ID: 1172409666

View in Genome Browser
Species Human (GRCh38)
Location 20:34711680-34711702
Sequence TGGGGGAGACAGAAGGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1266
Summary {0: 1, 1: 1, 2: 16, 3: 231, 4: 1017}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172409654_1172409666 1 Left 1172409654 20:34711656-34711678 CCTGGAAGAGGGAACCTGAATCC 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409653_1172409666 11 Left 1172409653 20:34711646-34711668 CCAGTAAATACCTGGAAGAGGGA 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409648_1172409666 20 Left 1172409648 20:34711637-34711659 CCTTCTCCTCCAGTAAATACCTG 0: 1
1: 0
2: 2
3: 20
4: 220
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409644_1172409666 26 Left 1172409644 20:34711631-34711653 CCCTCCCCTTCTCCTCCAGTAAA 0: 1
1: 1
2: 5
3: 48
4: 490
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409642_1172409666 28 Left 1172409642 20:34711629-34711651 CCCCCTCCCCTTCTCCTCCAGTA 0: 1
1: 0
2: 10
3: 103
4: 856
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409646_1172409666 22 Left 1172409646 20:34711635-34711657 CCCCTTCTCCTCCAGTAAATACC 0: 1
1: 0
2: 1
3: 18
4: 246
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409650_1172409666 14 Left 1172409650 20:34711643-34711665 CCTCCAGTAAATACCTGGAAGAG 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409643_1172409666 27 Left 1172409643 20:34711630-34711652 CCCCTCCCCTTCTCCTCCAGTAA 0: 1
1: 1
2: 4
3: 49
4: 572
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409645_1172409666 25 Left 1172409645 20:34711632-34711654 CCTCCCCTTCTCCTCCAGTAAAT 0: 1
1: 0
2: 2
3: 28
4: 355
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017
1172409647_1172409666 21 Left 1172409647 20:34711636-34711658 CCCTTCTCCTCCAGTAAATACCT 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG 0: 1
1: 1
2: 16
3: 231
4: 1017

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172409666 Original CRISPR TGGGGGAGACAGAAGGGGCA GGG Exonic
900095019 1:936697-936719 TGGGGGACACAGATGGGGGTGGG - Intronic
900308942 1:2024302-2024324 CGGGGTAGACAGCAGGGCCATGG - Intronic
900318410 1:2070642-2070664 TGGGGCAGATAGCAGGGGAAGGG + Intronic
900574515 1:3376477-3376499 TGGGGGAGAGATGAGGGCCAGGG - Intronic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
900796156 1:4709470-4709492 TGGTGGAGCCTGAAGGGGCTTGG + Intronic
900908455 1:5577207-5577229 TTGGGGAGAGGGAAGGGTCAGGG + Intergenic
901089043 1:6629424-6629446 TGGGGAGGACAGATGGGGCAGGG - Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901180272 1:7336842-7336864 TGAGGAAGATAGAAGGGCCATGG - Intronic
901817003 1:11800037-11800059 TGGGTGATACAAAAGGAGCAAGG + Intronic
901941399 1:12665051-12665073 TGTGGGAGGCAAGAGGGGCAGGG - Intronic
902377243 1:16035522-16035544 TGGGGGTGTGAGAAAGGGCAAGG + Intergenic
902382420 1:16058777-16058799 TGGGGGTGTGAGAAAGGGCAAGG + Intronic
902530582 1:17088136-17088158 TGGGGAGGGCAGAAGAGGCACGG + Intronic
902659452 1:17891074-17891096 AGGGGGTGAGAGACGGGGCAAGG - Intergenic
902721371 1:18306554-18306576 AGGGGGACAGAGGAGGGGCAGGG - Intronic
902783055 1:18716847-18716869 TGGGGGAGAGGGCAAGGGCAAGG - Intronic
902852321 1:19169534-19169556 TGGAGGCGACAGAAAGGACAAGG + Intronic
903282385 1:22257398-22257420 AGGGGGAGGAGGAAGGGGCAGGG - Intergenic
904009094 1:27379890-27379912 TGGAGGAGACAAAAGGGGTGTGG + Exonic
904010697 1:27388525-27388547 TGGTGAAGACAGAAGAGGCAAGG + Intergenic
904041808 1:27589851-27589873 TGGGGGAGCCAGTGGGGCCAGGG + Intronic
904378787 1:30097466-30097488 TGGGGGAGAGGGAGGGGGTAAGG + Intergenic
904577993 1:31517809-31517831 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
904604430 1:31691118-31691140 AGGAGGAGAGAGAAGGGGCCGGG - Intronic
904615039 1:31744986-31745008 TGGGGGAGATTTAAGGGGCATGG + Intronic
905121923 1:35688933-35688955 TGAGAGAGAGAGAAGGGGAATGG + Intergenic
905249707 1:36640036-36640058 TGGGGGTGACAGAGAGGCCAGGG - Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905447031 1:38034243-38034265 TGGGGGAGACAGAATAGGAATGG + Intergenic
905558707 1:38908948-38908970 TGGGGTAGCCAGAAGGCGGATGG + Intronic
906142466 1:43542048-43542070 TGGGAGAGGAACAAGGGGCAGGG - Intronic
906248751 1:44295204-44295226 TGGGAGAGGAAGAATGGGCAGGG + Intronic
906283243 1:44568237-44568259 TGAGGGAGGCAGAACTGGCAGGG - Intronic
906495230 1:46301012-46301034 TAGGGGAGGGAGAAGGGGAAAGG + Intronic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
906522753 1:46477093-46477115 TGGGGGAGAGAAAAGGGGGCAGG - Intergenic
906589973 1:47015790-47015812 TGGATGAGCCAGAAGGGGCGAGG - Intergenic
906691173 1:47793539-47793561 TGAGGGTGACAGGAGGGGAAGGG + Intronic
906701150 1:47859189-47859211 TGGGGGAAACAAAAGGGTCAGGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907190646 1:52645069-52645091 TCGGGGAGGTAGAAGGGGCAAGG + Intronic
907456455 1:54579538-54579560 TGGGGGAGAGGGAAGGGGCTGGG + Intronic
907495563 1:54841933-54841955 TGGGGGTGACAGCATGGGCATGG + Exonic
907795384 1:57710921-57710943 TGGGGCAGGCAGGAGGGTCAGGG + Intronic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
908140442 1:61179036-61179058 TGGGGCAGGCTGAAAGGGCAGGG - Intronic
909410600 1:75345999-75346021 TGGGGGTGAAAGAAAGGGCATGG + Intronic
909559434 1:76993099-76993121 TGGGGAAGGCAAAAGGGGCATGG - Intronic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
910050945 1:82973446-82973468 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
910463823 1:87475328-87475350 TAAGTGAGACAGAAGGGACAGGG - Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
911587220 1:99704878-99704900 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
912523833 1:110266145-110266167 AGGGGGAGAAATAATGGGCAGGG + Intronic
912559134 1:110537697-110537719 AGGCTGAGAAAGAAGGGGCAGGG + Intergenic
913246591 1:116875478-116875500 TGGGTGAGCCAGAAGGGAAATGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
913457604 1:119049290-119049312 TGGGGGAGCCAGAAGGGAGATGG - Intronic
914712259 1:150225372-150225394 TGGAGGAGAAAGCAGGGGCCGGG + Intronic
915293433 1:154902068-154902090 TGGGGGAGTCAGTATGGGGATGG + Intergenic
915339633 1:155169566-155169588 TGGTGAAGACAGAAAGGTCATGG + Intronic
915369699 1:155338243-155338265 TGGAGGAGCCAGAACGGGAAGGG - Exonic
915529737 1:156496446-156496468 TGGGGGAGGGGTAAGGGGCAGGG + Intronic
915656732 1:157366900-157366922 TGGGTGAAAAGGAAGGGGCAAGG + Intergenic
916214530 1:162384100-162384122 AGGAGGAGAGAGAAGGGACAGGG - Intronic
916284718 1:163093733-163093755 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
916641146 1:166729934-166729956 TGGGAGGGGCAGCAGGGGCAGGG - Intergenic
916662071 1:166931753-166931775 TGGGGGAGAAGGAAGGGATAAGG + Intronic
916669659 1:167003090-167003112 TGGGGGAGAGTAAAGGGGAATGG + Intronic
916677054 1:167072904-167072926 TGGGTGAGACAGGAGAAGCAGGG + Intronic
917028055 1:170663420-170663442 GGGGAGAGAGAGAAGGGGAAAGG + Intronic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
918097815 1:181349138-181349160 TGGGACAGAGAGAAGGTGCAGGG + Intergenic
918109704 1:181444669-181444691 GGGGTCAGACAGGAGGGGCAGGG - Intronic
918362363 1:183772072-183772094 TGGGGGAGCCAGAAGGGAGATGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918813359 1:189149952-189149974 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919742987 1:200991727-200991749 TGTGGGAGACAGAAGAGGGCTGG + Intronic
919837238 1:201583270-201583292 GAGAGGAGACAGCAGGGGCAAGG + Intergenic
920126057 1:203694617-203694639 TGGGGGAGTCATAAGGGTCCTGG + Intronic
920432243 1:205926483-205926505 TGGAGGAGAGGGCAGGGGCATGG + Intronic
920442398 1:205989675-205989697 CAGGGGAGGCAGAAGGGCCAGGG - Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920855046 1:209655182-209655204 TGGGGGACAGGGATGGGGCAGGG - Intergenic
921092199 1:211854982-211855004 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
921116158 1:212093500-212093522 TGGGGGAGCCAGAAGGGAAATGG + Intronic
921370468 1:214417972-214417994 TGGTGAAGACAGGAGGAGCAGGG + Intronic
921382484 1:214538745-214538767 TGGGGGAGACAGAGGGCAGAAGG + Intronic
922153408 1:223023359-223023381 TGGGGGAGGAGGAAAGGGCAGGG - Intergenic
922719230 1:227891869-227891891 TGGGGCAGAAAGCAGGTGCAGGG - Intergenic
922792079 1:228316291-228316313 TGGGAGCGGCACAAGGGGCAGGG + Intronic
922968707 1:229715978-229716000 TGGAGGAGACAGAGGCCGCAGGG + Intergenic
923031000 1:230249022-230249044 TGGAGGAGAGAGAAGGGGACTGG - Intronic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923383787 1:233447029-233447051 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
923867914 1:237960362-237960384 TGTGGGGCACAGAAGGGACAGGG + Intergenic
923900015 1:238315514-238315536 TGTGGAAGACAGAATGGGAAGGG + Intergenic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924501506 1:244642824-244642846 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
924697796 1:246418664-246418686 TGGGGGAGCCAGAAGGGAAATGG + Intronic
924947395 1:248855693-248855715 TGGCTGAGACAGAAAGGGCAGGG - Intronic
1062815076 10:493449-493471 GGGGGGAGCGAGAAGGGGCAAGG + Intronic
1062925287 10:1311708-1311730 AGTGGGAGACAGAAGAAGCAAGG - Intronic
1063024881 10:2168157-2168179 TGGTGGAGGCAGTAGGGTCATGG - Intergenic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063239013 10:4149277-4149299 TGGGGGAGCCAGAAGGAAAATGG + Intergenic
1063357747 10:5417052-5417074 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1063450409 10:6146367-6146389 TGGGGTAGAGAGATGGGGGAGGG + Exonic
1063971809 10:11386239-11386261 TGGTGGAGACAGAACTGGAAGGG - Intergenic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1064251589 10:13710302-13710324 TGGGGGAGACAGGAGTTGCCAGG - Intronic
1064300342 10:14117650-14117672 TGTGGGAGAGAGAAGGTGGAAGG + Intronic
1065344451 10:24735513-24735535 TGGGAGAGAAAGAGGGGTCAAGG - Intergenic
1065371515 10:24991631-24991653 TGGGAGAGCCAGAAGGGAGATGG - Intronic
1065699940 10:28414953-28414975 TGGAGAAGACAGAAGGAACAAGG + Intergenic
1065778297 10:29142975-29142997 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1066212336 10:33252229-33252251 TGGGGGAGCCGGAAGGGAGATGG - Intronic
1067363996 10:45608111-45608133 TGGGGGAGGGAAAAGGGGGAAGG + Intergenic
1067766792 10:49092988-49093010 TGGGGGAGGTAGAAGGGAGACGG - Intronic
1068134677 10:52940128-52940150 TGGGGGAGCCGGAAGGGAGATGG - Intergenic
1068258330 10:54543143-54543165 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1068607924 10:59026274-59026296 TGGGGGAGCCAGAAGGTAGATGG - Intergenic
1069209080 10:65733605-65733627 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1069352923 10:67551378-67551400 TGGGGGAGACAGAAAGGAGATGG - Intronic
1069416484 10:68205248-68205270 TGGGGAAGACAGAGGGGAAAAGG - Intronic
1069662449 10:70132544-70132566 TGGGGGAGACAGAGAGGGGCGGG + Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069724028 10:70566083-70566105 TGGTGGAGAGAGAAGGGGACTGG + Intronic
1069766566 10:70865522-70865544 TGGGGGAGACAGAGTGGGAGAGG - Intronic
1070068374 10:73060588-73060610 GGGGGGAAAAAGAAGGGCCAAGG + Intronic
1070161836 10:73871606-73871628 TGGGGGGGACAACAGGGGCTGGG - Intronic
1070430541 10:76333499-76333521 TGGGGAAGACAGCTGGGGCCTGG + Intronic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1070817050 10:79331250-79331272 AGTGGGAGAGAGAGGGGGCAAGG + Intergenic
1070850387 10:79558328-79558350 TGGGGGTCTCAGCAGGGGCAAGG - Intronic
1070856831 10:79612968-79612990 TGGGGGTCTCAGCAGGGGCAAGG + Intronic
1070976398 10:80609282-80609304 GGGGGGTGGAAGAAGGGGCAGGG - Intronic
1071028133 10:81139979-81140001 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071042308 10:81327090-81327112 TGGAGGAGACAGAGTGGGAATGG - Intergenic
1071220421 10:83459018-83459040 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071486850 10:86107872-86107894 TGGGGGAGCAAGAAGGGAGATGG - Intronic
1071936494 10:90537312-90537334 TTGGGAAGACAGACGGGTCAAGG + Intergenic
1072039237 10:91591443-91591465 AGGGGGAGACAGAGAGGGTAGGG - Intergenic
1072681172 10:97507850-97507872 GGAGGGAGACTGAAGGGACAGGG + Intronic
1073433050 10:103499320-103499342 TGGGGATGAGAGCAGGGGCAGGG + Intronic
1073462057 10:103671570-103671592 TGGGCTAGAGAGAAGGGGGAGGG - Intronic
1073867237 10:107818981-107819003 TGGAGCAGACAGATGGGGCTGGG + Intergenic
1074106392 10:110392679-110392701 TGGGAGTCACAAAAGGGGCATGG + Intergenic
1075011464 10:118873973-118873995 TGAGGCAGACAGAAGGGAGAGGG + Intergenic
1075223772 10:120606907-120606929 TTTGGGAGAGAGAAGAGGCAAGG + Intergenic
1075420277 10:122295305-122295327 AGGGGGAGAAAGAGGGGACAGGG + Intronic
1075639319 10:124053378-124053400 AGGGGGAGACAGGTGGAGCAGGG + Intronic
1075688622 10:124380481-124380503 TTGGGGAGTCAGGAGGAGCATGG - Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1076109156 10:127848221-127848243 GGGGGGAGAGAGAGGGGGGAGGG + Intergenic
1076330946 10:129665810-129665832 TGAGGGAGACTGAAGAGACATGG + Intronic
1076790597 10:132775000-132775022 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076790662 10:132775160-132775182 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1077080256 11:721831-721853 TGCGTGGGACAGAAGGCGCAGGG + Intronic
1077184100 11:1228796-1228818 TGTGCCAGAGAGAAGGGGCAGGG + Intronic
1077341665 11:2028954-2028976 TGGGGAAGACGGAGGGGGCTGGG + Intergenic
1077471132 11:2761134-2761156 TGGGGGAGCAAGAAGGGAGATGG + Intronic
1077586705 11:3459388-3459410 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1077887037 11:6394164-6394186 TGGGGCTGACTGGAGGGGCAAGG - Intronic
1078268107 11:9770076-9770098 TGGGGGTGAGAGGAGGGGGAGGG - Intergenic
1078369518 11:10733422-10733444 TGGGAGTGACAGAGGGGGGATGG - Intergenic
1078936006 11:15950930-15950952 TGGGAGAGGGAGAAGGGGAATGG - Intergenic
1079929260 11:26537579-26537601 ATGGGGAGACAGAAGGCCCATGG - Intronic
1079995755 11:27293563-27293585 TGGGGGAGGCAGAGAGGGAAGGG + Intergenic
1080642445 11:34165733-34165755 TGTTGGAGTCAGAAGGAGCAGGG + Intronic
1081061354 11:38481701-38481723 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1081279205 11:41187509-41187531 TGGGGAGGCCAGAAGGGGGATGG - Intronic
1081329993 11:41790749-41790771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081352092 11:42066401-42066423 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081595300 11:44454664-44454686 TGGCAGAGAGGGAAGGGGCAGGG - Intergenic
1081715459 11:45246840-45246862 TGGGGGTGGCAGAAGGTGAAGGG - Intronic
1081864609 11:46352644-46352666 AGGAGGAGGCAGAGGGGGCAGGG - Intronic
1081981291 11:47268965-47268987 TGGTGGAGGCAGGATGGGCAGGG - Intronic
1081981649 11:47270360-47270382 TGGGGGAGTGTGAAGGGGCGTGG + Intronic
1082132370 11:48506231-48506253 AGGGGGAGAGGGAAGGGGGAAGG - Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082565833 11:54676851-54676873 AGGGGGAGAGGGAAGGGGGAAGG - Intergenic
1082767299 11:57180070-57180092 TTTGGGTGAAAGAAGGGGCAGGG + Intergenic
1083016265 11:59457453-59457475 TTGGGGCCACAGAAGGGGAATGG - Exonic
1083129117 11:60606746-60606768 TGGTGTAGAGAGAAGGGGCTAGG + Intergenic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084023939 11:66436225-66436247 TCAGGGAGGCAGAAGGGGCCAGG - Intronic
1084161645 11:67353482-67353504 TGAGAGAGACAGACGGGGCCAGG + Exonic
1084242702 11:67833420-67833442 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1085266256 11:75239898-75239920 TGGGGGTCTCAGAAGGGGCCAGG - Intergenic
1085464893 11:76716644-76716666 TGGAGGCAAGAGAAGGGGCAGGG + Intergenic
1085555048 11:77411984-77412006 TTGGCGAAACAGAAGGGGCGGGG + Intronic
1085684076 11:78605830-78605852 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1086605909 11:88696114-88696136 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1087328006 11:96746849-96746871 TGGGGGAGCCAGAAGGCAGATGG - Intergenic
1087461946 11:98456760-98456782 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
1087788722 11:102384736-102384758 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1088103234 11:106177224-106177246 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088238530 11:107750409-107750431 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1088438677 11:109843797-109843819 TGGGGAAGAGAGGAGGGGTATGG + Intergenic
1088507306 11:110539294-110539316 TGGGGGGGCCAGAAGGGAGATGG + Intergenic
1088598723 11:111457704-111457726 AGGGGGAGAGGGAGGGGGCAGGG - Intronic
1088702327 11:112424518-112424540 TGGAGGAATCAGATGGGGCATGG + Intergenic
1089403185 11:118176660-118176682 GGGGGGAGAGAAAAGGGGGATGG + Exonic
1089645610 11:119876664-119876686 TGGGGGAGAAATACGGGCCAGGG - Intergenic
1089679268 11:120110319-120110341 AGGGGGAGACAGGAGGGTAAGGG - Intergenic
1089681601 11:120121846-120121868 AGGGAGAGACAGGAGGGACAGGG + Intronic
1089689372 11:120177679-120177701 TGGAGAAGCCAGAAGGGTCAGGG - Intronic
1089737129 11:120557219-120557241 CGGGGGGGACAGGAGAGGCAAGG - Intronic
1090351573 11:126111557-126111579 TGGAGGAGAGAGGAGGGGCTAGG - Intergenic
1090703205 11:129314748-129314770 TGGGGGAGGGGGAAGGGGAAGGG - Intergenic
1202824651 11_KI270721v1_random:84143-84165 TGGGGAAGACGGAGGGGGCTGGG + Intergenic
1091790925 12:3271752-3271774 AGGGAGAGGCAGGAGGGGCAGGG - Intronic
1091818086 12:3454530-3454552 TGGAGGAGAGAGGAGGAGCAGGG + Intronic
1092242807 12:6845858-6845880 TGGGGGGTACAGAATGGGGAGGG - Intronic
1092412936 12:8268121-8268143 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1093089390 12:14904508-14904530 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1093509035 12:19904135-19904157 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1093917415 12:24821016-24821038 TGCTGGAAACAGAAGGGGCTGGG + Intronic
1094249288 12:28340964-28340986 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1094320706 12:29179729-29179751 TAGAGGAGACAGATGGGGCCAGG - Intronic
1095091770 12:38114225-38114247 TGCAGGGGACCGAAGGGGCAGGG - Intergenic
1095100584 12:38178188-38178210 TGGAGAAGACAGCAGGAGCAAGG + Intergenic
1095715934 12:45345949-45345971 TGGGGGAGAGAGAGGTGGTAGGG + Intronic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1095898620 12:47305496-47305518 TGGGGGATCCAGAAGGGAGACGG + Intergenic
1096078286 12:48818224-48818246 CGTGGGAGACAGAAGAGGCGCGG - Intronic
1096113220 12:49040942-49040964 TGGGGGCGAGAGCAGGGGCTCGG + Exonic
1096171667 12:49476346-49476368 TGGGGGAGCCAGAAGGGAGACGG - Intronic
1096196474 12:49651940-49651962 TGGGGGAGGTGGAGGGGGCAAGG + Exonic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1096584204 12:52608960-52608982 TGGGGGTGACAGAAGAGGGGAGG + Intronic
1096686542 12:53291917-53291939 TGCAGAAGTCAGAAGGGGCATGG - Intronic
1096786999 12:54022675-54022697 AGGGGGAGAAAGAGGGGGAAAGG + Intronic
1096868756 12:54580182-54580204 TGGGGGCTACAGAGAGGGCAGGG + Exonic
1097543189 12:60965573-60965595 GGATGGAGACAGAAGGGGGAAGG + Intergenic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098547969 12:71731965-71731987 TGGGGGAGCAAGAAGGGGGATGG - Intergenic
1098605060 12:72380398-72380420 TGTGGGGGACAGATGGGGCATGG + Intronic
1099499135 12:83389514-83389536 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1100641291 12:96484416-96484438 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1100747196 12:97659473-97659495 GGAGGAACACAGAAGGGGCATGG - Intergenic
1100994723 12:100292417-100292439 TGGAGGACACAGAACTGGCAGGG + Intronic
1101389175 12:104284698-104284720 TGGGGGACAAAGAAGAGGGAAGG + Intronic
1101452064 12:104788945-104788967 AGGGGCAGAAAGCAGGGGCAAGG + Intergenic
1101455187 12:104824461-104824483 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101455761 12:104828288-104828310 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101684269 12:107001641-107001663 TAGGAGAGAAAGAAAGGGCAGGG - Intronic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102027240 12:109720445-109720467 TGGGGGAGGCAGAGGTGGCAGGG + Intronic
1102045998 12:109830711-109830733 TGAGGCAGACAGCAGGGTCAAGG + Intronic
1102152259 12:110696993-110697015 TGTGGGAGACAGAAAAGACAGGG + Intronic
1102236731 12:111298467-111298489 TGGGGGTGTCAGGAGGGGCGGGG + Intronic
1102423438 12:112822150-112822172 AGGGGAAGAGACAAGGGGCAAGG + Intronic
1102646312 12:114406184-114406206 GGAGGGAGAGAGAAGGGGGAGGG - Intronic
1102821828 12:115915076-115915098 AGGGGGAGAAAGGAGAGGCAAGG + Intergenic
1103058624 12:117841265-117841287 GGGGGAAGGCAGAAAGGGCAAGG - Intronic
1103058842 12:117842764-117842786 TGGGCAAGACAGAGGGGGCAGGG + Intronic
1103612650 12:122133553-122133575 GCTGGGAGACAGCAGGGGCATGG - Exonic
1103836736 12:123827511-123827533 TGGGTGGGACAGAGGGGGCATGG + Intronic
1103925703 12:124422461-124422483 AGGTGGAGACCGAAGGGGTATGG + Intronic
1103952107 12:124556997-124557019 TGGCTGAGACAGAGCGGGCAAGG + Intronic
1104611487 12:130232128-130232150 AGGGTGAGACAGAAAGAGCAAGG - Intergenic
1104729043 12:131094973-131094995 CGAGGGAGACTGGAGGGGCATGG - Intronic
1104813574 12:131633335-131633357 TGGGGGAGGCAGAAGGTGCCTGG + Intergenic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1105595158 13:21830613-21830635 AGGGGGAGGGAGAAGGGGAAAGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106169854 13:27279754-27279776 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106319457 13:28624353-28624375 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1107410112 13:40150672-40150694 TGGGGGAAACAGAGGAGGGAGGG - Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1108018264 13:46098274-46098296 TGGGGAAAACAGAACGGGTAGGG + Intronic
1108346422 13:49551125-49551147 GGGGGGAGGGAGAAGGGGGAAGG + Intronic
1108347510 13:49560868-49560890 TGGGGGAGACACACAGGGTAAGG + Intronic
1109151702 13:58856592-58856614 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1109172876 13:59117960-59117982 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1109735929 13:66484057-66484079 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109784546 13:67156553-67156575 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1110330426 13:74265976-74265998 TGGGGAAGACAGATGGGTCTTGG + Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110775720 13:79406029-79406051 TGGGGAAGAGGGAAGGGGGAGGG - Exonic
1110835176 13:80074674-80074696 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111217225 13:85159776-85159798 TGGGGGAGCCAGAACGGAGATGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111292180 13:86185013-86185035 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111292755 13:86188800-86188822 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111343934 13:86924524-86924546 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1111406239 13:87810890-87810912 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111584583 13:90268298-90268320 TGGGGAGGCCAGAAGGGGGATGG + Intergenic
1112253827 13:97809135-97809157 GGGGGGAGACAGTGGGGGCAGGG + Intergenic
1112380257 13:98882278-98882300 AGAGGGAGACAGAAGGGGAGAGG + Intronic
1112429363 13:99336954-99336976 GGAGGGAGAAAGAAGGGGAAGGG - Intronic
1112491310 13:99866884-99866906 TGGGAGAGAGAGGAGGGGCTTGG - Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113064418 13:106358980-106359002 AGGGAGAGAGAGAAGGAGCATGG - Intergenic
1113141361 13:107154959-107154981 TGAAGGAGACAGAAGAGACAAGG + Intergenic
1113352893 13:109546871-109546893 TGGGGGCGAAAGAAGAGGGAGGG - Intergenic
1113387153 13:109859356-109859378 TGGTGGAGGCAGGAGGGTCAGGG + Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113768336 13:112894310-112894332 GCGGGGAGAGAGAAGGGGCGGGG - Intergenic
1114295838 14:21328492-21328514 TGGGGGAGAAAGAAAGGAGAAGG + Exonic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114478210 14:23012789-23012811 TTTGGGAGACCGAAGCGGCACGG + Intergenic
1114657028 14:24322460-24322482 TGTGGGAGAAAGGAGGGGCAGGG + Intronic
1115123985 14:29971189-29971211 TAGGGGAGCCAGAAGGGCGATGG + Intronic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1116345374 14:43786453-43786475 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1116539021 14:46074634-46074656 TGGGTGAGACAGCAGTGGTATGG - Intergenic
1117622881 14:57605948-57605970 TGGGGAAGACAAGAGGGGGAAGG + Intronic
1117628092 14:57661202-57661224 TGGAGGTGACTGAAAGGGCAAGG - Intronic
1118331121 14:64816820-64816842 TGTGGGGGACACATGGGGCAGGG + Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118667445 14:68086154-68086176 GGGGGAAGCCAGAAGGGGAATGG + Intronic
1118761465 14:68882661-68882683 TGGAGGACCCAGAAGGGGAAGGG + Intronic
1118770105 14:68937113-68937135 TGGGGGTGAGAGACGGGGCCAGG - Intronic
1118837609 14:69487673-69487695 TGGGGGCAACAAAAGGGGAAGGG + Intronic
1118893726 14:69929233-69929255 TGGGGGAGGCAGATGGAGTAGGG - Intronic
1118929344 14:70225642-70225664 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1119350842 14:73964053-73964075 TGGCGGAGACTGCAGGGACAAGG + Exonic
1119479731 14:74951866-74951888 TGGGAGAAACAAAAGGGGCTGGG + Intronic
1119529644 14:75350780-75350802 TAGGGGAGAGAGAAGGGCAAAGG + Intergenic
1119697666 14:76726530-76726552 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1119850647 14:77864179-77864201 TGAAGGAGAGAGAAGGTGCAGGG + Intronic
1119866671 14:77980447-77980469 TGGGGGTGTTAGAAGGGGCCAGG + Intergenic
1119951649 14:78751699-78751721 TGGAGGGGACGGAAGGGGGAAGG + Intronic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1120841089 14:89085400-89085422 TGGGGGAGAGAGAGGGAGAAAGG - Intergenic
1121310653 14:92933476-92933498 TGGGGAAGACAAATGGGGCGTGG + Intronic
1121632839 14:95433411-95433433 TGGGGGAAACAGCAGCGTCATGG + Intronic
1122038320 14:98964419-98964441 TGGAGGAGACTGAAGGGGAGGGG - Intergenic
1122217338 14:100212997-100213019 TTGGGGTGGCAGAGGGGGCAGGG + Intergenic
1122287454 14:100660038-100660060 TGGAGGGGACAGAAGGGACAGGG + Intergenic
1122302081 14:100737023-100737045 TGGGGAGGACAGGAGGGGAAGGG - Exonic
1122302108 14:100737092-100737114 TGGTGGAGACAGGAGGGGAAGGG - Exonic
1122313394 14:100811505-100811527 TGGTGGAGACAGAAGTGGGAAGG + Intergenic
1122371153 14:101229776-101229798 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1122856149 14:104561129-104561151 TGGGGCAGGCAGCTGGGGCAGGG - Intronic
1122918766 14:104871027-104871049 TGGGGGCAACAGAGGGGCCAAGG - Intronic
1123452694 15:20380864-20380886 TGGGGGAGACAAAACTAGCAGGG + Intergenic
1123539249 15:21271689-21271711 TGGGGGAGAGGGAAGAGGAAGGG - Intergenic
1123809072 15:23905248-23905270 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
1123971230 15:25509735-25509757 GAGGGGAGAGAGAAGGGCCAGGG + Intergenic
1124701258 15:31914456-31914478 TGGGGGTGACACATGGTGCATGG + Intergenic
1125104818 15:35958186-35958208 AGGGGGAGAAGCAAGGGGCAGGG - Intergenic
1125201127 15:37101447-37101469 TGGGGGAGAAAGAAGTTGCCGGG + Intergenic
1125482155 15:40088481-40088503 TGGGGTAGGCAGAAGGGACGTGG - Exonic
1125599090 15:40906049-40906071 AGGAGAAGACAGAAGGGGCAGGG - Intergenic
1125632055 15:41155104-41155126 TGGGGGAGACAGGTGGGGCGTGG - Intergenic
1125685914 15:41563135-41563157 GGAGGGAGAGAGAAGGGGTAGGG + Intronic
1125729896 15:41887189-41887211 TGGGGGAGAAAGGAGGGGTGGGG - Intronic
1125998689 15:44188920-44188942 TCGGGGAGTCAGAAGTGGAAGGG + Intronic
1126165876 15:45653442-45653464 TGGAAGAGACATATGGGGCAAGG + Intronic
1126228298 15:46296475-46296497 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1126979687 15:54227537-54227559 AGAGGGAGACCGAGGGGGCAGGG + Intronic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1128609420 15:69062102-69062124 TGGGGGAGATAGAGGAGCCAAGG - Intronic
1128702678 15:69815637-69815659 TGATGGAGGCAGAAGGGGCCTGG + Intergenic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1128782898 15:70374634-70374656 TGGGGGAGGCAGCAGAGACAGGG - Intergenic
1128831855 15:70776777-70776799 TAGGGGACTCAGAAGCGGCAGGG - Intergenic
1129239245 15:74241923-74241945 TGGGGCAGACAGCAGGAGGAGGG + Intronic
1129350834 15:74955227-74955249 GAGGGGAGACACAAGGGGCCAGG + Exonic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129467304 15:75731331-75731353 TGGGAGAGAGGGATGGGGCAGGG - Intergenic
1129673644 15:77620836-77620858 TAGGGGAGATGGAAGGGGCCTGG + Intronic
1130026966 15:80278420-80278442 AGAGTGAGACAGAAGGGACAGGG - Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130115871 15:81003371-81003393 TGGGGGTGGAAGAAGGGGTATGG - Exonic
1130404309 15:83584273-83584295 AGGGGGAGACAGGAGTGCCAAGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130559209 15:84945398-84945420 TGGGGGAGCAGGAAGGGGGATGG - Exonic
1130648999 15:85751572-85751594 TGGGGATGGCGGAAGGGGCAGGG - Intergenic
1130682706 15:86010491-86010513 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1130710739 15:86278623-86278645 TGGGGGAAAGGGAAGGGGAAGGG - Intronic
1130828721 15:87577523-87577545 TGGAGGAGGCAGAGGAGGCAAGG + Intergenic
1131200231 15:90389311-90389333 TGGGGAAGACAGTATGAGCACGG + Intronic
1131254705 15:90854441-90854463 TTGGGAAGCCAGAATGGGCACGG + Intergenic
1131461866 15:92623180-92623202 AGTGGGAGACAGCAGGAGCATGG - Intronic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132085932 15:98908158-98908180 TGGGGGAGGGAGAAGGCCCAGGG + Intronic
1132268838 15:100504681-100504703 TCGGGGACACAGAAAGGACAGGG + Intronic
1132872925 16:2123657-2123679 TGGGGGACACAGCAGGGCCCAGG + Intronic
1133234646 16:4382198-4382220 TGTGAGAGCCAGATGGGGCAGGG + Exonic
1133271209 16:4611649-4611671 TGGGGGAGACAGAGCGAGCCTGG + Intronic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1133547512 16:6822106-6822128 TGGGGGAGACAGACTGAGAAAGG + Intronic
1133612152 16:7443347-7443369 TGTGTGAGACAGGAGGGGGATGG - Intronic
1134129455 16:11639301-11639323 TGGGAGGGATAGACGGGGCATGG + Intergenic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1134552015 16:15142836-15142858 TGGGGGACACAGCAGGGCCCAGG + Intergenic
1134712775 16:16336180-16336202 TGGGGGACTGAGAAGGGGGAGGG + Intergenic
1134894726 16:17874627-17874649 TGAGGGAGACAGGAGGGGGGTGG - Intergenic
1134954052 16:18372513-18372535 TGGGGGACTGAGAAGGGGGAGGG - Intergenic
1135833509 16:25800419-25800441 TGGGAGAGAAAGTAGGGGGAAGG - Intronic
1136544409 16:30947594-30947616 TGGGGGAGGTGGAAGGGGCGGGG + Exonic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1137563897 16:49521558-49521580 ATGGGGAGACAGCAGTGGCATGG + Intronic
1137682810 16:50365525-50365547 TGGGAGAGAGAGACAGGGCAGGG + Intronic
1138128333 16:54456984-54457006 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
1138229235 16:55325232-55325254 GGGGGAAGCCAGAAGGAGCAAGG + Intronic
1139045200 16:63049299-63049321 TGGAGGGGACAGATGGGACAGGG + Intergenic
1139170879 16:64628016-64628038 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139338223 16:66248496-66248518 TGGAGGCGGCAGAAGGGGCTGGG - Intergenic
1140034799 16:71364029-71364051 TGGGGGAGGGAGCAGAGGCAGGG - Intronic
1140128489 16:72137412-72137434 TGGGGGAAACAGAAGAGCGAAGG + Intronic
1140322072 16:73962471-73962493 TGGGGGAGAGAGAGGGGACTTGG + Intergenic
1140681213 16:77386576-77386598 TGAGGGATGCAGAAGGGGTAGGG - Intronic
1140907370 16:79420541-79420563 TGGGGGAGGCCGTAGGGGGAGGG - Intergenic
1140945540 16:79764947-79764969 TGGAGGAGACAGAAGATGGATGG - Intergenic
1141382602 16:83589357-83589379 TGGGGGAGAGGGAGAGGGCAAGG - Intronic
1141469351 16:84228239-84228261 TGGGAGGGACAGAGGGGGCGAGG - Intronic
1141798978 16:86294590-86294612 AGGGAGAGACAGAAGGGGAGAGG - Intergenic
1141918982 16:87122257-87122279 AAGGGGAGACGGAACGGGCAGGG - Intronic
1142300954 16:89257507-89257529 TGGGGGAGCCGGAAGGGAGACGG + Intergenic
1143001280 17:3796754-3796776 TGGGGGAGACAGAGGGTTGAGGG - Intronic
1143292360 17:5840961-5840983 TGGGGGAGTCAGAAGGCAGATGG + Intronic
1143368043 17:6421161-6421183 AGAGGGAGACAGGAGGGTCAGGG + Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143576468 17:7796669-7796691 TGGGCCAAGCAGAAGGGGCAAGG - Intronic
1143622833 17:8090914-8090936 TCAGGGTGAGAGAAGGGGCAAGG + Intergenic
1143890048 17:10096010-10096032 TGGGGGAGAAAGCAGGACCAGGG - Intronic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1145052814 17:19676912-19676934 TGGGGCAGACAGATGGTGGATGG + Exonic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145163514 17:20590741-20590763 TGGGGGGGACAGGAGGGTGAAGG - Intergenic
1145353934 17:22119148-22119170 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1145752871 17:27367759-27367781 TGGGGGAGAAAGAGAAGGCAAGG - Intergenic
1145990887 17:29078816-29078838 TGGGGGAGGCAGGAGAGCCAGGG + Exonic
1146133754 17:30300201-30300223 TGTGGGAGAAAGCAAGGGCAAGG + Intergenic
1146257584 17:31400539-31400561 TCGGAGAGGCAGAAGGGGCCGGG + Intronic
1146505269 17:33399432-33399454 AGAGGGAGACAGAGGGGGAAGGG - Intronic
1146927000 17:36752095-36752117 TGGGGGACACAGCAAGTGCAGGG + Intergenic
1146928569 17:36762054-36762076 TGGGGGAGAAGGCAGGGGGAGGG + Intergenic
1147188481 17:38725605-38725627 TGGGGGGGTCAGGAGGGGTAAGG - Exonic
1147374717 17:40016704-40016726 TGGGGGTGACAGCATGGACAGGG - Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147629080 17:41918597-41918619 TGGCAGAGGCAGAAGAGGCAAGG + Intronic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG + Intronic
1148461085 17:47839388-47839410 TGGGAGAGATGGTAGGGGCAGGG - Intronic
1148617938 17:49014249-49014271 AGGGGGAGACAGATGGGGACGGG - Intronic
1148624755 17:49060741-49060763 TGGGGGTGATAGGAAGGGCACGG + Intergenic
1148765450 17:50036096-50036118 CGGGGGAGACAGGCAGGGCAGGG - Intergenic
1148766889 17:50044735-50044757 TGGAGGAGGCAGACAGGGCAGGG - Intergenic
1148892972 17:50820974-50820996 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1148985017 17:51613459-51613481 AGGGGGAGGGAGAGGGGGCAAGG - Intergenic
1149290148 17:55210068-55210090 TGGGAGAGAAAGAAGGAGAATGG + Intergenic
1149376276 17:56047359-56047381 AGGGGGAGAACGAAGGAGCACGG + Intergenic
1149537150 17:57441911-57441933 TGGGGAGGACAGAAGGGTGAAGG + Intronic
1149888147 17:60361230-60361252 TGGGGAAGACTGAATGGGCACGG - Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151345819 17:73500594-73500616 TGGAGGAGATAGAAGGAGGATGG - Intronic
1151345842 17:73500695-73500717 TGGAGGAGACGGAAGGAGGATGG - Intronic
1151465132 17:74280152-74280174 TGGGGGAGTCAGAAAGGTCAAGG + Intronic
1151548360 17:74807079-74807101 TGGGGGAGAGAGAAGGCTCCAGG - Intronic
1151596323 17:75079899-75079921 TGGGGGAAAAGGGAGGGGCAGGG + Intergenic
1151854347 17:76710659-76710681 CGGGGGAGCCCGAAGGGCCAGGG - Exonic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152335237 17:79696870-79696892 TGGCGGAGCCAGAAGGGAGATGG - Intergenic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1152641352 17:81450574-81450596 TGGGGCAGGCAGGAGGGCCATGG - Intronic
1152727678 17:81955762-81955784 TGGGGGACACTGCAGGGGCCTGG - Intronic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1154983653 18:21527028-21527050 TGGTGGAGGCAGCAGGGACACGG - Intergenic
1155219547 18:23671810-23671832 TGGGGAAGACAGTATGGGGAGGG + Intergenic
1155703495 18:28778985-28779007 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1155778133 18:29794218-29794240 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1156004963 18:32429083-32429105 TGGGGGAGGGGGAACGGGCAAGG + Intronic
1156031662 18:32720365-32720387 TGGAGGAGAAAGAGGGGTCAGGG + Intronic
1156432048 18:37085520-37085542 TGGGGGAGATGGGAGGGGCAGGG + Intronic
1156514932 18:37671387-37671409 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1156551915 18:38027422-38027444 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1156691081 18:39707959-39707981 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1157534976 18:48451469-48451491 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157858914 18:51124003-51124025 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157867838 18:51201368-51201390 TGAGGGAGATAGAAGGGACTGGG - Intronic
1158015220 18:52775527-52775549 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1158105950 18:53885233-53885255 TGGGGGAGAAAGACGGGGTGGGG + Intergenic
1159328050 18:66949495-66949517 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159785494 18:72709141-72709163 TGTTGGAGACAGAATGTGCATGG + Intergenic
1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG + Intergenic
1160417520 18:78721433-78721455 TGGGGGCTTCAGAAGGGGAAGGG + Intergenic
1160731293 19:642779-642801 TGTGGGAGTCAGAAGGGGCAGGG - Intronic
1160786337 19:901659-901681 TGGGGAAGACAGTTGGAGCATGG - Intronic
1160996370 19:1883943-1883965 TGAGGGAGCCAGGAGTGGCAGGG - Intronic
1161208925 19:3056362-3056384 TGGGGGAGAGAGAGGGGGAGCGG + Intronic
1161238569 19:3209641-3209663 AGGGGGTGACAGTAGGGGCAGGG + Intergenic
1161267263 19:3370058-3370080 TGGGGGAGGCAGCAGGGCCCAGG + Intronic
1161342593 19:3751331-3751353 TGGGGGAGAAAAGAGGGGGACGG + Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161449717 19:4338405-4338427 CGGGAGAGACAGACGGGGCCAGG + Intronic
1162200288 19:9015085-9015107 TGGCGGAGACAGAGGAGGCAGGG + Intergenic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1162663077 19:12185731-12185753 TGGGTGAGACAGACAGGGCTGGG - Intronic
1163143975 19:15368602-15368624 TGGGGAGGACAGAGGGAGCAGGG - Intronic
1163312550 19:16522828-16522850 TGGGAGGGATAGGAGGGGCAGGG + Intronic
1163489144 19:17606724-17606746 TGGGTGGGACATTAGGGGCAGGG - Intronic
1163617087 19:18335764-18335786 TGGGGGAGCGAGAAGGGAGATGG - Intergenic
1163686895 19:18716868-18716890 TGGGGGAGCCAGGTGGGGCATGG + Intronic
1163717402 19:18880107-18880129 TGGGTGGGACTGAAGGGGCGGGG - Intronic
1163831560 19:19549556-19549578 TGAGAGAGACAGACGGGGCTAGG - Intergenic
1164011772 19:21209954-21209976 TGGGGGGGACAGAGGGGCCTAGG - Intergenic
1164158690 19:22612296-22612318 TGGGGGATGCAGAGGGGGTAGGG - Intergenic
1164447836 19:28332900-28332922 TGGCGAGGACTGAAGGGGCATGG - Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1165080785 19:33304781-33304803 AGGAGGAGACAGAAGGAGTAGGG + Intergenic
1165295830 19:34925372-34925394 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1165505858 19:36228787-36228809 TGGTGGAGAAAGAAGTGGGAAGG + Exonic
1166123256 19:40698659-40698681 TTGTGGAGAAAGAAGAGGCAAGG + Intronic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1166678043 19:44751196-44751218 TGGAGGACAGAGAAGGGACATGG - Intronic
1166885751 19:45960089-45960111 TGGGGGAGAAGGATGGAGCAGGG + Intronic
1166911460 19:46161217-46161239 TGTGGGAGACTGATGGGACATGG + Exonic
1167110602 19:47458405-47458427 CGGGGGAGAGAGATGGGGAAAGG - Intronic
1167333141 19:48868679-48868701 TGGGGAGGCCAGAAGGGGCGGGG - Intergenic
1167426814 19:49433870-49433892 TGGGGGGGTCAGGAGGGGGATGG + Intronic
1167716098 19:51143686-51143708 TGGGAGGGAGAGGAGGGGCAGGG - Intronic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1167810724 19:51827926-51827948 TAGGAGAGACAGAAGGGAAAAGG - Intergenic
1168072494 19:53960733-53960755 TGGGGGAGACAGGCAGGGCTGGG + Intergenic
1168253105 19:55152082-55152104 TGAGGGAGACAGGAAGTGCATGG - Intronic
1168287060 19:55340331-55340353 CGGGGGTGAGAGAAGGGTCAGGG - Intronic
1168329318 19:55557537-55557559 TGGGGGAGGCAGTGGGGGCAGGG - Intergenic
1168510156 19:56967362-56967384 AGGAGGAGAAAGAGGGGGCAGGG - Intergenic
1168633465 19:57975428-57975450 TGAGGGAGACAGAGGGGACCTGG + Intergenic
924996673 2:367645-367667 TGGTGGAGACAGAAGGGTGGGGG + Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925424759 2:3739637-3739659 TGGCGGAGCCAGAAGGGAGACGG - Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925806759 2:7658566-7658588 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
925990284 2:9249303-9249325 TGGGGCAGACAGACAGGCCACGG - Intronic
926056892 2:9779001-9779023 TGGGGGAGACTGGAAGGGAAAGG - Intergenic
926139263 2:10358738-10358760 TGGGGGAGCCAGAAGGGAGATGG - Intronic
926482505 2:13417423-13417445 TGGGGGAGACAAAACTAGCAGGG - Intergenic
926825503 2:16901800-16901822 TGGGGGAGTCAGAAAGGAGATGG - Intergenic
927139700 2:20121419-20121441 TGGAGAAGAAAGAAGGGGCTTGG - Intergenic
927144819 2:20156297-20156319 TGGTGGAGACAGAAGGGAGCTGG + Intergenic
927186250 2:20484654-20484676 TGCGGGAATCAGATGGGGCAAGG - Intergenic
927473908 2:23397410-23397432 TGGGGGAGGCAGCAGGGGTGGGG + Intronic
927584014 2:24282372-24282394 TGGGGGAGCCAGAAGGGAGACGG - Intronic
927854455 2:26519111-26519133 TGGGGATGGCAGAGGGGGCACGG + Intronic
927866971 2:26595319-26595341 TGTGGGCGACAGGAGGAGCAGGG + Intronic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
927963566 2:27255494-27255516 CGGGGGAGAAAGAACAGGCAGGG + Intronic
928107201 2:28478172-28478194 TTTGGGAGACTGAAGGGGCATGG - Intronic
928537921 2:32258103-32258125 TGGGGTAGCCAGAAGGGAGATGG + Intronic
928626296 2:33143021-33143043 TTGGGGTGGAAGAAGGGGCAGGG - Intronic
928815163 2:35285098-35285120 TGGGGTAGAGAGAAGAGGTAAGG - Intergenic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929628516 2:43434683-43434705 TGGGGGAACCAGAAGGGAGATGG - Intronic
929857671 2:45650601-45650623 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
929895868 2:45960461-45960483 TGTGGGGGGCAGAAGGGGAAGGG + Intronic
930127365 2:47812126-47812148 TTGAGGCTACAGAAGGGGCAAGG - Intronic
930209319 2:48617961-48617983 AGGGGGAAACAAAAGGTGCAGGG - Intronic
930297943 2:49578887-49578909 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
930515130 2:52397349-52397371 TGGTGGAGAGAGAATGGGCTTGG - Intergenic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931034746 2:58227440-58227462 TGTGGGAGACAGAAGGGAGACGG + Intronic
931224832 2:60320737-60320759 TGGGGGAGCCAGCAAGGGGAGGG - Intergenic
931470164 2:62531652-62531674 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
931795280 2:65702378-65702400 GGAGGGAGAGAGGAGGGGCAAGG + Intergenic
932132600 2:69201347-69201369 TCAGGGAGACACAAGGAGCAGGG + Intronic
932334739 2:70923711-70923733 TGGAAGAGACACAAAGGGCAAGG + Intronic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932784883 2:74591519-74591541 TGGGGGAGGGAGCAGGGGAATGG + Intronic
933398831 2:81765653-81765675 TGGGGGAGCCAGGAGGGAGATGG - Intergenic
933515929 2:83301768-83301790 GGGGAGAGAGAGTAGGGGCAAGG - Intergenic
933776531 2:85774409-85774431 TGGGGCAGGTAGAAAGGGCATGG - Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
933967758 2:87443814-87443836 TGAGGGAGTCATTAGGGGCATGG + Intergenic
934040942 2:88127063-88127085 TGCTGAAGACAGCAGGGGCAGGG - Intronic
934563930 2:95328056-95328078 AGGGGAAGAGAGCAGGGGCAAGG + Intronic
934892891 2:98086533-98086555 TGAGACAGACAGAAGGGACAGGG - Intergenic
934921245 2:98346888-98346910 GGCGGGAGGCAGAAGGAGCAGGG + Intronic
934957063 2:98631674-98631696 TGGGGGAGCCAGAAGGGAGATGG - Intronic
935062612 2:99621585-99621607 TGGTGGGGACAGAAGGCACAAGG + Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935263530 2:101375419-101375441 TGGGGGAGTAAGAAGGGGTGTGG + Intronic
935308448 2:101759737-101759759 TGGGGGAGAGAAAAGGGGGAGGG - Intronic
935326734 2:101944312-101944334 ACGGGGAGAGAGTAGGGGCATGG + Intergenic
935543659 2:104378278-104378300 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
935663998 2:105494506-105494528 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
935882214 2:107575933-107575955 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
935884217 2:107597944-107597966 TGGGGGAGAGGGAGGGGGCCTGG - Intergenic
936022800 2:109007629-109007651 TGTGGGGGACAGGAGAGGCAGGG + Intergenic
936326042 2:111506682-111506704 TGAGGGAGTCATTAGGGGCATGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936965999 2:118128109-118128131 AGGGACAGAGAGAAGGGGCAGGG - Intergenic
937302704 2:120852908-120852930 TGGGGGAGACAGACGCAGGAAGG + Intronic
937307998 2:120884057-120884079 TGGGGGAGACTTTAGGGGCCAGG + Intronic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
938090062 2:128425577-128425599 TGGGGGCAACAGGAGGGGAATGG + Intergenic
938398392 2:130967309-130967331 CGGGGCAGAAAGAAGGGCCATGG - Intronic
939008639 2:136819436-136819458 TGAGGGAAAAAGAAGGGGGAGGG - Intronic
939437814 2:142201269-142201291 AGAGGGAGAGAGAAGGGGAATGG - Intergenic
939618350 2:144386516-144386538 AGGGGGTAACAGGAGGGGCAAGG + Intergenic
939649722 2:144745727-144745749 TGGGGGAGCCAGAAGTGAGATGG - Intergenic
940360491 2:152791111-152791133 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
940508020 2:154580275-154580297 TATGGGAGAGAGAAGGGGAAGGG + Intergenic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941104855 2:161341039-161341061 CGGGGGAGCCCGAAGGGCCAGGG - Intronic
941106840 2:161364080-161364102 TGGGGGAGCCAGAAGGGAGATGG + Intronic
941125202 2:161576317-161576339 TGGGGAGGCCAGAAGGGGAATGG - Intronic
941325498 2:164109337-164109359 TGGGGGAGACAAAAGGGAAATGG - Intergenic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
941663074 2:168215485-168215507 TGGAGGAGTCAGAAGGTCCAAGG - Intronic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942022026 2:171875499-171875521 GGGGAGAGAGAGAAAGGGCAAGG + Intronic
942154227 2:173110568-173110590 TGGGGGAAAGAGTAGGGGCGGGG - Intronic
942173259 2:173307789-173307811 TGGGGGAAACTGGTGGGGCAAGG + Intergenic
942487332 2:176453137-176453159 TGGGGGTGAGAGATGGAGCAAGG + Intergenic
942715453 2:178886443-178886465 TGGGGGTGGCAGAGGAGGCAGGG - Intronic
943202398 2:184845523-184845545 TGGGTGAGACAGAAAGGCTATGG + Intronic
943838878 2:192552264-192552286 TTGGGGAGCCAGAAGAGGGATGG + Intergenic
944031797 2:195243137-195243159 TGGGGAAGAAAGGAGGGGCCTGG + Intergenic
944306873 2:198188880-198188902 TGGGGAAGCCAGAAGGGGGGTGG - Intronic
944669652 2:201984341-201984363 AGGTGGAGACAGAAAGAGCAGGG + Intergenic
944728355 2:202495285-202495307 TGGGGGAACCAGAAGGGAGATGG + Intronic
944962599 2:204892086-204892108 AGGGGGAGCCAGAGGGGACAAGG + Intronic
945126184 2:206513041-206513063 AGAGGGAGAGAGAAGGGGAATGG - Intronic
945324116 2:208463158-208463180 TGGGGGAGGAAGAAGGGACCAGG - Intronic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
946160461 2:217832609-217832631 TGGGGAAAGCAGCAGGGGCAGGG - Intronic
946174954 2:217916900-217916922 TGAGGGACAGAGAATGGGCAGGG + Intronic
946204438 2:218093243-218093265 GGGGGGAGACTGAAGTGACAGGG + Intergenic
946396502 2:219446077-219446099 TGCAGGAGAAAGAAGGGGCCTGG + Intronic
947478347 2:230472803-230472825 TGGGTGAGTCAGAGGGGCCAGGG - Intronic
947593510 2:231397541-231397563 GGTGGGAGAAAGAAAGGGCAGGG + Intronic
947740370 2:232482096-232482118 TGGAGGAGACAGGAGGGAAACGG + Intronic
948101033 2:235373527-235373549 GGGGGGGGATAGAAGGGGCAGGG - Intergenic
948223158 2:236289301-236289323 TGGGTGAGATGGAAGGGGCTGGG + Intergenic
948302665 2:236919758-236919780 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
948531638 2:238611718-238611740 AGGGGGAGAAAGAGTGGGCAGGG + Intergenic
948667214 2:239544097-239544119 TGGGGAAGGCACAAGAGGCAGGG + Intergenic
948877976 2:240840405-240840427 TGGGGGAGACAGAATTTGCCTGG - Intergenic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
949047325 2:241877911-241877933 TGGGGGGGCCGGAAGGGGGAAGG - Intergenic
1168851327 20:979060-979082 TGAGGGAGAGAGAAGAGACAAGG - Intronic
1169046210 20:2536431-2536453 TGGGGGAGAGAGACGGGTGAAGG - Intergenic
1169135740 20:3195992-3196014 TGGAGGAGAGAGAAGAGGCAGGG - Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169550672 20:6698232-6698254 AGGTGGAGACAGAAGAGGCAGGG - Intergenic
1169801238 20:9514729-9514751 CGGGGGACAGAGAAGGGGGAGGG - Exonic
1170104395 20:12737780-12737802 TGGGGAAGAGAGACAGGGCAAGG - Intergenic
1170141864 20:13132805-13132827 TGTTGGAAAAAGAAGGGGCAAGG - Intronic
1170270972 20:14527037-14527059 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1170459622 20:16564981-16565003 AGTTGGAGAGAGAAGGGGCATGG - Intronic
1170591769 20:17776885-17776907 TGAGAGAGACAGTGGGGGCAGGG + Intergenic
1170695868 20:18658040-18658062 AGTGGGAGAGAGAAGTGGCAAGG + Intronic
1171384211 20:24756762-24756784 TGGGGGAGCCACAAGGGAGACGG + Intergenic
1171517562 20:25750228-25750250 TGGGGGAGGCAGAAAGGAGATGG + Intergenic
1171564190 20:26163273-26163295 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1172007325 20:31826463-31826485 TGGGGGAGAGAGGAGAGGCAAGG + Intronic
1172091345 20:32434994-32435016 TTGGGAGGACAGTAGGGGCAAGG - Exonic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172585177 20:36078166-36078188 TTGGGGAGCCAGAAGGGAAATGG + Intergenic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1172778967 20:37424554-37424576 TGTGGGAGACAGAGGGAGCCAGG + Intergenic
1173471376 20:43326098-43326120 AGGGGAGGACAGAGGGGGCAGGG - Intergenic
1173484588 20:43431069-43431091 TGGGGAAGGCAGAGAGGGCAGGG + Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173850448 20:46214543-46214565 TGGAGAAGCCAGAAGGGGCCAGG - Intronic
1173970111 20:47146075-47146097 TGGGGGAGAGAGAGGTGGCAAGG + Intronic
1174056636 20:47802732-47802754 TCGGGGAGACAGAAGCTGCCTGG - Intergenic
1174859583 20:54077950-54077972 AGGGGCTGACAGAAGGGGAATGG + Intergenic
1174894546 20:54434908-54434930 TTGGGGAGTCAGGAGGGTCAGGG - Intergenic
1175421260 20:58835390-58835412 TGGGGGAGACAGATGAATCATGG - Intergenic
1175725061 20:61312539-61312561 TGGTGGGGACTGCAGGGGCAAGG - Intronic
1175807346 20:61837252-61837274 TGGGAGTGAGAGAAGGGGCCAGG + Intronic
1175921395 20:62452000-62452022 GGGGGGAGAGAGATGGGGGAGGG + Intergenic
1176071812 20:63230881-63230903 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1176255032 20:64147229-64147251 TGGGGGAGTAGGGAGGGGCAAGG - Intergenic
1176284659 21:5012962-5012984 GGGTGGAGACTGAGGGGGCAGGG - Intergenic
1176714636 21:10340605-10340627 TCCGGGAGACAGAAGGGGAATGG + Intergenic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1177264483 21:18765115-18765137 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1177339526 21:19782149-19782171 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1177601295 21:23318254-23318276 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1178195815 21:30344281-30344303 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1178402318 21:32297518-32297540 TGGAAGAGACACATGGGGCAGGG - Intronic
1178403891 21:32309347-32309369 TGGGTGAGACACCACGGGCAGGG - Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178438671 21:32581278-32581300 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1178591761 21:33916758-33916780 TGGGGGAGAGGGGAGGGGAATGG - Intergenic
1178697942 21:34810075-34810097 TGGGAGAGGCCGAGGGGGCATGG + Intronic
1178726577 21:35057723-35057745 GGGAGGAGAAAGAAGGGGAAGGG + Intronic
1178824649 21:36004998-36005020 AGGGGGAGGCAGGGGGGGCAGGG + Intergenic
1178843593 21:36156862-36156884 TGGGGGAGAGAGACTGGGCAGGG - Intronic
1178860441 21:36284567-36284589 TGGGGTAGAAAGAAGGAACAGGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179246558 21:39638491-39638513 TGGGGGAGCCAGGAGGGAGATGG - Intronic
1179286106 21:39978554-39978576 TGGGAGAGACAGCATGAGCAGGG + Intergenic
1179342283 21:40523573-40523595 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179459593 21:41524963-41524985 GGGAGGAGATGGAAGGGGCAGGG - Intronic
1179580483 21:42340307-42340329 TGGGGAAAACACCAGGGGCAGGG + Intergenic
1179872522 21:44250513-44250535 GGGTGGAGACTGAGGGGGCAGGG + Intronic
1179918056 21:44490720-44490742 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1180081106 21:45488030-45488052 TGGAGGGGACAGTGGGGGCAGGG - Intronic
1180930439 22:19586914-19586936 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1180969819 22:19809357-19809379 TGAGGGAGCCAGAAGGGAGATGG - Intronic
1180993646 22:19953743-19953765 TGGAGGGGACAGAAAGGACAGGG - Intronic
1181044000 22:20206067-20206089 TGGGGGAGCCAGAGGGGAGATGG + Intergenic
1181084601 22:20433745-20433767 GGGTGGAGACAGTGGGGGCAGGG - Intronic
1181593036 22:23896316-23896338 TGGGGGAGACATGGGGGGCATGG + Intronic
1181978762 22:26751532-26751554 TGGGGGAGGGGGAAGGAGCAGGG + Intergenic
1182031300 22:27161334-27161356 TGGGGAGGACAGAAGGGCCTCGG + Intergenic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182556981 22:31134423-31134445 TGGGGTAGGCAGATGGGCCAAGG + Exonic
1182598943 22:31444614-31444636 TGATGGAGGCAGCAGGGGCAGGG + Exonic
1182719591 22:32386610-32386632 TGGGAGAGGCAGATGTGGCATGG - Intergenic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183068055 22:35377286-35377308 TGGGGGACCCAGCAGGGGAAAGG - Intergenic
1183134363 22:35872543-35872565 TGTGGGAGCCAGAAGGGAGATGG + Intronic
1183366571 22:37410156-37410178 TGCGGCAAACAGACGGGGCAGGG + Intronic
1183371444 22:37434846-37434868 TGAGGGAGAGAGGAGGGGCTAGG - Intergenic
1183392227 22:37552232-37552254 GGGTGGAGAGAGGAGGGGCATGG - Intergenic
1183726459 22:39592668-39592690 TCTGGGTGACAGAGGGGGCAGGG - Intronic
1184390546 22:44200946-44200968 TCGGGGAGGCAGATGGGGCTTGG - Intronic
1184678202 22:46054582-46054604 GGTGGGAGGCAGAAGGGGCCTGG + Intronic
1184729694 22:46365772-46365794 TTGGGAACACAGAAGGGGTAGGG - Intronic
1185035576 22:48475039-48475061 TGTGGGAGGCAGAGGGGGCGAGG - Intergenic
1185035592 22:48475077-48475099 TGCGGGAGGCAGAGGGGGCGAGG - Intergenic
1185287570 22:50009406-50009428 TGGGTGAGGCAGAAGGCGCCCGG + Intronic
1185336835 22:50274710-50274732 TGGGGGAGGTGGAAGGGGCTGGG - Intergenic
1185336895 22:50274836-50274858 TGGGGGAGGTGGAAGGGGCTGGG - Intergenic
949444132 3:4115254-4115276 TGGGGAGGACAGAAGGGAGATGG - Intronic
949806259 3:7959090-7959112 TGTGGGAGCCAGAAGGGAAATGG + Intergenic
949951892 3:9236132-9236154 TGGGGGTCACAAAAGGGTCAGGG - Intronic
950080760 3:10220419-10220441 TGGGGGAGAGAAAAGAGGAAAGG - Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950626775 3:14253133-14253155 TGGGGGCAACAGAGGGGGTAGGG + Intergenic
951549390 3:23861797-23861819 TGGGGCAGCCAGAAGGGAAATGG - Intronic
951719186 3:25679747-25679769 AGGGGGAGAGAGGAGGGGGAAGG + Intergenic
952167650 3:30768548-30768570 AGGGGGAGAGAGAAGGGGTGGGG + Intronic
952376002 3:32767934-32767956 TGGGAGAGACAGATGGGGTCAGG + Intronic
952564209 3:34635413-34635435 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
952580259 3:34824564-34824586 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
952887592 3:38021132-38021154 TGGGGGGGACAGCAAGGGTAAGG - Intronic
953034997 3:39203548-39203570 TGGGAGTGGGAGAAGGGGCAGGG + Intergenic
953088387 3:39697469-39697491 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953982021 3:47417906-47417928 CGTGGGAGTGAGAAGGGGCAAGG + Intronic
954416581 3:50396215-50396237 TGGAGGAGGCAGAGGGGCCAGGG - Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
954795254 3:53158101-53158123 TGGAGGAGGCAGAGGTGGCAGGG + Intronic
954797758 3:53170148-53170170 TGTGGGAGAAAGAAGGGCTAAGG + Intronic
954922463 3:54203603-54203625 TGGGGAAGCCAGAAGGGAGATGG + Intronic
955322289 3:57982933-57982955 TGGTGTAGGCTGAAGGGGCATGG - Intergenic
955480575 3:59385425-59385447 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
955645907 3:61137192-61137214 TGGGGAAGAAGGAAGGAGCAGGG - Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956194113 3:66635087-66635109 TCGGGGAGCCAGAAGGGAGATGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956877798 3:73480582-73480604 TGGGGTAGGCAGGAGGGCCAGGG - Intronic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958004411 3:87793228-87793250 GGGTGGAGAGAGACGGGGCACGG + Intergenic
958632904 3:96703937-96703959 TGGGGGAGCCTGAAGGGAGATGG - Intergenic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
960165924 3:114401155-114401177 GGGAGGAGACAGAAGGAGAAAGG + Intronic
960415797 3:117383403-117383425 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960694568 3:120383449-120383471 GGAGGCAGAGAGAAGGGGCAGGG + Intergenic
960950123 3:122993775-122993797 TGGGGGAGGCAGGAGCGGGAGGG - Intronic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961542199 3:127607602-127607624 TGAGGGAGACAGACAGGGCATGG - Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961890500 3:130126774-130126796 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
961917607 3:130393364-130393386 TGGGGGATACAGTGGGGACACGG - Intronic
962095098 3:132285166-132285188 TGGGGGAGCCAGAAGGGAGATGG + Intronic
962384100 3:134919291-134919313 TGGGGGAGACACATGGGAGATGG + Intronic
962867316 3:139458420-139458442 TGGGGCAGACAGTAAGGGCAGGG - Intronic
962991569 3:140582187-140582209 TCTGGGAGACAGATGGTGCAGGG + Intergenic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
963433355 3:145237178-145237200 TGGGGGAGAGAAAAGAGTCAGGG - Intergenic
963932456 3:151017785-151017807 GGGGAAAGACAGAAGGGGAAAGG - Intergenic
963996999 3:151721375-151721397 TGGGGGAGCCGGAAGGGAGATGG + Intergenic
964155692 3:153582451-153582473 TGGGTGAGACAGAAGGGGAATGG - Intergenic
964308026 3:155361691-155361713 TGGGGGAGCTAGAAGGGAGACGG + Intergenic
964372635 3:156016930-156016952 AGGGGTAGACAGAAAGGACATGG - Intergenic
964650966 3:159010845-159010867 TGGGGTAGGCAGAGGGGGGACGG - Intronic
964756579 3:160094863-160094885 TGGGGGAGACATAGTGGGTAAGG - Intergenic
965321020 3:167251168-167251190 TGGGGGAGCCAGAAGGGAGATGG - Intronic
965969131 3:174532174-174532196 TGGGGGAAGGAGAAGGGGAAGGG + Intronic
966268037 3:178070415-178070437 TGGGGGAAGCAGAATTGGCAAGG + Intergenic
966285774 3:178293766-178293788 TGGGGGAGCCAGAAGGGAAGTGG + Intergenic
966745483 3:183271365-183271387 TGGTGGAGGTAGTAGGGGCAGGG + Exonic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
968479635 4:827412-827434 TGGGGGAGAGGGAAGGGTGAAGG + Intergenic
968747236 4:2366446-2366468 TTGGTGAGACAGCAGGTGCAGGG - Intronic
968891169 4:3369180-3369202 TGGGGGAGTCTGCAGGGGCGGGG - Intronic
968910778 4:3476056-3476078 GGGAGGAGGCAGCAGGGGCAGGG - Intronic
968915347 4:3494835-3494857 TAGGGGAGACAGGCAGGGCAGGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969001885 4:3989189-3989211 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
969554110 4:7894590-7894612 TCAGGGAGACAGAGGGGGCCTGG + Intronic
969619651 4:8272725-8272747 TGGGGAGGACAGAGAGGGCATGG + Intronic
969669589 4:8582369-8582391 TGGGGGAGAGAGAAAGAACAAGG - Intronic
969752119 4:9119346-9119368 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
969780150 4:9395026-9395048 GGGGGGAGGCAGAAGGGAAAAGG + Intergenic
969812034 4:9655622-9655644 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969926180 4:10587806-10587828 TAGGGGAGACAGTAGGGACCGGG - Intronic
970033328 4:11702442-11702464 TGTGGGAGACAGAAGATGAAGGG - Intergenic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970463986 4:16304796-16304818 TGGGAGTCACAGAAGGGGAAGGG + Intergenic
970542510 4:17094209-17094231 TGGGAGAGAGAGAAGGAGCAAGG + Intergenic
970697560 4:18696215-18696237 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
971218102 4:24680636-24680658 TGGGAGGGAGAGAAGGAGCAGGG + Intergenic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
971273422 4:25172586-25172608 GGGGGGAAAGACAAGGGGCAAGG + Intronic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971774921 4:30950806-30950828 TGAGGGAGACAGAGGGGACTAGG + Intronic
971940762 4:33212403-33212425 TTTGGGAGGCAGAAGTGGCAGGG + Intergenic
971986915 4:33837988-33838010 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972664324 4:41149477-41149499 GGGGGGAGAAAGAAGGAGAAGGG + Intronic
972749085 4:41970693-41970715 TGGGGGAGGCTGAAGTGGGAAGG + Intergenic
973057446 4:45678812-45678834 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
973686193 4:53372299-53372321 TGGGGAAGACAGAAAAGTCAAGG + Intergenic
974012277 4:56617832-56617854 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974250097 4:59374902-59374924 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974669705 4:65014149-65014171 TGGGGGAGCCAGAAAGGAGATGG + Intergenic
974752064 4:66154332-66154354 TGGGGGAGCCAGAAAGGAGACGG - Intergenic
974983753 4:68993918-68993940 TGAGGGAGCCAGAAAGGGGACGG + Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975481386 4:74884426-74884448 TGGAAGAGAGAGAAGGGGGAGGG - Intergenic
975662844 4:76704783-76704805 TGGAGGGGACAGAAGTGGAAGGG + Intronic
975779643 4:77824782-77824804 TGGGAGAGACAGAGGAGGGAGGG - Intergenic
976070635 4:81236081-81236103 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
976751436 4:88454568-88454590 TGGGGGAGCCAGAAGGGAGTTGG - Intergenic
976776176 4:88708670-88708692 TGGAGAAGAAAGCAGGGGCAAGG + Intergenic
977163718 4:93669823-93669845 TGTGTGAGAGAGAAGGTGCAGGG - Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
978069081 4:104444005-104444027 GTGGAGAGATAGAAGGGGCAAGG - Intergenic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978703398 4:111675635-111675657 TGGGGAGGACAGAAGCGGGAGGG - Intergenic
978833017 4:113112422-113112444 AGGGGGAGACAGAATGTGTATGG + Intronic
980085653 4:128387471-128387493 TGGGGGACACAGTAGCAGCATGG + Intergenic
980438299 4:132809539-132809561 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
981110810 4:140931078-140931100 GGGGAGAGAGAGAAGGGGCGGGG + Intronic
981317210 4:143351297-143351319 TGGGGGAGCCAGAAGGCAGATGG + Intronic
981761069 4:148195543-148195565 TGGGGGAGACATAATAGACAAGG + Intronic
982315111 4:154023985-154024007 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
982504431 4:156198903-156198925 TGGGGCAGTCAGAAGGGAGATGG - Intergenic
982947779 4:161648041-161648063 TGGGGGAGCCAGTAGGGAGATGG - Intronic
983145961 4:164215215-164215237 TGGGGGAGCCAGAAGAGAGATGG + Intronic
984271896 4:177557716-177557738 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
984433507 4:179679795-179679817 TGGGGTGGACGGAAGGGGGAGGG - Intergenic
984846183 4:184109987-184110009 TGGGGGAGATGGAAGGGAGAAGG + Intronic
985040226 4:185884033-185884055 TGGGGGAGGAAGAAGGTTCAAGG + Intronic
985708350 5:1414398-1414420 TGGGGGGGCCTGGAGGGGCAGGG + Intronic
985730493 5:1544708-1544730 GGGGGGAGATAGAAGGGGACAGG - Intergenic
986003248 5:3646881-3646903 AGGGAGAGAGAGAGGGGGCAAGG + Intergenic
986484018 5:8217288-8217310 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
986598542 5:9448446-9448468 TGGGGTAGGCAGAAGGGGCGGGG - Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988038103 5:25853472-25853494 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
989204502 5:38797734-38797756 TGGGGGAGCCAGAAGGGAGCTGG + Intergenic
990560627 5:56980054-56980076 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
990698236 5:58446574-58446596 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
990792351 5:59496099-59496121 TGGGGGAGCCAGAAGGGAGATGG + Intronic
991937703 5:71818139-71818161 TGTGGGAGGCAGAAGAGGTAGGG + Intergenic
991976329 5:72186824-72186846 TGGGGGAGACAAAAGAAGAAGGG + Intronic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992268744 5:75044306-75044328 TGGGGCAGAAAGAAGAGGAATGG - Intergenic
992374506 5:76175043-76175065 TGAGAGAGGCAGAAGGGGAAGGG + Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992783345 5:80147677-80147699 TGTGGGAGGGAGAAGGGGAAGGG - Intronic
994301918 5:98157476-98157498 TGGGGGAGTCAGAGGGGAGATGG + Intergenic
995083906 5:108086005-108086027 AGGGGCAGAAAAAAGGGGCAGGG - Intronic
995356727 5:111246268-111246290 GGGGGTAGACAGACTGGGCAGGG - Intronic
995847589 5:116510701-116510723 TGGGGGAGAGAGAAGGAGGGAGG - Intronic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996693712 5:126369138-126369160 TGGGGAAGGCAGAAAGGGAAAGG - Intronic
997474161 5:134133145-134133167 TGGGGGAGACAGAGGGGCAAAGG + Intronic
998230247 5:140357183-140357205 TTGGGGCCACAGAAAGGGCAAGG + Intergenic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
998532609 5:142899719-142899741 TGGGGGAGAGAAAAGGTGCTGGG + Intronic
998785994 5:145709405-145709427 GGTGGGAGACAGCAGGAGCAGGG + Intronic
999194016 5:149769848-149769870 AGAGGGAGGCAGAAGGGTCAGGG - Intronic
999793388 5:154964736-154964758 TGGGGGAGATAGAAGGGAAATGG + Intronic
1000167923 5:158673260-158673282 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000888981 5:166781802-166781824 TGGGTGGGACTGAAGGGGCTGGG + Intergenic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001381789 5:171310494-171310516 TGGGGGAGGCAGAGGGGGGCGGG - Intronic
1001786573 5:174418842-174418864 AGGGGGAGAGGGAAGGGGGAGGG + Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002135299 5:177104032-177104054 GGGAGGGGACTGAAGGGGCAGGG - Intergenic
1002167921 5:177359521-177359543 AGGCTGACACAGAAGGGGCAGGG - Intronic
1002271346 5:178074533-178074555 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002297725 5:178240616-178240638 GGGCGGGGACAGCAGGGGCAGGG - Intronic
1002449761 5:179311980-179312002 GGGAGGAGGGAGAAGGGGCATGG + Intronic
1002453189 5:179331238-179331260 GGGAGAGGACAGAAGGGGCAGGG + Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002795669 6:469425-469447 AGGGGGAGAGAGGAGGGGGACGG - Intergenic
1002812073 6:640259-640281 TGGGAGAGACAGAAGGGGTGCGG + Intronic
1002842772 6:920794-920816 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002843354 6:924546-924568 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1002902041 6:1417431-1417453 TGAGGGAAACAGGTGGGGCAGGG - Intergenic
1003131221 6:3396794-3396816 TGCGGGAGCCAGAAGGGAGATGG - Intronic
1003394785 6:5743716-5743738 TGGGGGAGAAAGAAGATGAATGG + Intronic
1003426173 6:5999679-5999701 GGAGGGAGACAGAAGGGGCGAGG - Intronic
1003487841 6:6595197-6595219 AGGGGGAGAAAGAAGAGGAAGGG + Intronic
1003495682 6:6661263-6661285 TGGGGGGAACAGAAGGAGCTGGG - Intergenic
1003499783 6:6694838-6694860 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1003533388 6:6955960-6955982 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004027307 6:11831705-11831727 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004235178 6:13868672-13868694 TGGGGGTGACGGCAGGGGAAAGG + Intergenic
1004350098 6:14883406-14883428 AGGGGACGGCAGAAGGGGCAGGG + Intergenic
1004417249 6:15436295-15436317 TGGGAGAGCCAGAAGGGAGATGG + Intronic
1004458782 6:15816678-15816700 TGGGGGAGACTGATGGGGAGTGG + Intergenic
1004746192 6:18511223-18511245 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1004953621 6:20702502-20702524 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1005794758 6:29347960-29347982 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1005874134 6:29998493-29998515 TGGGGGACACAGAAAGTCCATGG + Intergenic
1005969468 6:30749876-30749898 TGGCGGAGGCAGAATGGGCAGGG + Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006208931 6:32376045-32376067 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006641279 6:35491015-35491037 TGAGACAGACAGGAGGGGCAGGG + Intronic
1007089414 6:39172823-39172845 GGGGGGAGAAAAAAGGGGGAAGG + Intergenic
1007187024 6:39980562-39980584 GAGGGGAGACGGTAGGGGCAGGG + Intergenic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007381784 6:41494927-41494949 GGGGGGAGGCAGAGGGGGAAGGG + Intergenic
1007394000 6:41566931-41566953 TGGGAGAGACAGCAGGGCCATGG - Intronic
1007655233 6:43447646-43447668 GGTGGGAGACAGACGGGGAAAGG - Intronic
1007732479 6:43955570-43955592 TGGGGGAGACTGAAAGAGCTTGG + Intergenic
1007927025 6:45658055-45658077 TGAGGGAAAGAGAAGGGTCAAGG + Intronic
1008730865 6:54481193-54481215 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1009545487 6:65014536-65014558 TGTGGGATACAGAAGGGGATGGG + Intronic
1010503986 6:76633749-76633771 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1011106334 6:83785831-83785853 TGGGAGAGAAAGAAGGAGAAGGG + Intergenic
1011227723 6:85126519-85126541 AGGGGGAGCCAGCAGGAGCAAGG - Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1011713473 6:90079266-90079288 TGGAGGAGGGAGAAGGGACAAGG - Intronic
1011801603 6:91022171-91022193 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1012179591 6:96135643-96135665 CGGGGGAGAAAGAAGTGGGAGGG + Intronic
1012205676 6:96457847-96457869 TGGTGGAGCCAGAAGGGCAAGGG - Intergenic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1013055207 6:106576238-106576260 GGGGTGAGACAGGAGGGGGATGG + Intronic
1013071962 6:106737570-106737592 TGGAGGAGACACACAGGGCAAGG + Intergenic
1013516728 6:110894264-110894286 TGGGGGAGACACCAGGGAGAGGG - Exonic
1013814421 6:114080784-114080806 TAGGAGGGAGAGAAGGGGCAAGG + Intronic
1014247246 6:119081682-119081704 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1014846708 6:126286664-126286686 TGGTGGAGAAAGAAAGGCCAAGG - Intergenic
1015369877 6:132438578-132438600 TGGGGCAGTCAGCAGGGGTAAGG + Intergenic
1015431701 6:133138394-133138416 TGGGAGAGAGAGAAGGGGAAAGG - Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1016021002 6:139236046-139236068 TGGGGAGGCCAGAAGGGGGAAGG - Intergenic
1016109587 6:140206077-140206099 TGGGGGAGCCAGAAAGGAGATGG - Intergenic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1016783528 6:147986099-147986121 TGGGGAGGACAGAAGTGGGATGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017359180 6:153545966-153545988 TGGGGAGGGCAGAAGGAGCATGG - Intergenic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1017768351 6:157625248-157625270 TGGGGGTGAGAGAAAGGGCGGGG + Intronic
1017872933 6:158502212-158502234 TGGGGGCGGCAGAGGGGGCGGGG - Exonic
1017889820 6:158628913-158628935 GGGGGGAGACAGGAGGCTCACGG - Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018843043 6:167532196-167532218 TGGGGGAGCTAGAAGGGAGATGG - Intergenic
1019136560 6:169912166-169912188 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
1019178610 6:170173796-170173818 AGGGAGAGGAAGAAGGGGCAGGG + Intergenic
1019313833 7:375654-375676 TGGGGGGAACCGAACGGGCACGG + Intergenic
1019556185 7:1632726-1632748 GGGGGGAGGCAGAAGAGGCAAGG - Intergenic
1019738101 7:2660316-2660338 GGGAGGTGACAGAAGGGGCTGGG - Intronic
1020085672 7:5308955-5308977 TGGGGGAGAGAGGAGGGGCTTGG + Intronic
1020120040 7:5497984-5498006 TGGGGGAGAAAGTGGAGGCAGGG - Intronic
1020124780 7:5527260-5527282 TGGGGGACAAAAAAGGGGGAAGG + Exonic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020672081 7:11128724-11128746 TGGGAGAGACGGAAGGAGAACGG - Intronic
1021200955 7:17728257-17728279 TGGGAGAGAGGGAAGGGGAAAGG - Intergenic
1021202975 7:17746261-17746283 TGGGGGGGAGAGAAGGGGAAAGG - Intergenic
1021606242 7:22412208-22412230 AGAGGGAGAGAGAAAGGGCAAGG + Intergenic
1021989941 7:26131413-26131435 TGAGGGAAACAGAAGGGGAATGG + Intergenic
1022099951 7:27163509-27163531 TGGGGGTGAGAGAAGGGAGAAGG + Exonic
1022205505 7:28159644-28159666 TGGTGGAGAAAGTAGAGGCAGGG + Intronic
1022411751 7:30144081-30144103 TGGGGGAGACAGAGGGGAAGGGG - Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022739569 7:33108734-33108756 TGGGAGACAAAGAAGGGCCAGGG - Intronic
1022820610 7:33956542-33956564 AAGGGGAGACAGGAGAGGCAGGG - Intronic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023253539 7:38290687-38290709 TGGGGGAGCCAGACGGGAGATGG - Intergenic
1023366109 7:39464957-39464979 TGGGGGAGACAGGTGGGGGAAGG - Intronic
1024082396 7:45865996-45866018 TGGGGGAAAGGGATGGGGCAGGG + Intergenic
1024203063 7:47126034-47126056 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024268132 7:47622097-47622119 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024565515 7:50676815-50676837 TGGGTGGGACAGTAGGAGCAGGG + Intronic
1025208638 7:57008209-57008231 TGGGGGAGAGAGGAGGGGCTTGG - Intergenic
1025273537 7:57550943-57550965 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1025663309 7:63568669-63568691 TGGGGGAGAGAGGAGGGGCTTGG + Intergenic
1025851547 7:65248703-65248725 TGAGGGAAAGAAAAGGGGCAAGG + Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026837585 7:73648699-73648721 AGAGGGAGAGAGACGGGGCAGGG - Intergenic
1026952540 7:74357102-74357124 TGGGTGAGTCAGCAGGGGCCAGG + Intronic
1026986966 7:74560901-74560923 TGGTGGAGACAGAAGTGGATGGG - Intronic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027189979 7:75990947-75990969 TGGGGATGACAGAAGAGCCAAGG - Intronic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027932281 7:84552779-84552801 TCCGGGAGCCAGAAGGGGGATGG - Intergenic
1028455070 7:91029638-91029660 TGCAGGAAACAGAAGGGGAAGGG - Intronic
1029033216 7:97490597-97490619 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029605589 7:101597856-101597878 TGGGGAGGATAGAAGGGGCTGGG - Intergenic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1030343060 7:108402529-108402551 TTTGGGAGACAGAAGGAGCCTGG + Intronic
1030746563 7:113173039-113173061 TGGGGAAGCCAGAAGGGGAATGG - Intergenic
1030794414 7:113770292-113770314 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1031119029 7:117699532-117699554 TGGGGGAGATAGAAAGGACAGGG - Intronic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031870256 7:127083277-127083299 TGAGGGAGAAGGAAGAGGCAGGG - Intronic
1032544993 7:132734370-132734392 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1033217176 7:139501509-139501531 TGGGGGAGGGAGAAGGGCAAGGG + Intergenic
1033418502 7:141185376-141185398 TGAGGGAGCCAGAAGGGAGATGG + Intronic
1033545875 7:142399784-142399806 TGCGGGGAAGAGAAGGGGCATGG + Intergenic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1033970620 7:147034691-147034713 TGGGGAGGTCAGAAGGGGGATGG + Intronic
1034099272 7:148437308-148437330 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034446955 7:151118650-151118672 TGGTGGGGACAGGAAGGGCAGGG - Intronic
1034763596 7:153696467-153696489 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035260398 7:157658338-157658360 TGCGGGAGACAGAAGGCACAGGG + Intronic
1035262366 7:157670077-157670099 TGGGGGAGCAGCAAGGGGCACGG + Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036163081 8:6406866-6406888 CGGGGGAGAGAGCAGGAGCAGGG - Intronic
1036635819 8:10548868-10548890 TGGGGGAGACAGACTAGGAATGG + Intronic
1036649780 8:10634887-10634909 TTGGGGAGACTGGAGGGGCAAGG - Intronic
1036854201 8:12228398-12228420 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1037314953 8:17592077-17592099 TGGGGGAGAGGGAGGAGGCATGG - Intronic
1037577107 8:20217400-20217422 TGGGGAAGAGAGAAGTGGTAAGG - Intronic
1037635781 8:20700230-20700252 TGGGGGAGACAGCAGGAGCTAGG + Intergenic
1037817243 8:22118748-22118770 TGGGGCTCAGAGAAGGGGCAGGG - Intronic
1037876826 8:22552521-22552543 GGGGGGCGACACAAGGGGCAGGG + Intronic
1037918653 8:22788305-22788327 AGGGGGACAAAGAAGGAGCAGGG + Intronic
1038451209 8:27640033-27640055 GGGGAGGGACAGAAGAGGCATGG + Intronic
1038862381 8:31401625-31401647 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039382932 8:37102809-37102831 TGGAGGAAACAGGAGGAGCATGG - Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039475580 8:37837814-37837836 TGGTGGAGCCAGGAGGGGCCCGG + Exonic
1041312353 8:56529762-56529784 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1041934719 8:63322440-63322462 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042229783 8:66544071-66544093 TGGGGGATACAGAGCGGGCTTGG + Intergenic
1042372924 8:68013234-68013256 TGGGGAAGACAAAAGGCACAAGG - Intronic
1042598198 8:70471749-70471771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1043238457 8:77899699-77899721 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1043507242 8:80914691-80914713 AGGGGGAGACAAAAGGAGCTGGG - Intergenic
1043605284 8:81991723-81991745 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1044085340 8:87936428-87936450 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044607844 8:94062575-94062597 TGGGGGAGGGAGGTGGGGCAAGG - Intergenic
1044666813 8:94640771-94640793 AGGGGGAGACGTGAGGGGCAGGG - Intergenic
1044730587 8:95225812-95225834 TGGGAGGGACAGAAGGGGCCAGG - Intergenic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1045861522 8:106819235-106819257 TGGGGGAGCCAGAAGGGAGACGG - Intergenic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1046138915 8:110064051-110064073 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1046142709 8:110115894-110115916 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1046439218 8:114236628-114236650 TATGGGAGCCAGAAGGGGAACGG - Intergenic
1046870163 8:119197120-119197142 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1047202103 8:122775977-122775999 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047231627 8:123002536-123002558 TGGGGGACACAGAATACGCAAGG - Intergenic
1047313370 8:123710905-123710927 TGAAGGAGACAGAGGGGTCAAGG - Intronic
1047542607 8:125785030-125785052 TGGGGGAGCAAGAAGGGAGATGG - Intergenic
1047544464 8:125802480-125802502 AGGGGGAGAGAGAAGGAGAAGGG + Intergenic
1047800689 8:128306663-128306685 CGGGGGAGACTGATAGGGCAAGG - Intergenic
1047903101 8:129445015-129445037 TGGAGGAGACAGGAGGGGCCAGG + Intergenic
1048031112 8:130633420-130633442 AGGGGGAGAGAGGAGGGGAAGGG - Intergenic
1048135036 8:131740118-131740140 TGGGAGAGCCAGAAGGGAGATGG - Intergenic
1048277198 8:133075804-133075826 TGAGGGAGACAGAAGGCAAACGG + Intronic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1049068365 8:140337655-140337677 TGGGGGAGGCAGCAGGTTCAGGG - Intronic
1049154230 8:141057092-141057114 TGGGGCAGAGAGAAGGGGGTGGG - Intergenic
1049197472 8:141323675-141323697 TGTGTCAGACAAAAGGGGCAGGG - Intergenic
1049204991 8:141359509-141359531 TGGGGGTGGCAGGAGGGGCTGGG - Intronic
1049235216 8:141508753-141508775 TGGAGGTGACAGGAGGGGCCAGG + Intergenic
1049480689 8:142821059-142821081 TGGCTGAGACACAAGGGGCAGGG + Intergenic
1049499310 8:142953160-142953182 TGGGGGTGACAGGAAGGGGAGGG - Intergenic
1049684840 8:143935148-143935170 TGGGGCAGGCAGCAGGGGAAGGG + Intronic
1049726981 8:144151503-144151525 TGGGGGAGCCAGAAAGGAGATGG - Intronic
1049739865 8:144233460-144233482 TGCGGGAGAGAGAAGGTGGATGG - Intronic
1049739874 8:144233497-144233519 TGCGGGAGAGAGAAGGTGGATGG - Intronic
1049840569 8:144768578-144768600 TGAGGGAGAAAGAAGGGGAAAGG - Intergenic
1050043620 9:1521102-1521124 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1050089100 9:1998538-1998560 TGGTGGAGACAGTGGGGTCAGGG - Intergenic
1050342485 9:4654643-4654665 TGGGGGAGCCAGCAGGGAGATGG + Intronic
1050479300 9:6073393-6073415 TCGGGGAGTCAGAAGGGAGACGG - Intergenic
1050766491 9:9141212-9141234 GGGAGGAGAGAGAAGGGGGAGGG - Intronic
1050847831 9:10245749-10245771 GGGGGAAGACAGATGTGGCAGGG + Intronic
1051103580 9:13550957-13550979 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1051262597 9:15279420-15279442 TGGGGGAGAGAGAAGGTAAAGGG + Intronic
1051735884 9:20198690-20198712 TTGGGGAGAGAGAAGGGGGTGGG - Intergenic
1052025810 9:23571908-23571930 TGGGCTAGACAGAAGAGGTACGG + Intergenic
1052028660 9:23603842-23603864 TGGGGAAGAGCGAAGGGGCGGGG - Intergenic
1052069697 9:24067185-24067207 TGGGGGAGGCAGAATGCACAGGG + Intergenic
1052114913 9:24638879-24638901 TGGGGTAGGCAGAGGGGGGAGGG - Intergenic
1052509809 9:29401312-29401334 GGTGAGAGAGAGAAGGGGCAAGG + Intergenic
1052830245 9:33209367-33209389 TGGGGAAGACAGAAGGGATATGG + Intergenic
1052879230 9:33590481-33590503 TGGGGGTGAAAGATGGGGCTGGG + Intergenic
1052986378 9:34491064-34491086 TGGGTGATACAGAATGGGAAGGG + Intronic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053477199 9:38391081-38391103 TGGGGGAGGCAGGAGGGCCTTGG + Intergenic
1053496748 9:38553738-38553760 TGGGGGTGAAAGATGGGGCTGGG - Intronic
1053792622 9:41697573-41697595 TGGGTAAGGTAGAAGGGGCAGGG - Intergenic
1054181036 9:61909594-61909616 TGGGTAAGGTAGAAGGGGCAGGG - Intergenic
1054472329 9:65548395-65548417 TGGGTAAGGTAGAAGGGGCAGGG + Intergenic
1054656555 9:67671548-67671570 TGGGTAAGGTAGAAGGGGCAGGG + Intergenic
1054855375 9:69893521-69893543 TGGGGAAGACAATAGGGACATGG - Intronic
1054986632 9:71269352-71269374 TGAGGGACTCAGCAGGGGCATGG + Intronic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1055365694 9:75542353-75542375 TGGGGAAGAGAGAAGGGGTGGGG + Intergenic
1056004606 9:82255544-82255566 TGAGGGAGACAGAACAGGAAAGG + Intergenic
1056689033 9:88790244-88790266 TGAGAGACAGAGAAGGGGCAAGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1056935657 9:90913479-90913501 TGGGGGAGAAAACAGGGGCTTGG - Intergenic
1057676663 9:97141294-97141316 TGGGGGTGAAAGATGGGGCTGGG - Intergenic
1057914361 9:99044263-99044285 AGTGGGAGCCTGAAGGGGCATGG + Intronic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058311933 9:103514845-103514867 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1058584468 9:106492243-106492265 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG + Intergenic
1059001759 9:110356055-110356077 AGGAAGAGAGAGAAGGGGCAGGG - Intergenic
1059042495 9:110829909-110829931 TGGCGGAGCCAGAAGGGAGACGG - Intergenic
1059042603 9:110830565-110830587 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059336538 9:113572595-113572617 TGGGGCAGACAGATAAGGCAAGG + Intronic
1059930469 9:119255403-119255425 TGGGGGAGCCAGAGGTGGGAGGG + Intronic
1060105378 9:120869799-120869821 TGGAGGAGGCAGGAGAGGCAGGG + Intronic
1060792708 9:126496968-126496990 TGGAGGAGACAGGAGGGGCTGGG + Intronic
1061226625 9:129284361-129284383 TGGGGGAGAGAAAAGGGCCCAGG + Intergenic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061625316 9:131837870-131837892 TGGGGGAGACAGCAGGAGCTGGG - Intergenic
1061726253 9:132583451-132583473 TGGTGGAGACAGTGTGGGCAGGG + Intronic
1061744033 9:132726758-132726780 TGGGAGAGACCGCAGGGACAGGG + Intronic
1061794951 9:133081140-133081162 TGGGGGAGAGGGCTGGGGCAGGG - Intronic
1062025321 9:134337581-134337603 TACTGGAGACAGAAGGGACACGG + Intronic
1062052412 9:134454452-134454474 TGGAGGAGACAAATGGGGCCTGG - Intergenic
1062090661 9:134677073-134677095 GGGGAGACACAGAAGAGGCAGGG + Intronic
1062143736 9:134976726-134976748 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1062158580 9:135067447-135067469 TGGGGAAGACACACGCGGCAGGG + Intergenic
1062270739 9:135707235-135707257 TGGGGGAATGAGCAGGGGCATGG + Intronic
1062374114 9:136254340-136254362 AGGGGGTGTCAGAAGCGGCATGG - Intergenic
1062386044 9:136311901-136311923 TGGGGGACAGAGCAGGGGAAGGG + Intergenic
1185459829 X:328866-328888 GGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185459839 X:328886-328908 AGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185581519 X:1213628-1213650 GGGAGGAGACGGAAGGGGGAGGG - Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185837749 X:3360948-3360970 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1185942865 X:4340803-4340825 TGGGGGAGCCAGCAGGGAGATGG + Intergenic
1186074079 X:5857406-5857428 TGCGAGAGAGAGAAGGGGGAAGG + Intronic
1186907410 X:14126666-14126688 TGTGGAAGACAGAAGGTGCCAGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187329991 X:18328990-18329012 TGGGGGAGACAGGAGGCACTAGG + Intronic
1187391620 X:18890054-18890076 TGAGGGAGACAGCAGGGACTGGG + Intergenic
1187682980 X:21786642-21786664 TGGGGAAGTGAGAAAGGGCAGGG - Intergenic
1188152487 X:26695204-26695226 AGAGGGAGGCAGAAGGGTCAAGG + Intergenic
1188309652 X:28600507-28600529 TGGGGGTCAAGGAAGGGGCAAGG + Intronic
1188735389 X:33707473-33707495 TGTGGCAGACAGAGGGAGCAAGG - Intergenic
1188841991 X:35027717-35027739 TGGAGGAGGCAGTAGGGGAAGGG - Intergenic
1188921033 X:35977572-35977594 GGAGGGAGAGAGAAGGGGAAGGG - Intronic
1189548888 X:42072589-42072611 TGGGGAAGAGACAAGGGGAAGGG + Intergenic
1189959065 X:46307555-46307577 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1190222582 X:48521922-48521944 TGGGGGAGGGAGCAGGGGCCGGG - Intronic
1190277716 X:48909998-48910020 TGTGGGGAACGGAAGGGGCAAGG + Intronic
1190662084 X:52664009-52664031 TGGAGGAGACATCAGGTGCAGGG + Intronic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192050553 X:67720335-67720357 TGGAGGAAAGAGAAGGGGAAAGG - Intronic
1192211821 X:69132702-69132724 TGAGTGAAACAGAAAGGGCAGGG - Intergenic
1192219555 X:69188158-69188180 TTAGGGAGACTGAAGAGGCAGGG - Intergenic
1192442026 X:71181737-71181759 TGGGGGAAACCCAAGGGCCAGGG - Intergenic
1192502641 X:71663965-71663987 TGGGGGAGACAGGGAGGACAGGG - Intergenic
1193358422 X:80551155-80551177 TCGGGGAGCCAGAAGGGAGATGG + Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193607661 X:83588485-83588507 TGGGGGAGCCAGATGGGAAATGG + Intergenic
1193702468 X:84779913-84779935 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1193834647 X:86326690-86326712 TGGAGGACACAGGAGGGACAAGG - Intronic
1193836339 X:86349181-86349203 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1193898240 X:87141118-87141140 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
1194535672 X:95103551-95103573 TGCGGGAGTCAGAAGGGAGATGG + Intergenic
1194859560 X:98980032-98980054 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1196072302 X:111539336-111539358 TGGGGGAACCAGAAGGGAGATGG - Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196261398 X:113586386-113586408 TGGTGGAGCCAGAAGGGAGATGG + Intergenic
1196505587 X:116437114-116437136 TGGGAGGGAGAGAAGGGACAGGG - Intronic
1197222181 X:123924808-123924830 TGGGGGGGGCAGGAGGGACAGGG + Intergenic
1197302875 X:124802549-124802571 TGTGGGAGCCATATGGGGCAAGG - Intronic
1197677721 X:129347841-129347863 TGTGGGAGAAAGTAGGGGAAGGG + Intergenic
1198111017 X:133502638-133502660 TGAGAAAGACAGAAGGGGCCAGG - Intergenic
1198388545 X:136150354-136150376 CGGGGGAGAAAGGAGAGGCATGG - Intronic
1198524862 X:137490981-137491003 GGGGGGATACAGAAGAGGCAAGG - Intergenic
1198750017 X:139930499-139930521 TGGGGGTGACAAAAAGGGAAAGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198964274 X:142210757-142210779 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
1199143309 X:144335917-144335939 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1199365036 X:146971326-146971348 AGGGGGACAGAGCAGGGGCAAGG - Intergenic
1199382333 X:147184445-147184467 AGGGGGACAGAGCAGGGGCAAGG + Intergenic
1199474546 X:148231117-148231139 TGAGGGAGAGAGAAGGGGAGTGG - Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199623613 X:149720861-149720883 TGAGGGAGATAGAAGTGGTAAGG - Intergenic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1199683019 X:150240426-150240448 TGGGGGACACAGCAGGAGCAAGG + Intergenic
1199686789 X:150272242-150272264 TGAGGGAGACGGAAAGGTCAAGG + Intergenic
1199799035 X:151231110-151231132 TGGGCCAGATAGAAGAGGCAGGG + Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200804823 Y:7422489-7422511 TGGGGAAGGGAGAGGGGGCAGGG - Intergenic
1200955187 Y:8937524-8937546 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1201412375 Y:13713199-13713221 TGGGGGAGCCAGAAAGGAAATGG + Intergenic