGGACGCCTGGCCCTGGG - Exonic
1132114201 15:99123934-99123956 AGGGCCTGGCGCCTGGCCAGAGG + Intronic
1136292793 16:29285781-29285803 AGGGAGAGACCCCTGACCCTGGG + Intergenic
1138593616 16:58017228-58017250 AGGCCAAGAGGCCTGGGCCGTGG - Intronic
1141531213 16:84648409-84648431 AGGGCGGGACGCGGGGGCCGTGG - Intergenic
1142098682 16:88259785-88259807 AGGGAGAGACCCCTGACCCTGGG + Intergenic
1142441424 16:90100822-90100844 AGGGTGAGACTTCTGGCCCTGGG - Intergenic
1143706121 17:8698784-8698806 AGGGAGAGACGGCAGGCCTGGGG + Intergenic
1146799918 17:35809977-35809999 GCGGCGAGATGACTGGCCCGAGG - Intronic
1152018676 17:77769096-77769118 AGGGCCAGAGGGCTGGCCAGAGG + Intergenic
1153666515 18:7371497-7371519 AGAGAGAGAAGCATGGCCCGTGG + Intergenic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1157621265 18:49018611-49018633 AGGGATAGAGGCCTGGCCCAAGG - Intergenic
1161443440 19:4305050-4305072 GGGCCGGGACGCCTGGTCCGCGG - Intronic
1161504418 19:4636249-4636271 AGGGTGCGAGGCCTGGCCTGGGG + Intergenic
1167948664 19:53009487-53009509 AGGGCAGGAAGCCTGGCCAGTGG + Intergenic
1168412185 19:56146994-56147016 TGGGCGACGCGCCGGGCCCGCGG + Exonic
925959683 2:9003503-9003525 AGGGCGCGACGCCCGGCGCCAGG + Intronic
930021192 2:47003223-47003245 ATGGCTAGACTCCTGGCCCCAGG - Intronic
932767916 2:74482817-74482839 TGAGCGAGACGCCTGGGCCATGG + Exonic
945088891 2:206160147-206160169 AGGGAGGGAGGCCGGGCCCGGGG + Intronic
947984918 2:234439806-234439828 ATGGGGAGAGGCCTGGCCCAGGG + Intergenic
948178269 2:235960707-235960729 AGGGCAAGACCCCTGTCCCACGG - Intronic
948374438 2:237512171-237512193 TGGGGGAGACGCCTGGGCTGGGG - Intronic
948382973 2:237563936-237563958 AGGCAGAGACGGCTGGCCCCTGG + Intergenic
948880962 2:240856914-240856936 AGGGCGGGACCCCTGGGCCGTGG - Intergenic
1169683350 20:8242283-8242305 AGGGATAGACATCTGGCCCGTGG - Intronic
1170776079 20:19375700-19375722 AGGGCTGGGCGCCTGGCCCCTGG - Intronic
1172095393 20:32457700-32457722 AGGACAGGACGCCTGGCCCAGGG - Intronic
1172126121 20:32626360-32626382 AAGGCGAAACGCCTGGCACGTGG - Intergenic
1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG + Intronic
1172604139 20:36203147-36203169 AGAGCCACACACCTGGCCCGAGG - Intronic
1172619505 20:36309659-36309681 AGGGGGAAATGCCTGGCCAGGGG - Intronic
1174842753 20:53915578-53915600 AGAGCGAGAGGGCTGGCCCGGGG - Intergenic
1177166585 21:17611927-17611949 GGCGCGAGAAGACTGGCCCGTGG + Intronic
1181006666 22:20016785-20016807 AGGGCGGGAGGGCTGGCCCGGGG - Exonic
1182548100 22:31087088-31087110 AGGGAGAGAGGACTGGCCCAGGG - Intronic
953698630 3:45179305-45179327 AGGGGGAGAAGCCTGGCCAGGGG + Intergenic
953911851 3:46897185-46897207 AAGGCGAGAGGCCTGGCCTGGGG + Intronic
966881146 3:184351988-184352010 AGGGCCAGCAGCCTGGCCCAGGG - Intronic
967826154 3:193879317-193879339 GGGGCGAGTCACCTGACCCGGGG + Intergenic
968361685 3:198151798-198151820 AGGGTGAGACTTCTGGCCCTGGG - Intergenic
973777900 4:54260280-54260302 AGGGAGAGACGGCATGCCCGAGG + Intronic
978515102 4:109560629-109560651 AGGTCAAGACTCCGGGCCCGGGG + Intronic
985838744 5:2290001-2290023 AGGGAGAGCCGCCTTGTCCGTGG + Intergenic
997385215 5:133466823-133466845 AGGGAAGGACGCCTGGCCTGAGG + Intronic
997714081 5:136029192-136029214 AAGCCGAGCCGCCTGGCCAGGGG + Intronic
1002638392 5:180619206-180619228 ACGGCGAGACCCCGGGCGCGGGG - Intronic
1013372653 6:109483517-109483539 GGGGCGAGATGGCAGGCCCGGGG + Intergenic
1016936363 6:149451501-149451523 AGGGCGCGACGTGAGGCCCGGGG + Intronic
1019253999 7:36924-36946 AGGGTGAGACTTCTGGCCCTGGG + Intergenic
1019287991 7:233182-233204 AGGACGCGTCGCCTGGCCCGGGG + Intronic
1033366074 7:140673297-140673319 AGGGCGGGCCGCCTGGGCCGCGG + Exonic
1034422789 7:150998132-150998154 ATGGGGAGACACCTGGCCCAGGG + Intronic
1035612170 8:973863-973885 AGGGGAAGAGGCCTGGCCCGTGG - Intergenic
1037620064 8:20555810-20555832 AGGGCAAGTCTCCTGGCCTGTGG + Intergenic
1038310490 8:26442560-26442582 AGGGTGAGAAGCCTAGCCAGAGG + Intronic
1038542547 8:28402019-28402041 AGGGCCAGACGGATGGCGCGGGG - Intronic
1041753629 8:61288580-61288602 AGGGAGAGACCCCAGGCACGGGG + Intronic
1045188199 8:99858883-99858905 AGGAGGAGATGCCTGGCCAGGGG - Intronic
1053313811 9:37035779-37035801 AGGGCGGGAAGCCTGGGCTGGGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056773602 9:89496894-89496916 AGGGTGAGATGCTTGGCCCCAGG + Intronic
1061726015 9:132582475-132582497 AGGGGGAGACGGACGGCCCGAGG - Exonic
1062615411 9:137393864-137393886 AGGGCGAGGCGGCTGGGCCAGGG + Intronic
1062746399 9:138215619-138215641 AGGGTGAGACTTCTGGCCCTGGG - Intergenic
1195716987 X:107826828-107826850 AAGGGGCGACGCCTGGGCCGAGG - Intronic
1200208055 X:154332240-154332262 AGGGCGAGGGGACTGGCCAGAGG - Intergenic