ID: 1172411591

View in Genome Browser
Species Human (GRCh38)
Location 20:34727867-34727889
Sequence TAGCAGGGCGTGGTGTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1244
Summary {0: 1, 1: 1, 2: 68, 3: 316, 4: 858}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172411591_1172411601 28 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411601 20:34727918-34727940 TTTCACCACACTGGCCAGGATGG 0: 8
1: 345
2: 4922
3: 43803
4: 162480
1172411591_1172411595 2 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411595 20:34727892-34727914 TTTTGTCTTTTTAGTAGAGATGG 0: 650
1: 203548
2: 144285
3: 71660
4: 58285
1172411591_1172411596 3 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411596 20:34727893-34727915 TTTGTCTTTTTAGTAGAGATGGG 0: 349
1: 91391
2: 247294
3: 162065
4: 91733
1172411591_1172411599 19 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
1172411591_1172411597 4 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411597 20:34727894-34727916 TTGTCTTTTTAGTAGAGATGGGG 0: 330
1: 86252
2: 177172
3: 179561
4: 120265
1172411591_1172411600 24 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411600 20:34727914-34727936 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328
1172411591_1172411598 5 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411598 20:34727895-34727917 TGTCTTTTTAGTAGAGATGGGGG 0: 10
1: 1837
2: 3926
3: 4585
4: 5227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172411591 Original CRISPR TAGCAGGGCGTGGTGTCACA TGG (reversed) Intronic
901047108 1:6403661-6403683 TAGCCAGGCATGGTGGCACATGG - Intergenic
901382397 1:8883239-8883261 TAGCCGGGCGTGGTGGCATGCGG - Intergenic
901538528 1:9899611-9899633 TAGCCGGGCATGGTGACGCATGG + Intronic
901804727 1:11731092-11731114 TAGCCGGGTGTGGTGGCACATGG + Intergenic
902364796 1:15965560-15965582 CAGCTGGGAGTGGAGTCACAGGG - Intronic
902539058 1:17139476-17139498 TAGCCAGGCATGGTGGCACATGG + Intergenic
902610963 1:17596907-17596929 TAGATGGGCGTGGTGGCACACGG + Intronic
902774087 1:18663526-18663548 TAGCTGGGCATGGTGGCACATGG - Intronic
903096865 1:20984733-20984755 TAGCTGGGCGTGGTGGCATGTGG - Intronic
903212479 1:21826213-21826235 TAGCTGGGTGTGGTGGCACATGG - Intronic
903247776 1:22028796-22028818 TATCTGGGTGTGGTGGCACATGG - Intergenic
903782217 1:25828003-25828025 AAGCAGGGCGCGGTGGCTCATGG - Intronic
903949155 1:26984545-26984567 TAGCTGGGCATGGTTGCACATGG - Intergenic
904166146 1:28556827-28556849 TAGCTGGATGTGGTGGCACACGG - Intronic
904223495 1:28993800-28993822 TAGCCTGGCATGGTGGCACATGG - Intronic
904238991 1:29131944-29131966 TAGCTGGGTGTGGTGGTACATGG - Intergenic
904303770 1:29573775-29573797 AGGCAGTGGGTGGTGTCACATGG + Intergenic
904551943 1:31325882-31325904 TAGCTGGGTGTGGTGGCAGAAGG + Intronic
904739857 1:32665530-32665552 TAGCTGGGCGTCATGGCACATGG + Intronic
904852920 1:33472748-33472770 TAGGAGGTGGTGGTGACACAGGG + Intronic
905056406 1:35097788-35097810 TAGCCGGGCGTGGTGGTGCATGG - Intronic
905193793 1:36257984-36258006 TAGCCGGGCATGGTGGCACATGG - Intronic
905211664 1:36378602-36378624 TAGCCAGGCGTGGTGGCGCACGG - Intronic
905422360 1:37856643-37856665 TAGCCAGGCTTGGTGGCACATGG - Intronic
905442259 1:38003245-38003267 TAGCTGGGCATGGTGGCACATGG - Intronic
905577209 1:39054866-39054888 TAGCTGGGCGTGGTGGCGCGTGG - Intergenic
905699792 1:40002811-40002833 TAGCTGAGTGTGGTGGCACACGG + Intergenic
905723694 1:40229731-40229753 TGGCCGGGCGTGGTGTCTCATGG - Intronic
905809302 1:40900110-40900132 TAGCTGGGCGTGATGGCACGTGG + Intergenic
906398127 1:45484588-45484610 TAGCCGGGCGTGGTGGTGCACGG + Intronic
906479461 1:46190581-46190603 GAGCAGGGCAAGGGGTCACATGG + Intronic
906620597 1:47275004-47275026 TAGCCGGGCATGGTGGCACACGG + Intronic
907211118 1:52823319-52823341 TAGCTGGGTGTGGTGGCACCTGG + Exonic
907835537 1:58105130-58105152 TTGCAGGGCTTGATCTCACATGG - Intronic
907892846 1:58651696-58651718 TAACTGGGCATGGTGGCACACGG + Intergenic
908193529 1:61727101-61727123 TAGCCAGGCGTGGTGACTCATGG - Intergenic
909655627 1:78028853-78028875 TATCCGGGCATGGTGGCACATGG + Intronic
909766162 1:79358830-79358852 TAGCCGGGCGTGGTGGCACACGG - Intergenic
910089185 1:83442022-83442044 TAGCTGGGCATGGTGGCACATGG + Intergenic
910180011 1:84472462-84472484 TAGCTGGGCATGGTGGCACATGG - Intergenic
910374617 1:86554408-86554430 TAGCTGGGCATGGTGACAGAGGG - Intronic
910583714 1:88856122-88856144 TAGCTGGGCGTGGTGGCACGTGG + Intronic
910690890 1:89964637-89964659 CAGCTGGGCGTGGTGGCTCACGG - Intergenic
910728946 1:90369868-90369890 TAGCCAGGCATGGTGGCACATGG - Intergenic
910789231 1:91033979-91034001 TAGCCGTGCGTGGTGGCACGTGG - Intergenic
911607718 1:99927481-99927503 TAGCCAGGCTTGGTGGCACATGG - Intergenic
912791172 1:112652334-112652356 TAGCTGGGCATGGTGGCACATGG + Intronic
913037654 1:114987517-114987539 TAGCCAGGTGTGGTGGCACATGG + Intronic
914719209 1:150275355-150275377 TAGCTGGGCATGGTGGCACATGG + Intronic
914734552 1:150402819-150402841 TAGCCGGGCATGATGGCACATGG + Intronic
915121982 1:153634997-153635019 TAGCCGGGCGTGGTGGCGCATGG - Intronic
915294020 1:154907397-154907419 TAGCCAGGCTTGGTGGCACATGG + Intergenic
915370671 1:155347252-155347274 TAGCCGGGCATGGTGGCACGTGG + Intronic
915428489 1:155846863-155846885 TAGCTTGGCATGGTGGCACACGG + Intronic
915459370 1:156060731-156060753 TAGCTGGGCGTGGTGGCACATGG - Intergenic
915606349 1:156954232-156954254 TAGCTGGGTGTAGTGGCACATGG + Intronic
915968236 1:160331026-160331048 TAGCTGGGCATGGTGGCACATGG + Intronic
917351464 1:174082608-174082630 TAGCTGGGTGTGGTGGCACGCGG + Intergenic
918475626 1:184921149-184921171 TAGCCGGGCGTGGTGGCACATGG + Intronic
918907087 1:190510684-190510706 GAGCTGGGCATGGTGGCACAGGG + Intergenic
918977646 1:191511620-191511642 TAGCCAGGCGTGGTGGCAGATGG - Intergenic
919427722 1:197453720-197453742 TAGCCAGGTGTGGTGGCACATGG - Intronic
919454539 1:197805897-197805919 TAGCCGGGCGTGGTGGTGCATGG - Intergenic
919657237 1:200209229-200209251 TAGCCAGGCATGGTGGCACATGG + Intergenic
919884989 1:201926871-201926893 TAGCTGGGAGTGGTGGCACGTGG + Intronic
919902017 1:202050852-202050874 TAGCTGGGCGTGGTTGCAGATGG + Intergenic
919998841 1:202779331-202779353 TAGCCAGGCGTGGTGGCACGCGG + Intronic
920309368 1:205039776-205039798 TAGCAGGACTGGGTGTCAAACGG + Intergenic
920429404 1:205907164-205907186 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
920835786 1:209509620-209509642 TGGCCGGGCGTGGTGGCTCACGG + Intergenic
921567354 1:216736327-216736349 TAGCCGGGCGTGGTGGCGGACGG - Intronic
922202262 1:223415505-223415527 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
922487839 1:225989481-225989503 TAGCCGGGTGTGGTGGCACATGG + Intronic
922506710 1:226130322-226130344 TAGCTGGGCGTGGTAGCACGCGG + Intergenic
922544672 1:226447152-226447174 TAGCTAAGCGTGGTGGCACACGG + Intergenic
922933247 1:229406258-229406280 TAGCCGGGCGTGGTGGTGCATGG + Intergenic
923307789 1:232703998-232704020 TAGCTGGGCATGGTGACGCATGG + Intergenic
923403767 1:233640848-233640870 TAGTTGGGTGTGGTGGCACAAGG - Intronic
923731766 1:236558082-236558104 TTGCAGGGTGTGGTGGCTCACGG - Intronic
923777691 1:236994914-236994936 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
923878034 1:238072341-238072363 TAACTGGGCATGGTGGCACACGG + Intergenic
924041779 1:239990978-239991000 TAGCTGGGCGTGGTGGCACATGG + Intergenic
924069615 1:240262904-240262926 TAGCTGGGCGTGGTGGCAGGTGG - Intronic
1062874752 10:933976-933998 TAGCTGGGCGTGGTGGCATGCGG - Intergenic
1063216321 10:3929171-3929193 TAGCTGGGCGTGGTGGCAGGTGG + Intergenic
1063669180 10:8086022-8086044 TAGCCGGGCGTGGTGGTGCATGG + Intergenic
1063766515 10:9147646-9147668 CAGCTGGGCGTGGTGGCTCACGG - Intergenic
1063830085 10:9942534-9942556 TAGCTGGGCGTGGTGGCACATGG + Intergenic
1063833836 10:9988333-9988355 TAGCTGGGCGTGGTGGCACATGG + Intergenic
1063921033 10:10933155-10933177 TAGCCAGGCATGGTGGCACACGG + Intergenic
1064412915 10:15123381-15123403 TAGCTGGGTGTGGTGGCACGTGG + Intronic
1064537345 10:16370964-16370986 TTGCAAGGTGTGGTGGCACACGG - Intergenic
1064870076 10:19927554-19927576 TAGCTGGGCGTGGTGGCGCATGG + Intronic
1065537949 10:26732961-26732983 TAGCTGGGCGTGGTGGCATACGG + Intronic
1065550856 10:26867345-26867367 TAGCTGGTCGTGGTGGCACGTGG - Intergenic
1065587977 10:27239049-27239071 TAGCCGGGCATGGTGACGCACGG + Intronic
1065830033 10:29606898-29606920 TAGCCGGGTGTGGTGGCACGTGG - Intronic
1065902100 10:30217564-30217586 TAGCCGGGCGTGGTGGCACATGG - Intergenic
1066088705 10:31996436-31996458 TAGCTGGGCGTGGTGGCACATGG + Intergenic
1066123669 10:32317494-32317516 TAGCCGGGTGTGGTGGCACATGG + Intronic
1066272653 10:33838370-33838392 TAGCAGGATGTGGTGGCACATGG + Intergenic
1066312467 10:34211280-34211302 TACCAGGGCTTGGGGTCACACGG - Intronic
1066381116 10:34901925-34901947 TAGCTGGGCATAGTGGCACATGG + Intergenic
1066584575 10:36918502-36918524 TAGCTAGGAGTGGTGGCACATGG + Intergenic
1066773447 10:38865976-38865998 TAGCATGGAATGGTGTCGCATGG + Intergenic
1067077757 10:43197765-43197787 TTGCAGAGCTTGGAGTCACAGGG - Intronic
1067451521 10:46384854-46384876 TGGCAGGGGGTGGGGCCACATGG - Intronic
1067477042 10:46574088-46574110 GGGCAGGGGGTGGGGTCACAGGG + Intergenic
1067486291 10:46653696-46653718 TAGCTGGGCGTGGTGGTAGACGG - Intergenic
1067585718 10:47474902-47474924 TGGCAGGGGGTGGGGCCACATGG + Intronic
1067608464 10:47687952-47687974 TAGCTGGGCGTGGTGGTAGACGG + Intergenic
1067617699 10:47767693-47767715 GGGCAGGGGGTGGCGTCACAGGG - Intergenic
1068131221 10:52897637-52897659 TAGCCCAGCGTGGTGGCACATGG - Intergenic
1068798711 10:61114822-61114844 TAGCCGGGTGTGGTGGCACATGG - Intergenic
1068979505 10:63046833-63046855 TAGCCGGGTGTGGTGACACACGG + Intergenic
1068986499 10:63112243-63112265 TAGCTGGACATGGTGGCACAGGG + Intergenic
1069019617 10:63471890-63471912 TAGCTGGGCATGGTGGCACATGG + Intergenic
1069449392 10:68504160-68504182 TAGCCGGGCGTAATGGCACACGG - Intronic
1069756831 10:70778690-70778712 TACCAAGGCCTGGTGGCACAGGG - Intronic
1069977550 10:72226525-72226547 TAGCTGGGTGTGGTGGCACGTGG + Intronic
1069998169 10:72355865-72355887 TAGCCGGGCATGGTGGCACATGG + Intergenic
1070070597 10:73085527-73085549 TAGCCAGGCGTGGTGGCACATGG - Intronic
1070101291 10:73389769-73389791 TAGCTGGGCATGGTGGCACATGG - Intronic
1070247055 10:74742765-74742787 TAGCCGGGTGTGGTGGCACACGG - Intergenic
1070262860 10:74874522-74874544 TAGCTGGGTGTGGTGGCGCATGG - Intronic
1070270252 10:74947140-74947162 TAGCTGGGCGTGGTAGCACACGG - Intronic
1070285174 10:75077825-75077847 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
1070319446 10:75343661-75343683 TAGCAGGACCTGGAGTCACTGGG - Intergenic
1071624052 10:87149575-87149597 TAGCTGGGCGTGGTGGTAGATGG + Intronic
1071892474 10:90026140-90026162 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
1072389898 10:94972543-94972565 TAGCCAGGCATGGTGGCACATGG + Intronic
1072417961 10:95264539-95264561 TAAGAGGGTGTGGTGTCACAGGG + Intronic
1072649844 10:97286444-97286466 TAGCTGGACGTGGTGGCACATGG + Intronic
1073200936 10:101734844-101734866 TAGCTGGGCGTGGTGGTGCATGG + Intergenic
1073240528 10:102055173-102055195 TAGCTGGGCGTGGTAGCGCAAGG + Intronic
1073438870 10:103540433-103540455 TAGCCAGGTGTGGTGGCACACGG - Intronic
1073986424 10:109214934-109214956 TAGCCAGGCATGGTGACACATGG + Intergenic
1074053801 10:109903988-109904010 TAGCTGGGCGTGGTGGCTCATGG - Intronic
1074311785 10:112328682-112328704 TAGCAGGGGAGGGGGTCACAAGG - Intergenic
1074368800 10:112882109-112882131 TAGTAGGGAGTGGGGTGACAAGG + Intergenic
1074466569 10:113688113-113688135 TAGCTAGGCATGGTGGCACACGG - Intronic
1075120474 10:119660811-119660833 TGGCTGGGCGTGGTGGCTCACGG + Intronic
1075137803 10:119801592-119801614 TAGCCAGGCCTGGTGGCACATGG + Intronic
1075757618 10:124826946-124826968 TAGCTGGGTGTGGTGGCACGTGG + Intronic
1077034106 11:486560-486582 TGGCCGGGCGTGGTGGCTCACGG + Intronic
1077085057 11:745952-745974 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1077256752 11:1588142-1588164 AAGCCAGGCGTGGTGGCACACGG - Intergenic
1077760487 11:5090593-5090615 TGGCTGGGCGTGGTGGCTCAAGG - Intergenic
1077943275 11:6867355-6867377 TAGCTGGCCGTGGTGGCACATGG - Intergenic
1078183564 11:9032258-9032280 TAGCTGAGCGTGGTGGCACATGG - Intronic
1078395757 11:10980567-10980589 TAGCCGGGCGCGGTGGCTCACGG - Intergenic
1079203298 11:18393544-18393566 TAGCCGGGCGTGGTGGCGCCTGG + Intergenic
1080367564 11:31593385-31593407 TAGCTGGGTGTGGTGGCACATGG - Intronic
1080650759 11:34221114-34221136 TAGCCGGGCGTGGTGGCGCATGG - Intronic
1080735882 11:35013144-35013166 TAGCTGGGCGTGGTGGCATGCGG + Intronic
1081089962 11:38852075-38852097 TAGCCGGGCGTGGTGGCACATGG + Intergenic
1081704537 11:45173474-45173496 TAGCTGGGCGTGGTGGCGCACGG + Intronic
1081796323 11:45822835-45822857 TAGCTGGGCACGGTGGCACATGG + Intergenic
1081999463 11:47385735-47385757 TAGCCGGGTGTGGTGGCACACGG - Intergenic
1082858038 11:57827066-57827088 TAGCTGGGTGTGGTGTCATGGGG + Intergenic
1083230973 11:61319058-61319080 TAGCCAGGCGTGGTGGCGCATGG + Intronic
1083373010 11:62196594-62196616 TAGCTGGGCGTGGTGGTGCATGG - Intergenic
1083408641 11:62476241-62476263 TAGCTGGGCATGGTGGCGCATGG + Intronic
1083443869 11:62694347-62694369 TAGCTGGGCATGGTGGCTCACGG - Intronic
1083470819 11:62882628-62882650 TATCTGGGTGTGGTGGCACACGG - Intronic
1083602851 11:63959690-63959712 TAGCCAGGCGTGGTGGCACGTGG + Intergenic
1084072747 11:66746728-66746750 TAGCAGGGTGTGGTGGCAGGCGG + Intronic
1084121630 11:67072317-67072339 AGGCAGGGCGTGGTGGCTCATGG - Intergenic
1084128018 11:67113876-67113898 CAGCTGGGCGTGGTGGCTCACGG + Intergenic
1084138246 11:67203944-67203966 TAGCTGGGCGTGGTGGTACGCGG - Intronic
1084138484 11:67206283-67206305 TAGGCAGGCGTGGTGGCACACGG + Intronic
1084230931 11:67752255-67752277 TAGCTGGGCTTGGTGGCACAAGG + Intergenic
1084375752 11:68776251-68776273 TAGCCAGGTGTGGTGGCACATGG + Intronic
1084884791 11:72196691-72196713 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1085098131 11:73777326-73777348 TAGCTGGGCGTGGCGGCGCATGG + Intergenic
1085155300 11:74287869-74287891 TAGCTGGGCATGGTGGCACATGG + Intronic
1085626960 11:78081089-78081111 TAGCAGGGGAGGGGGTCACAAGG - Intergenic
1085745212 11:79109304-79109326 TTGGAGGGCTTGGTGTGACAAGG + Intronic
1085812929 11:79701985-79702007 TAGCCAGGCATGGTGACACATGG - Intergenic
1086161189 11:83723708-83723730 TAGCCAGGCATGGTGGCACATGG + Intronic
1087098456 11:94342505-94342527 TAGTTGGGTGTGGTGGCACATGG - Intergenic
1087530304 11:99373061-99373083 TAGCGGGGCATGGTGGCACATGG + Intronic
1087785658 11:102351467-102351489 TAGCTGGGCGTGGTGGCGCGTGG + Intronic
1088244835 11:107807717-107807739 TAGCTGGGCATGGTGGCAGATGG - Intronic
1088335882 11:108703473-108703495 TAGCTGGGAGTGGTGGCACACGG - Intronic
1088502967 11:110501604-110501626 TAGCTGGGCCTGGTGCCACATGG + Intergenic
1089252770 11:117177060-117177082 TAGCTGGGCGTGGTGGCACATGG + Intergenic
1089605721 11:119640214-119640236 GAGCAGGGTGTGGGGTTACAGGG - Intronic
1090006341 11:123005977-123005999 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1090012083 11:123054132-123054154 TAGCCGGGCATGGTGGCGCATGG + Intergenic
1090841691 11:130494896-130494918 TAGCTAGGCATGGTGGCACACGG - Intergenic
1091341728 11:134820974-134820996 TAGCAGGGCATGGTGGCATGCGG + Intergenic
1091498986 12:997062-997084 TAGCCAGGCATGGTGGCACATGG - Intronic
1091577445 12:1751658-1751680 TAGCCGGGTGTGGTGGCACGTGG - Intronic
1091872840 12:3909361-3909383 TAGCCGGGCGTGGTGGCAGGTGG + Intergenic
1091885312 12:4012837-4012859 TAGCTGGGTGCGGTGGCACATGG + Intergenic
1092130411 12:6108146-6108168 TAGCCAGGCGTGGTGACACCTGG + Intronic
1092361782 12:7842872-7842894 TAGCTGGGTGTGGTGGCACATGG - Intronic
1092412715 12:8266564-8266586 TAGCTGGGCTTGGTGGTACATGG - Intergenic
1092613309 12:10193785-10193807 TAGTGGGGTGTGGTGGCACACGG + Intergenic
1092615411 12:10212096-10212118 TAGCTGGGCGTGGTGGCGCATGG - Intergenic
1092745399 12:11667978-11668000 TGGCTGGGCGTGGTGGCTCACGG - Intronic
1092816341 12:12315511-12315533 TAGCTGGGCGTGGTGGCGCATGG - Intergenic
1092840676 12:12538146-12538168 TAGCCAGGCGTGGTGGCGCACGG - Intronic
1092854027 12:12656347-12656369 TAGCAGGGCGTGTTGGCACGGGG + Intergenic
1092864741 12:12750224-12750246 TAACTGGGTGTGGTGGCACATGG + Intronic
1093519492 12:20031883-20031905 TAGCCAGGCGTGGTGGCCCATGG + Intergenic
1094198441 12:27774000-27774022 TAGCTGGGTGTGGTGGCACACGG + Intergenic
1094366666 12:29690077-29690099 TAGCAGGGATTGGTTTCAAAAGG - Intronic
1094562323 12:31567170-31567192 TAGCTGGGTGTGGTGGCACGTGG + Intronic
1094648960 12:32356505-32356527 TAGCTGGGCGTAGTGGCACTGGG + Intronic
1094680079 12:32660067-32660089 CAGGAGGGTGTGCTGTCACAGGG - Intergenic
1094714799 12:33002518-33002540 TAGCAGGGCATGGTGGCACACGG - Intergenic
1094717599 12:33028779-33028801 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1095435669 12:42185030-42185052 TAGCTGGGCTTGGTGGCGCATGG + Intronic
1095704129 12:45219480-45219502 TGGCCAGGCATGGTGTCACAAGG - Intronic
1095770327 12:45947820-45947842 TAGCCGGGCATGGTGACACATGG - Intronic
1096340504 12:50794417-50794439 TAGCTGGGCGTGGTGGCACGTGG + Intronic
1096744853 12:53719378-53719400 TAGCTGGGCATGGTGGCACATGG + Intronic
1096768108 12:53911020-53911042 TAGCTGGGCATGGTGGCACGTGG - Intergenic
1097111236 12:56659806-56659828 TAGCCAGGAGTGGTGGCACATGG + Intergenic
1097278694 12:57830892-57830914 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1097286844 12:57884590-57884612 TAGCCGGGCTTGGTGGCACATGG + Intergenic
1097839469 12:64307719-64307741 CAGCTGGGCGTGGTGGCCCAGGG + Intronic
1097862066 12:64527787-64527809 TAGCTGAGCATGGTGGCACATGG + Intergenic
1097890278 12:64770990-64771012 TGGCCGGGCGTGGTGGCTCACGG - Intergenic
1097934594 12:65231539-65231561 TAGCTAGGTGTGGTGGCACATGG + Intronic
1098137427 12:67417319-67417341 TAGCTGGGCATGGTGGCACGTGG + Intergenic
1098459508 12:70716699-70716721 TTGCTGGGCGTGGTGGCTCATGG + Intronic
1098991329 12:77067116-77067138 TAGCTGGGCGTGGTGGCGCACGG - Intergenic
1099306285 12:80960002-80960024 TTGCTGGGCATGGTGGCACATGG - Intronic
1099610536 12:84862933-84862955 TAGCTGGGCATGGTAGCACACGG - Intronic
1099930274 12:89066204-89066226 TAGCTGGGCATGGTGGTACATGG + Intergenic
1100227166 12:92570585-92570607 TAGCAGGGCTTAGTGACACATGG + Intergenic
1100378944 12:94043860-94043882 TAGCTGGGCGTGGTGGCGGATGG + Intergenic
1100383764 12:94086376-94086398 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1100396233 12:94188602-94188624 TGGCTGGGCGTGGTGGCTCACGG - Intronic
1100481667 12:94985177-94985199 TAGTCGGGCATGGTGGCACATGG + Intronic
1100491216 12:95080095-95080117 TAGCCGGTCGTGGTGGTACATGG - Exonic
1100653825 12:96619007-96619029 TAGCCAGGTGTGGTGACACATGG - Intronic
1100684987 12:96977858-96977880 TAGCAGAGCGTGGTATAACTTGG + Intergenic
1100838454 12:98589186-98589208 TAGCTGGGCGTGGTGGCGCGCGG - Intergenic
1101008546 12:100426579-100426601 TAGCTAGGTGTGGTGGCACATGG - Intergenic
1101105286 12:101434537-101434559 TAGCCGGGCGTGGTGGCACGTGG + Intergenic
1101112948 12:101504331-101504353 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1101342608 12:103856541-103856563 TAGCCAGGCATGGTGGCACACGG - Intergenic
1101912758 12:108872819-108872841 TAGCAGGGCTTGGAGTAAGATGG + Intronic
1101933516 12:109036012-109036034 TAGCTGGGCATGGTGGCCCATGG + Intronic
1102071806 12:110026429-110026451 TAGCTGGGTGTGGTGGCCCATGG + Intronic
1102092195 12:110200802-110200824 TAGCTGGGTGTGGTGGCACATGG + Intronic
1102344120 12:112147814-112147836 TAGCCGGGCGTGGTGGCACTTGG - Intronic
1102476930 12:113194817-113194839 TAGCCAGGCATGGTGGCACACGG - Intergenic
1102671051 12:114619218-114619240 TAGCTGGGCATGGTGGCACATGG - Intergenic
1102705603 12:114877777-114877799 TAGCTGGGTGTGGTGGCACATGG - Intergenic
1102882723 12:116498034-116498056 TAGCTGGGCGTGGTGGCGCATGG + Intergenic
1103006548 12:117425251-117425273 TAGCTGGGCATGGTGGCTCAAGG + Intronic
1103487116 12:121290542-121290564 TAGCCAGGCGTGGTGGCGCAGGG + Intronic
1103496737 12:121368541-121368563 TAGCTGGGTGTGGTGACACGTGG - Intronic
1103593963 12:122011832-122011854 TAGCTGGGCATGGTGGCACAAGG + Intergenic
1103622883 12:122199727-122199749 TAGCTGGGCGTGGTGGCACATGG - Intronic
1103823487 12:123717167-123717189 TAGCCGGGGGTGGTGGCACTTGG + Intronic
1104733396 12:131121524-131121546 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1104861095 12:131924121-131924143 TAGTTGGGCGTGGTGGCACTTGG - Intergenic
1105371186 13:19803620-19803642 TAGCCGGGCGTGGTGGCACACGG - Intergenic
1105761168 13:23515693-23515715 CAGCAGGGCGAGATTTCACAGGG + Intergenic
1106056440 13:26241806-26241828 TAGCTGGGCTTGGTGGCACATGG + Intergenic
1106527214 13:30551849-30551871 TAGCCAGGCATGGTGGCACATGG - Intronic
1107036084 13:35904335-35904357 TAGCCGGGCATGGTGGCACCCGG - Intronic
1107937925 13:45360923-45360945 TAGCCGGGCGTGGTGGCGCATGG - Intergenic
1108879499 13:55092072-55092094 TAGCTGGGCGTAATGGCACATGG + Intergenic
1108920762 13:55671735-55671757 TAACAGGGGAGGGTGTCACAAGG + Intergenic
1109240572 13:59882232-59882254 TAGCCGGGCGTGGTGGCTCATGG - Intronic
1109666311 13:65543127-65543149 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1109949801 13:69485697-69485719 TAGCCTGGTGTGGTGGCACATGG + Intergenic
1110100771 13:71598398-71598420 TAGCCGGGCGTGGTGGCGCATGG - Intronic
1110107798 13:71700408-71700430 TAGCCGGGGGTGGTGACGCACGG + Intronic
1110222984 13:73092361-73092383 TAGCTGGGCATGGTGGCACATGG - Intergenic
1110605498 13:77427414-77427436 TAGCTGGGCATGGTGGCACATGG - Intergenic
1111471604 13:88690733-88690755 TAGCTGGGCATGGTGACACATGG - Intergenic
1111598579 13:90442726-90442748 CAGCTGGGCATGGTGGCACATGG + Intergenic
1112026383 13:95414962-95414984 TAGCCAGGCGTGATGGCACATGG - Intergenic
1112384429 13:98925016-98925038 TAGCCGGGCGTGGTGGCAAGTGG + Intronic
1112716186 13:102188793-102188815 TACCTGGGCATGGTGGCACATGG + Intronic
1112779889 13:102888521-102888543 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1112853538 13:103735897-103735919 GAGCAGGGGGAGGTGGCACAGGG + Intergenic
1113186785 13:107696040-107696062 TAGCTGGGCGTGGTGGTGCATGG - Intronic
1113285891 13:108848652-108848674 TAGCAGGGTTTGGTGGCGCAGGG + Intronic
1113366024 13:109676610-109676632 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1114274414 14:21129780-21129802 TAGCTGGGCATAGTGGCACACGG + Intergenic
1114457861 14:22868395-22868417 CAGGAGGGCGTGGTGGCACATGG + Intergenic
1114545454 14:23497116-23497138 TAGCCGGGCATGGTGGCGCATGG + Intronic
1114637741 14:24197612-24197634 TAGCCGGGCATGGTGGCTCATGG + Intronic
1115408543 14:33046828-33046850 TAGCCAGGCATGGTGGCACATGG + Intronic
1115615094 14:35086941-35086963 TAGCCGGGTGTGGTGGTACACGG - Intronic
1115616317 14:35098323-35098345 TAGCCAGGCGTAGTGACACACGG - Intronic
1115982915 14:39073436-39073458 TAGCTGGGCGTGGTGGCACGTGG - Intronic
1116927300 14:50652883-50652905 TAGCCAGGCGTGGTGGCACGTGG + Intronic
1116931003 14:50690918-50690940 TAGCTGGGTGTGGTGGCACGTGG - Intergenic
1117101524 14:52353449-52353471 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1117247245 14:53898380-53898402 TAGCCGGGGGTGGTGGCACACGG + Intergenic
1117386239 14:55215756-55215778 TAGCAGGGTGTGGTGGCGCATGG + Intergenic
1117570600 14:57045200-57045222 TAGCAGGGGGTGGGGTCATGAGG - Intergenic
1118240598 14:64053821-64053843 TAGCTGGGTATGGTGGCACATGG + Intronic
1118498224 14:66330042-66330064 TAGCTGGGTATGGTGGCACATGG + Intergenic
1118562596 14:67102512-67102534 GAGCCAGGCGTGGTGGCACATGG + Intronic
1118605809 14:67502596-67502618 TAGCCAGGCGTGGTGGCACATGG - Intronic
1118629945 14:67693794-67693816 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1118806779 14:69244818-69244840 TAGCCAGGCATGGTGCCACAAGG - Intergenic
1119546519 14:75476036-75476058 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1119843013 14:77807485-77807507 TAGCTGGGCGTGGTGGCGCACGG - Intronic
1119935731 14:78590767-78590789 TAGCTGGGTGTGGTGGCACGTGG + Intronic
1120524363 14:85560427-85560449 TATCAGGGCATGGTGGCACGTGG + Intronic
1121366517 14:93317149-93317171 TAGTTGGGTGTGGTGGCACATGG - Intronic
1121393497 14:93596899-93596921 TAGTAGGTCGTGGTGTGAAATGG - Intronic
1122504123 14:102220914-102220936 TAGCCGGGTGTGGTGGCGCACGG - Intronic
1122520003 14:102336877-102336899 TAGCTGGGCATGGTGACACACGG - Intronic
1122579980 14:102765469-102765491 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1122734798 14:103831788-103831810 TAGCCAGGCATGGTGACACATGG + Intronic
1122927621 14:104914062-104914084 TAGCCGGGCATGGTGGCGCAGGG + Intergenic
1123483505 15:20659474-20659496 TAGTCGGGTGTGGTGGCACATGG + Intergenic
1123588340 15:21778419-21778441 TAGCCAGGCGTGGTGGCCCATGG - Intergenic
1123624979 15:22220982-22221004 TAGCCAGGCGTGGTGGCCCATGG - Intergenic
1123766221 15:23481109-23481131 TACCCTGGCGTGGTGGCACATGG - Intergenic
1123907046 15:24931690-24931712 TAGCAGGGAATGGTGGCACATGG + Intronic
1124056367 15:26244091-26244113 TAGCTGGGCGTGGTGGCATGTGG - Intergenic
1124382749 15:29180516-29180538 TAGCTGGGTGTGGTGGCACACGG + Intronic
1124589879 15:31043470-31043492 TGGCCGGGCGTGGTGGCTCATGG - Intronic
1125632481 15:41158593-41158615 TAGCCAGGCATGGTGGCACAAGG + Intergenic
1125918272 15:43508869-43508891 TAGCAGGGCCTGAGATCACAAGG + Intronic
1125974171 15:43936469-43936491 TGGCCGGGCGTGGTGGCTCATGG - Intronic
1126117069 15:45217682-45217704 TAGCTGGGCGTGGTGACACGTGG + Intergenic
1126583005 15:50258342-50258364 TAGCAGGGAGTGGTATCCTAGGG - Intronic
1126587205 15:50300587-50300609 TAGCCAGGCGTGGTGGCACATGG - Intronic
1126597888 15:50399936-50399958 TAGCTGGGTGTGGTGGCACGCGG - Intergenic
1126867212 15:52949522-52949544 TACCCAGGCGTGGTGGCACATGG + Intergenic
1126872183 15:53001802-53001824 TAGCCAGGCATGGTGGCACATGG - Intergenic
1127432286 15:58922229-58922251 TAGCCGGGTGTGGTGACTCATGG + Intronic
1127578064 15:60311937-60311959 TAGCTGGGCGTGGTGGCACATGG + Intergenic
1128163537 15:65440913-65440935 TAGCAGGGCATGGTGGCACATGG - Intergenic
1128981232 15:72188056-72188078 TGGCTGGGCGTGGTGGCTCATGG + Intronic
1129600177 15:76994222-76994244 CGGCAGGGCGTGGCGTCTCAGGG + Intronic
1129926490 15:79368947-79368969 TAGCTGGGCATGGTGGCACACGG + Intronic
1130585820 15:85181118-85181140 TAGCTGGGCGTGGTGGATCATGG - Intergenic
1130645247 15:85719787-85719809 TAGCCAGGCGTGGTGGCATATGG + Intronic
1131141416 15:89979581-89979603 TAGCTGGGCGTGGTGGCCCATGG + Intergenic
1131327674 15:91463948-91463970 TAGCCGGGCGTGGTGGCAGGGGG + Intergenic
1131377156 15:91935097-91935119 TAGCCAGGCGTGGTGGCACACGG - Intronic
1131482167 15:92791435-92791457 TAGCCGGGCGTGGTGGCGCATGG + Intronic
1132087839 15:98922619-98922641 AAGCTGGGAGTGGTGTCACTAGG - Intronic
1132089350 15:98935322-98935344 TTGCTGGGTGTGGTGTCCCAAGG + Exonic
1132273427 15:100545610-100545632 TAGCTGGGCGTGGTGCCGCGTGG - Intergenic
1132330818 15:101011328-101011350 AAGCTGGGCGTGGTGGCACGTGG + Intronic
1132345570 15:101106536-101106558 TAGCCGGGCGTGGTGCTACTCGG + Intergenic
1132393473 15:101455611-101455633 CAGCAGGGCAAGCTGTCACAAGG - Intronic
1132504200 16:298651-298673 TAGCTGGGCGTGGTGGCACACGG - Intronic
1132822792 16:1884851-1884873 TAGCCGGGCGTGGTAGCACATGG - Intergenic
1132898523 16:2240355-2240377 TAGCCGGGTGTGGTGGCACACGG - Intronic
1133218142 16:4305987-4306009 TAGCGGGGCGTGATGGCACATGG - Intergenic
1133325474 16:4939638-4939660 TAGCAGGGCGTGGTGGCAGCAGG - Intronic
1133780322 16:8933899-8933921 TAGCTGGGCGTGGTGGCACACGG - Intronic
1133783973 16:8961344-8961366 TAGCCAGGCGTGGTTGCACATGG + Intronic
1133833278 16:9343609-9343631 TGGCAGGCCCTGGTGTGACAGGG - Intergenic
1134046406 16:11104252-11104274 TAGCTGGGTATGGTGGCACATGG - Intronic
1134363966 16:13559521-13559543 TAGCCAGACATGGTGTCACATGG - Intergenic
1134621622 16:15693792-15693814 TAGCCGGGTGTGGTGGCACATGG + Intronic
1134728730 16:16442401-16442423 TAGCTGGGTGTGGTGGTACATGG - Intergenic
1134792123 16:16998529-16998551 TAGTCAGGCGTGGTGGCACATGG - Intergenic
1134938713 16:18269523-18269545 TAGCTGGGTGTGGTGGTACATGG + Intergenic
1135133007 16:19868226-19868248 TAGCCAGGTGTGGTGGCACACGG + Intronic
1135267643 16:21041223-21041245 TAGCTGGGCATGGTGGCGCATGG + Intronic
1136180113 16:28545850-28545872 TAGCCGGGCTTGGTGGCACATGG + Intergenic
1136404902 16:30039267-30039289 TAGCCAGGCGTGGTGGCGCATGG - Intronic
1136408106 16:30060944-30060966 TTTCAGGGTGTGGTGTCAGATGG - Intronic
1136422099 16:30141219-30141241 TAGCCGGGCGTGATGGCACAAGG + Intergenic
1136550870 16:30981803-30981825 TAGCCGGGCGTGGGGGTACATGG + Intronic
1136558393 16:31023166-31023188 TAGCCAGGCGTGGTGGCTCATGG + Intergenic
1136601178 16:31289933-31289955 TAGCCAGGTGTGGTGGCACATGG + Intronic
1136751059 16:32636193-32636215 TAGCTGGGCATGGTGGCGCATGG + Intergenic
1137266038 16:46869840-46869862 TAGCTGGGTGTGGTGGTACATGG + Intergenic
1137344852 16:47647267-47647289 TAGCCGGGCGTGGTGACACATGG - Intronic
1137501855 16:49018033-49018055 TAGCTGGGCTTGGTGGCACATGG - Intergenic
1138020135 16:53471612-53471634 TAGCCAGGCATGGTGGCACATGG - Intronic
1138020540 16:53475975-53475997 TAGCAGGGCATGGTGGTGCACGG - Intronic
1138675238 16:58646539-58646561 TAGCTGGGCGTGGTGGCGCGTGG - Intergenic
1138682867 16:58698922-58698944 TAGTTGGGTGTGGTGGCACACGG - Intergenic
1139565944 16:67776314-67776336 TAGCCGGGTGTGGTGGAACATGG + Intronic
1139659717 16:68412264-68412286 TGGCAGTGCGTGTTGGCACAGGG - Intronic
1139684357 16:68591084-68591106 TAGCTGGGCGTGGTGGCAGGTGG + Intergenic
1139748960 16:69097010-69097032 TAGCCGGGCATGGTGGCACGTGG + Intergenic
1139760059 16:69177726-69177748 TAGCTGGGCATGGTGTTGCATGG - Intronic
1139780268 16:69345535-69345557 TAGGTGGGCGTGGTGGCACGTGG + Intronic
1139851558 16:69953667-69953689 TAGCCAGGCGTGGTGTCACATGG + Intronic
1139880535 16:70176581-70176603 TAGCCAGGTGTGGTGTCACATGG + Intronic
1139918602 16:70444053-70444075 TAGCCGGGCATAGTGTCACATGG + Intergenic
1140371974 16:74418937-74418959 TAGCCAGGTGTGGTGTCACATGG - Intronic
1140419032 16:74801790-74801812 TAGCTGGGCGTGGTGGCATATGG + Intergenic
1140516155 16:75543422-75543444 TAGCCAGGCGTGGTGGCATATGG + Intronic
1140706246 16:77633045-77633067 TAGCTGGGCATGGTGGCTCAGGG - Intergenic
1141086453 16:81098981-81099003 TAGACGGGCGTGGTGGCACGTGG - Intergenic
1141113899 16:81292075-81292097 TAGCTGGGTGTGGTGGCGCATGG - Intergenic
1141546637 16:84774614-84774636 TACCCGGGCGTGGTGGCACGCGG - Intronic
1141729623 16:85812962-85812984 TAGCTGGGTCTGGTGGCACATGG - Intergenic
1141999394 16:87655497-87655519 TAGCTGGGCGTGGTGGTGCACGG - Intronic
1142049293 16:87947532-87947554 TAGCCGGGTGTGGTGGCGCATGG - Intergenic
1142400699 16:89856918-89856940 TAGCCAGGTGTGGTGGCACATGG + Intronic
1203053193 16_KI270728v1_random:895449-895471 TAGCTGGGCATGGTGGCGCATGG + Intergenic
1142631916 17:1230653-1230675 TAGCCGGGCGTGGTGGCACATGG + Intergenic
1142657683 17:1404732-1404754 TAGCTGGGCATGGTGGCACGCGG + Intergenic
1142944082 17:3410250-3410272 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1143143997 17:4761603-4761625 TAGCCAGGCGTGGTGACACATGG + Intergenic
1143195553 17:5073701-5073723 TAGCCGGGCGTGGTGGCACGTGG + Intergenic
1143477278 17:7209894-7209916 TAGCTGGGCGTGGTGGCACATGG + Intronic
1143547716 17:7608469-7608491 TAGCCAGGCGTGGTGGCACATGG + Intronic
1143547854 17:7610078-7610100 TAGCCAGGCGTGGTGGCACATGG + Intronic
1143655658 17:8292034-8292056 TAGCTGGACGTGGTGGCGCATGG + Intronic
1143901793 17:10180058-10180080 TGGCTGGGCGTGGTGGCTCATGG + Intronic
1143991973 17:10973436-10973458 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1144113582 17:12063824-12063846 TAGCTGGACATGGTGTCGCATGG + Intronic
1144272308 17:13629981-13630003 TAGCCGGGCGTGGTGGCACTCGG + Intergenic
1144346044 17:14350879-14350901 TAGCCAGGCATGGTGGCACATGG - Intergenic
1144423090 17:15115681-15115703 TAGCTGGGCATGGTGGTACATGG - Intergenic
1144492020 17:15721249-15721271 TAGCCAGGCATGGTGACACATGG + Intergenic
1144496277 17:15747628-15747650 TAGCCAGGCGTGGTGGTACATGG + Intronic
1144750573 17:17645552-17645574 TAGCCAGGCCTGGTGGCACATGG - Intergenic
1144861693 17:18307762-18307784 TAGCTGGGTGTAGTGGCACATGG + Intronic
1144870906 17:18370174-18370196 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1145066913 17:19767577-19767599 TAGCTGGGCGTGATGGCACAAGG + Intergenic
1145376084 17:22350248-22350270 TAGCCAGGCATGGTGGCACATGG - Intergenic
1145788052 17:27606975-27606997 TAGCGAGGCGTGGTGGCACACGG - Intronic
1145875854 17:28318003-28318025 TAGCAGGGGGCTATGTCACAGGG - Intergenic
1146021741 17:29285152-29285174 TAGCTGGGCGTGGTGGCGCATGG + Intronic
1146089946 17:29866977-29866999 TAGCTGGGCGTGGTGGCACATGG - Intronic
1146190130 17:30757901-30757923 TAGCTGGGTATGGTGGCACATGG - Intergenic
1146218267 17:30996233-30996255 TAGCTGCGTGTGGTGACACATGG - Intronic
1146228910 17:31091728-31091750 AAGCCGGGCATGGTGGCACATGG - Intergenic
1146257132 17:31398182-31398204 TAGCTGGGCGTGGTGGCACATGG - Intronic
1146294826 17:31641295-31641317 TAGCAGGGCGTGGTGGCACATGG - Intergenic
1146335305 17:31964550-31964572 TAGCTGGGTATGGTGGCACATGG - Intronic
1146877010 17:36422031-36422053 TAGCTGGGTGTGGTGGCACATGG - Intronic
1147062374 17:37890824-37890846 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1147287278 17:39412372-39412394 TAGCTGGGCGTGATGGCGCATGG - Intronic
1147411065 17:40252909-40252931 TAGCCAGGCATGGTGGCACATGG - Intronic
1147518194 17:41142222-41142244 TAGACGGGCGTGGTGACACATGG - Intergenic
1147666576 17:42152631-42152653 TAGCTGGGCGTGGTGGTGCATGG + Intronic
1147794397 17:43032387-43032409 TAGCTGGGCATGGTGGCACATGG - Intergenic
1147878682 17:43639801-43639823 TAGCTGGGCGTGGTGGCACATGG + Intergenic
1147883449 17:43668845-43668867 CAGCTGGGCGTGGTGGCGCATGG + Intergenic
1147984841 17:44299835-44299857 TAGCCGAGCGTGGTGGCACATGG + Intergenic
1148133319 17:45275320-45275342 TAGCTGGGTGTGGTGGCACGTGG + Intronic
1148155427 17:45422266-45422288 TAGCTGGGCATGGTGGCACGTGG + Intronic
1148879445 17:50714489-50714511 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
1149078352 17:52624181-52624203 TAGCTGGGCGTGGTGGCATGTGG - Intergenic
1149630561 17:58118666-58118688 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
1149906541 17:60531778-60531800 TAGCTGGGCTTGGTGGCGCATGG - Intergenic
1149959127 17:61088034-61088056 TAGCTGGGCATGGTTTCACATGG + Intronic
1150309623 17:64117295-64117317 TAGCTGGGCGTATTGGCACATGG + Intronic
1150449550 17:65255188-65255210 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1150549196 17:66193013-66193035 TAGCCAGGCGTGGTGGCACACGG + Intergenic
1150570195 17:66378753-66378775 TAGCCTGGCGTGGTGGCACATGG + Intronic
1150581546 17:66478398-66478420 TAGCCAGGTGTGGTGGCACATGG - Intronic
1150648986 17:66997669-66997691 TAGCTGGGCGTGGTAGCACACGG + Intronic
1150721018 17:67614524-67614546 TAGCCAGGTGTGGTGGCACATGG + Intronic
1150909153 17:69370178-69370200 TAGCTGGACGTGGTGGCGCATGG + Intergenic
1150909615 17:69374485-69374507 TAGCCGGGCATGGTGGCACATGG - Intergenic
1150910531 17:69382656-69382678 TAGCCGGGCATGGTGGCACATGG - Intergenic
1151356791 17:73563430-73563452 TAGCTGGGTGCGGTGGCACACGG + Intronic
1151402171 17:73862897-73862919 TAGCAGGGCCTGCTTTCACCAGG + Intergenic
1151541210 17:74765403-74765425 TTGCTGGGCGTGGTGGCGCATGG - Intronic
1151669183 17:75562712-75562734 TAGCTGGGCGTGGTGGCACATGG - Intronic
1151812784 17:76454337-76454359 TAGCTGGGCGTGGTGGCACATGG + Intronic
1152109419 17:78349387-78349409 TAGCCGGGCCTGGTGGCACATGG + Intergenic
1152175583 17:78785001-78785023 TAGCTGGGCTTGGTGGCACATGG - Intergenic
1152448080 17:80357838-80357860 TAGCTGGGCATGGTGGCACTGGG + Intronic
1152497657 17:80685419-80685441 TAGCTGGGCATGGTGGTACACGG - Intronic
1152853833 17:82652483-82652505 TAGCCGGGCGTGGTGGCAGACGG + Intergenic
1153274187 18:3352009-3352031 TAGCTGAGCATGGTGGCACATGG + Intergenic
1153446741 18:5181144-5181166 TAGCCAGGCATGGTGGCACATGG + Intronic
1153660341 18:7320310-7320332 TAGCTGGGTGTGGTGGCAGACGG - Intergenic
1154140806 18:11822456-11822478 TAGCCAGGCGTGGTGGCACGCGG + Intronic
1154533353 18:15371187-15371209 TAGCGGGGCATGGTGGCAGATGG - Intergenic
1155154983 18:23150494-23150516 TGGCTGGGCGTGGTGGCTCACGG - Intronic
1155188026 18:23404525-23404547 TAGCTGGGCATGGTGGCCCATGG + Intronic
1155587717 18:27386981-27387003 TAGCTGGGCATGGTGGCACGCGG - Intergenic
1155640724 18:28010793-28010815 TAGCTGGGCGTGGTGCTACTCGG - Intronic
1155722454 18:29033768-29033790 TAGCCAGGCATGGTGGCACACGG - Intergenic
1155961065 18:31995321-31995343 TAGCTGGGCGTGGTGGTGCATGG + Intergenic
1155995322 18:32325102-32325124 TAGCTGGGCATGGTGGCGCATGG - Intronic
1156183864 18:34638985-34639007 TAGCCGGACATGGTGGCACATGG - Intronic
1156908929 18:42387816-42387838 TAGCCAGGCGTGGTGGCTCACGG - Intergenic
1157815473 18:50726752-50726774 TAGCCAGGCATGGTGGCACACGG + Intronic
1158180435 18:54709495-54709517 TAGCCAGGCATGGTGGCACATGG - Intergenic
1158515623 18:58127985-58128007 TAGCCGGGCATGGTGGCACTGGG - Intronic
1158700209 18:59738480-59738502 TAGCTGGGTATGGTGGCACATGG - Intergenic
1158995444 18:62913887-62913909 TAGCCGGGTGTGGTGGCACATGG - Intronic
1159119839 18:64155762-64155784 TAGCCGGGCATGGTGGCGCATGG - Intergenic
1159206808 18:65264256-65264278 TACCATGGCGTGATGACACACGG + Intergenic
1159380116 18:67645433-67645455 TAGCCAGGCTTGGTGGCACATGG + Intergenic
1159598461 18:70405923-70405945 TAGCTGGGCGTGGTGGCACGCGG - Intergenic
1159777071 18:72615420-72615442 TAGCTGGGCATGGTGGCGCATGG - Intronic
1160804356 19:985448-985470 CAGCCGGGCGTGGTGGCTCACGG - Intronic
1161094556 19:2382276-2382298 TAGCCGGGCATGGTGGCACATGG - Intergenic
1161107304 19:2450775-2450797 TAGCTGGGCGTGGTGGTGCACGG - Intronic
1161418940 19:4164852-4164874 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1161490877 19:4560582-4560604 TAGCTGGGCGTGGTGGCACGTGG - Intergenic
1161491215 19:4562819-4562841 TAGCTGGGCGTGGTGGCACGTGG - Intergenic
1161500029 19:4609085-4609107 TAGCCAGGCATGGTGACACACGG - Intergenic
1161591843 19:5132559-5132581 TAGAAGCGCGTGGGATCACAGGG + Intronic
1161927942 19:7315287-7315309 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1162261717 19:9539570-9539592 TGGCAGGGCCGGGGGTCACAAGG - Intergenic
1162526207 19:11208424-11208446 TAGCCGGGCGTGGTGGCGCACGG - Intronic
1162606813 19:11715393-11715415 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1162664747 19:12200998-12201020 TAGCTGGGTGTGGTGGCACACGG - Intergenic
1163113577 19:15176312-15176334 TAGCCGGGTGTGGTGGCACATGG - Intronic
1163265756 19:16220355-16220377 AAGCCGGGCATGGTGGCACACGG - Intronic
1163275715 19:16282916-16282938 TAGTTGGGCATGGTGGCACATGG + Intergenic
1163515222 19:17758826-17758848 TAGCCAGGCCTGGTGTCACATGG + Intronic
1163523229 19:17804688-17804710 TAGCAGGGCGTGGTGGCTCATGG - Intronic
1163686135 19:18712812-18712834 TAGCTGGGCATGGTGGCATACGG + Intronic
1163833044 19:19556600-19556622 TAGCCAGGAGTGGTGGCACATGG + Intergenic
1163838976 19:19594123-19594145 TCGCCGGGCATGGTGGCACATGG + Intronic
1164004342 19:21134967-21134989 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
1164170422 19:22720090-22720112 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1164278947 19:23751328-23751350 TAGCTGGGCGTTTTGGCACATGG + Intronic
1164590841 19:29506001-29506023 TAGCAGGACATGGTGGAACAAGG + Intergenic
1164815010 19:31191711-31191733 TAGCCGGGCATGGTGGCACGTGG + Intergenic
1164995204 19:32716139-32716161 TAGCTGGGTGTGGTGACACATGG + Intergenic
1165026010 19:32961922-32961944 CAGCTGGGCGTGGTGGCTCATGG - Intronic
1165048222 19:33123252-33123274 TAGCCAGGCATGGTGGCACATGG + Intronic
1165151702 19:33764352-33764374 CAGCTGGGCGTGGTGGCTCATGG + Intronic
1165212318 19:34245725-34245747 TAGCCAGGCATGGTGGCACACGG - Intergenic
1165234574 19:34410395-34410417 TAGCTGGGCATGGTGGCACATGG - Intronic
1165453739 19:35899417-35899439 TAGCCGGGCGTGGTGGCAGGCGG + Intronic
1165500821 19:36187781-36187803 CAGCCAGGCGTGGTGGCACACGG - Intronic
1165872557 19:38983289-38983311 TAGCTGGGTGTGGTGGTACATGG - Intergenic
1165899251 19:39161168-39161190 CAGCAGGGCGTGGACTCACAAGG - Intronic
1166011426 19:39945621-39945643 TAGCTGGGCATGGTGGCACAGGG - Intergenic
1166059047 19:40313468-40313490 TAGCTCGGCGTGGTGGCGCATGG - Intergenic
1166079934 19:40437560-40437582 TAGCCAGGCGTAGTGGCACATGG - Intergenic
1166137137 19:40784345-40784367 TAGCTGGGTGTGGTGGCTCATGG + Intronic
1166191031 19:41176791-41176813 TAGCTGGGCGTGGTGGCAGGCGG - Intergenic
1166341397 19:42139583-42139605 TAGCTGGGCATGGTGGCGCATGG - Intronic
1166408529 19:42540866-42540888 TAGCCGGGCATGGTGGCACGTGG - Intronic
1166600774 19:44092861-44092883 TAGCTGGGTGTGGTGGCGCATGG + Intergenic
1166669176 19:44699675-44699697 TGGCCGGGCGTGGTGGCTCATGG - Intronic
1166723782 19:45012901-45012923 TAGCCAGGTGTGGTGGCACATGG + Intronic
1166806769 19:45492390-45492412 TAGCAGGGCGTGGTGGCCTGTGG + Intronic
1166866982 19:45844771-45844793 TTGAGGGGAGTGGTGTCACAAGG - Intronic
1167007580 19:46785932-46785954 TATCCAGGCGTGGTGGCACACGG + Intronic
1167068663 19:47206282-47206304 GAGCAGGGCATGGGGTGACATGG - Intronic
1167076200 19:47250989-47251011 TAGCCGGGCGTGGTGGCACTGGG - Intergenic
1167076266 19:47251400-47251422 TAGCCAGGCATGGTGGCACATGG - Intergenic
1167176299 19:47866772-47866794 TAGCCTGGCTTGGTGGCACATGG - Intergenic
1167453512 19:49585932-49585954 TAGCTGGGCATGGTGGCACGTGG + Intronic
1167606942 19:50486333-50486355 TGGCTGGGTGTGGTGGCACACGG - Exonic
1167656316 19:50766745-50766767 TAGCTGGGTGTGGTGGCACGTGG - Intergenic
1167671040 19:50853811-50853833 TAGCCGGGCGTGGTGGCACACGG + Intergenic
1167677554 19:50896771-50896793 TAGCCAAGCGTGATGTCACATGG - Intergenic
1167700809 19:51044266-51044288 TAGCTGGGCGTGGTGGCAGGGGG - Intergenic
1167884292 19:52487773-52487795 TAGCCGGGCTTGGTGGCTCATGG - Intronic
1167947495 19:53000647-53000669 TAGCCGGGTGTGGTGGCACATGG + Intergenic
1167953113 19:53043737-53043759 TAGCTGGGCGTGGTGGCATGTGG + Intergenic
1167993206 19:53378309-53378331 TAGCTGGGCGTGGTGGCACATGG + Intronic
1167996300 19:53405204-53405226 TAGCTGAGCGTGGTGGCGCAAGG + Intronic
1168032591 19:53692682-53692704 TAGCCGGGCGTGGTGGTGCACGG - Intergenic
1168112912 19:54204544-54204566 TAGCCGGGCATGGTGGTACATGG - Intronic
1168200302 19:54810262-54810284 TAGCCAGGCGTGGTGGGACATGG - Intronic
1168215561 19:54922631-54922653 TAGCCAGGCATGGTGGCACAGGG + Intergenic
1168225044 19:54988663-54988685 TAGCTGGGCGTGGTGGCACATGG - Intronic
1168534331 19:57156545-57156567 TAGCTGGGTGTGCTGGCACATGG - Intronic
1168629307 19:57944676-57944698 CAGCCAGGCGTGGTGGCACACGG + Intronic
925050482 2:810973-810995 TAGCTGGGCATGGTGGCACATGG - Intergenic
925168428 2:1734719-1734741 TAGCTGGGCATGGTGGCGCATGG + Intronic
925996810 2:9300085-9300107 TAGCCAGGCGTGGTGGCTCACGG + Intronic
926110388 2:10179295-10179317 TAGCCGGGCGTGGTGGCATGTGG - Intronic
927670020 2:25061257-25061279 TAGCTGGACGTGGTGGCACACGG - Intronic
927724509 2:25411076-25411098 TAGCTGGGCGCGGTGGCTCATGG + Intronic
927773214 2:25881682-25881704 TAGCCGGGCGTGGTGGCTCAAGG + Intergenic
928150362 2:28822751-28822773 TAGCTGAGCGTGGTGGCACGTGG - Intronic
928221184 2:29404156-29404178 TAGCCAGGCATGGTGGCACATGG + Intronic
928330057 2:30350803-30350825 TAGCTGGGCGTGGTAGCACATGG - Intergenic
928444986 2:31325901-31325923 TAGCCAGGCTTGGTGGCACATGG + Intergenic
928448912 2:31360350-31360372 TAGCTGGGCGTGGTGGGGCAGGG + Intronic
928532362 2:32205811-32205833 TAGCCAGGCGTGGTGGCACATGG - Intronic
929106858 2:38374035-38374057 TAGCTGGGTGTGGTGGCGCATGG - Intronic
929210831 2:39355213-39355235 TAGCTGGGCGTGGTGCCACGTGG + Intronic
929530198 2:42745957-42745979 TAGCTGGGCGTGGTGGCGCATGG - Intronic
929857132 2:45646896-45646918 TAGCTGGGCATGGTGGCACATGG + Intergenic
930474512 2:51864145-51864167 TAGCTGGGTGTGGTGGCACATGG + Intergenic
930625283 2:53690088-53690110 TAGCTGGGCATGGTGCCACATGG + Intronic
930712650 2:54563747-54563769 TAGCCGGGCGTGGTGGCAGGTGG - Intronic
931025856 2:58113161-58113183 TAGCTGGGCGTGGTGGCACACGG + Intronic
931366493 2:61623585-61623607 TAGCTGGGCGTGGTGGCAGCAGG + Intergenic
932092121 2:68815594-68815616 TAGCCGGGCGTGGTGGCGGACGG - Intronic
932148220 2:69343555-69343577 TAGCTGGGCGTGGTGGCTCGCGG - Intronic
932719570 2:74129161-74129183 TAGCTGGGCATGGTGGCTCATGG + Intergenic
933282214 2:80344628-80344650 TAGCTGGGCGTGGTGGCGCAGGG - Intronic
933959969 2:87401834-87401856 TAGCTGGGCATGGTGGCACACGG + Intergenic
934541502 2:95179135-95179157 TAGCAGGGCATGGTGGCCCATGG - Intronic
934594438 2:95592512-95592534 TAGCTGGGCGTGGTGGCAGGCGG - Intronic
934662942 2:96152859-96152881 TGGCAGGGCCTGGGGTGACAGGG - Intergenic
935028454 2:99299568-99299590 TAGCTGGGCGTGGTGGCACAGGG - Intronic
935107102 2:100054828-100054850 GAGCAGGGTGAGGTGCCACAGGG - Intronic
935336785 2:102023765-102023787 TGGCTGGGCGTGGTGGCTCATGG + Intronic
935518414 2:104074196-104074218 TAGCAGGGCGTGGTGGTAGTGGG + Intergenic
935528689 2:104205519-104205541 TAGCCAGGTGTGGTGGCACATGG - Intergenic
935732536 2:106076170-106076192 TAGCCAGGCGTGGTGGCAGATGG + Intronic
935964615 2:108461646-108461668 TAGCTGGGCATGGTGGCAGATGG - Intronic
936251054 2:110868732-110868754 TAGCTGGGCATGGTGGCACATGG - Intronic
936275561 2:111093716-111093738 TAGCTGGGCGTGGTGGCATGTGG + Intronic
937153863 2:119704450-119704472 TAGCTGGGCGTGGTAGCGCATGG + Intergenic
938058751 2:128236125-128236147 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
938858712 2:135343039-135343061 TAGCAGGGCATGGCAGCACACGG + Intronic
939604963 2:144242814-144242836 TAGCTGGGCTTGGTGGCATATGG + Intronic
940282442 2:152001565-152001587 TAGCCGGGCATGGTGGCACATGG + Intronic
940336316 2:152531619-152531641 TAGCTGGGCGTGGTGTCAGGCGG - Intronic
940720037 2:157272015-157272037 TAGGAGGGTGTAGTGTCTCATGG + Intronic
941097173 2:161252061-161252083 TAGCCGGGCGTGGTGGCACGCGG - Intergenic
941126696 2:161592558-161592580 TAGCTGGGCATGGTGGTACATGG - Intronic
941647526 2:168057336-168057358 TAGCTGAGTGTGGTGGCACATGG - Intronic
941776326 2:169397463-169397485 TAGCCGGGCATGGTGGCACGCGG - Intergenic
941954297 2:171188732-171188754 TAGTAGGACGTGGTGGCACGTGG + Intronic
941964064 2:171283387-171283409 TAGCAGGGCATGATGTCGCCTGG - Intergenic
942033285 2:171985760-171985782 TAGCTGGGCATGGTGGCTCAGGG - Intronic
942266059 2:174226643-174226665 TAGCCGGACGTGGTGGCCCATGG - Intronic
942349601 2:175038830-175038852 GGGCCGGGCGTGGTGTCTCATGG - Intergenic
942821994 2:180125301-180125323 TAGCTGGGCGTGGTGGTGCACGG + Intergenic
943570001 2:189563127-189563149 TAGCAAGGTATGGTGGCACATGG + Intronic
943629927 2:190239793-190239815 TAGCTGGGCGTGGTGGCACATGG - Intronic
944178446 2:196860386-196860408 TAGCTGGGCGTGGTGCCACACGG + Intronic
944238754 2:197465433-197465455 TAGCCGAGCGTGGTGGCACATGG - Intronic
944246067 2:197531688-197531710 TAGCCGGGCATGGTGGCACATGG - Intronic
944259812 2:197664637-197664659 TAGCTGGGTGTGGTGGTACATGG + Intronic
944588724 2:201197255-201197277 TGGCTGGGCGTGGTGGTACATGG - Intronic
944672097 2:202003547-202003569 TAGCTGGGCATGGTGCCACGTGG - Intergenic
944737189 2:202577705-202577727 TAGCTGGATGTGGTGGCACATGG - Intergenic
944744555 2:202642085-202642107 CAGCCGGGCATGGTGGCACACGG - Intronic
944841750 2:203630611-203630633 TAGCCGGGTGTGGTGGCTCATGG - Intergenic
945003581 2:205377914-205377936 AAGCTGGGCGTGGTGGCACGTGG - Intronic
945070171 2:205981440-205981462 TAGCCGGGTGTGGTGGCACTGGG + Intergenic
945084927 2:206121596-206121618 TAGCCAGGCATGGTGGCACATGG - Intronic
946243410 2:218370938-218370960 CAGCTGGGCATGGTGACACAAGG + Intergenic
946819213 2:223613166-223613188 CAGCAGGGCTTGGCGTCAGACGG + Intergenic
946828090 2:223699411-223699433 TAGCTGGGCATGGTGGCACATGG + Intergenic
946840287 2:223813072-223813094 AAGCTGGGCGTGGTGGCACACGG - Intronic
947506081 2:230709477-230709499 TAGCAGGGCGTGGTGTTGCATGG - Intergenic
947779900 2:232750037-232750059 TAGCCGAGCATGGTGACACACGG + Intronic
947962908 2:234254595-234254617 TAGCTGAGCATGGTGGCACATGG - Intergenic
948051241 2:234981003-234981025 TAGCCAGGCATGGTGGCACAAGG - Intronic
948497393 2:238360733-238360755 TAGCTGGGCATAGTGGCACAGGG + Intronic
1168787142 20:549498-549520 TAGCCGGGCATGGTGGCACATGG + Intergenic
1168826616 20:818631-818653 TAGCCGGGCATGGTGGCACATGG - Intergenic
1168993089 20:2111550-2111572 TAGCCGGGCGTGGTGGTGCATGG + Intronic
1169134210 20:3186980-3187002 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
1169220807 20:3821515-3821537 TAGCCGGGCATGGTGGCGCATGG - Intronic
1169743394 20:8919100-8919122 TAGCAAGGCGTGGTGGCATGTGG + Intronic
1170206681 20:13806360-13806382 TAGCTGGGCGTGGTGGCACATGG + Intronic
1170249028 20:14259086-14259108 TAGCTGGGCATGGTGGTACATGG - Intronic
1171139209 20:22726400-22726422 TAGTCGGCCGTGGTGGCACATGG - Intergenic
1171888666 20:30685335-30685357 TAGCCAGGCATGGTGGCACATGG + Intergenic
1172042751 20:32057452-32057474 TAGCTGGGTGTGGTGGCACATGG + Intronic
1172393494 20:34582532-34582554 TAGCCGGGTGTGGTGGCATATGG + Intronic
1172411591 20:34727867-34727889 TAGCAGGGCGTGGTGTCACATGG - Intronic
1172473772 20:35221769-35221791 TAGCTGGGAGTTGTGGCACATGG - Intergenic
1172601173 20:36184087-36184109 TAGCTGGGCGTGGTGGCATGTGG + Intronic
1172693975 20:36809066-36809088 TAGCAGGGAGGGGTGACGCATGG + Intronic
1172742204 20:37178158-37178180 TAGCTGGGCGTGGTGTCGCAAGG + Intronic
1172752735 20:37262224-37262246 TAGCTGGGCATGTTGGCACATGG + Intergenic
1172850647 20:37960634-37960656 TAGCTGGGCATGGTGGCACATGG - Intergenic
1173109098 20:40168754-40168776 TAGCTGGGCATGGTGGCACGTGG - Intergenic
1173220364 20:41127545-41127567 TAGCTGGGCGTGGTGGCAGGAGG - Intergenic
1173486049 20:43441953-43441975 TAGTTGGGCGTGGTGGCTCAGGG - Intergenic
1173541404 20:43854428-43854450 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1173609174 20:44354293-44354315 TAGCCGGGCATGGTGGCAAACGG - Intergenic
1173782477 20:45768022-45768044 TAGCTGGGCGTGGTGGCTAATGG + Intronic
1173804264 20:45913586-45913608 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1173930531 20:46814275-46814297 TAGCCGGGCGTGGTGGCAAGTGG + Intergenic
1174210535 20:48874729-48874751 TAGCTGGGCATGGTGACACACGG + Intergenic
1174232799 20:49060334-49060356 TAGCTGGGCGTGGTGGTGCACGG + Intronic
1174263451 20:49314181-49314203 TAGCTGGATGTGGTGGCACATGG + Intergenic
1174319334 20:49728437-49728459 TAGCTGGGTGTGATGGCACATGG - Intergenic
1174520351 20:51124985-51125007 TGGCTGGGCGTTGTGGCACATGG + Intergenic
1174759335 20:53191515-53191537 TAGCTGGGTGTGGTGGCACGTGG + Intronic
1175136900 20:56830976-56830998 TAGCTGGGCGTGGTGGAGCACGG + Intergenic
1175294830 20:57901126-57901148 TAGCCGGGCATGGTGACACATGG - Intergenic
1175563551 20:59954152-59954174 TAGCCAGGTGTGGTGACACATGG - Intergenic
1175850942 20:62092523-62092545 TAGCTGGGCGTGGTGGCTCACGG + Intergenic
1176093670 20:63329860-63329882 TCACAGGGTGTGGGGTCACAGGG + Intronic
1176804650 21:13468197-13468219 TAGCTGGGCATGGTGGTACAGGG + Intergenic
1176865793 21:14054529-14054551 TAGCAGGACGTGGTGGCACATGG - Intergenic
1176957742 21:15125930-15125952 TAACAGGGCGTGGTATCTCATGG + Intergenic
1177003745 21:15645501-15645523 TAGCTGGGCGTGGTGGCACACGG - Intergenic
1177145685 21:17404550-17404572 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1177429750 21:20976411-20976433 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1177451521 21:21274017-21274039 TAGCCGGGCGTGGTGGCGCATGG + Intronic
1177678745 21:24336933-24336955 TAGCCGGGAGTGTTGGCACATGG - Intergenic
1177689259 21:24482748-24482770 TAGCTGGGCGTGGTGACGCATGG - Intergenic
1177941155 21:27413013-27413035 TAGCTGGGAGTGGTGGCGCATGG - Intergenic
1177994083 21:28073987-28074009 TAGCTGGGCTTGGTGGTACATGG - Intergenic
1178145424 21:29734543-29734565 TAGCCAGGCATGGTGTCACGTGG - Intronic
1178749304 21:35285352-35285374 TAGCCGGGCGTGGTGGCAGGCGG + Intronic
1178848371 21:36192523-36192545 TAGCTGGGTGTGGTGGCACATGG - Intronic
1178917643 21:36717591-36717613 TAGCCGGGCGTGGTGGCATGCGG - Intronic
1179217226 21:39378097-39378119 TAGTCGGGCGTGGTGGCGCATGG - Intergenic
1180201135 21:46224968-46224990 TAGCCAGGCATGGTGGCACATGG + Intronic
1180208190 21:46276104-46276126 TAGCCGGGCGTGGTGGCGCATGG + Intronic
1180558247 22:16594654-16594676 TAGCCGGGCATGGTGGCACATGG - Intergenic
1180631114 22:17230743-17230765 TAGCCAGGCGTGGTGGCGCATGG - Intergenic
1180787580 22:18555491-18555513 TAGCCGGGCGTGGTGGCAGGCGG - Intergenic
1180895404 22:19328288-19328310 TAGCCAGGCATGGTGGCACATGG - Intergenic
1180944438 22:19682894-19682916 TAGCCGGGCATGGAGGCACATGG + Intergenic
1181012211 22:20048068-20048090 TAGCTGGGCGTGGTGGCAAGCGG - Intronic
1181234159 22:21439815-21439837 TAGCCGGGCGTGGTGGCAGGCGG + Intronic
1181244488 22:21495016-21495038 TAGCCGGGCGTGGTGGCAGGCGG - Intergenic
1181757853 22:25037983-25038005 TAGCTGGGTGTCGTGGCACACGG - Intronic
1182567001 22:31207612-31207634 TAGCAGGGTGTAGTGTGAGATGG + Intergenic
1182680413 22:32075040-32075062 TAGCTGGGCATGGTGGCACATGG - Intronic
1182931833 22:34181713-34181735 TAGCTGGGCATGGTGGCAGATGG - Intergenic
1183426769 22:37744152-37744174 TAGCCGGGCGTGGTGGCACATGG - Intronic
1183569864 22:38644941-38644963 TAGCCGGGTATGGTGGCACACGG + Intronic
1183767409 22:39891762-39891784 TAGCTGGGCTTGGTGGCTCATGG - Intronic
1183896800 22:40975922-40975944 TAGCCGGGCGTGGTGGCACACGG - Intergenic
1184011460 22:41751624-41751646 TAGCTGGGCGTGGTGGCGCGTGG + Intronic
1184025998 22:41856919-41856941 TAGCTGGGCGTGGTGGCAGGCGG + Intronic
1184456444 22:44612961-44612983 TAGCTGGGCAAGGTGGCACACGG - Intergenic
1184485954 22:44779712-44779734 TAGCTGGGCGTGGTGGCCCATGG - Intronic
1184544678 22:45159198-45159220 TAGCTGGGCGTGGTGGCACGTGG - Intergenic
1184752793 22:46498464-46498486 TAGCCGGGCGTGGTGGCAGGGGG + Intronic
1184792929 22:46711940-46711962 TAGCCAGGCATGGTGGCACAAGG + Intronic
1185353857 22:50354157-50354179 TAGCCGGGCATGGTGGCACGTGG + Intronic
949471831 3:4404609-4404631 TAGCCAGGCGTGGTGACACATGG + Intronic
949528834 3:4933585-4933607 TAACTGGGCGTGGTGGCACGCGG + Intergenic
949784171 3:7722586-7722608 TAGCCGGGCATGGTGGTACATGG - Intronic
949978443 3:9482069-9482091 TAGCCGGGCGTGGTGGCAGGAGG + Intergenic
950077864 3:10200031-10200053 TAGTTGGGCATGGTGGCACACGG - Intronic
950157205 3:10730679-10730701 GAGCAGGGCTGGGGGTCACAAGG - Intergenic
950287809 3:11758817-11758839 TAGCCGGGCGTGGTGGTGCATGG - Intergenic
950363477 3:12466425-12466447 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
950513841 3:13450914-13450936 TAGCTGGGCGCGGTGGCATATGG + Intergenic
950629313 3:14271698-14271720 TAGCTGGGCATGGTGGCGCATGG - Intergenic
951007514 3:17635532-17635554 TAGCCGGGCATGGTGGCACATGG + Intronic
951511136 3:23503468-23503490 TGGCCGGGCGTGGTGGCTCACGG - Intronic
951631623 3:24727721-24727743 TAGCTGGTCATGGTGGCACATGG + Intergenic
951657371 3:25024805-25024827 TGGCTGGGCGTGGTGACACACGG + Intergenic
951681365 3:25298326-25298348 TAGCCAGGCGTGGTGGCACGTGG - Intronic
951699300 3:25478706-25478728 TGGCAGAGCCAGGTGTCACATGG - Intronic
952037439 3:29219881-29219903 TAGCCAGGCGTGGTGGCCCATGG + Intergenic
952182691 3:30935096-30935118 TAGCTGGGTGTGGTGGCAGATGG - Intergenic
952335498 3:32400163-32400185 TAGCCGGGTGTGGTGGCACATGG - Intronic
952392882 3:32895698-32895720 TTGCAGGTGATGGTGTCACAGGG + Exonic
952421242 3:33132930-33132952 TAGCCAGGCGTGGTGGCACGTGG + Intronic
952890332 3:38036090-38036112 TAGCCGGGCGTGGTGGCACATGG + Intergenic
953311067 3:41879756-41879778 CAGCTGGGCGTGGTGACTCACGG - Intronic
953375690 3:42426794-42426816 TAGCTGGGCATGGTGGCGCATGG + Intergenic
953563025 3:44009829-44009851 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
953592881 3:44276934-44276956 TAGCTGGGCGTGGTGACATATGG - Intronic
953914900 3:46912159-46912181 TAGCCGGGCGTGGTGGCAGGCGG + Intergenic
953943001 3:47118573-47118595 TAGCTGGGCGTGGTGGCACCCGG + Intronic
953948059 3:47165347-47165369 TAGCCGGGCGTGGTGGCGCACGG + Intergenic
953956858 3:47238360-47238382 TAGCTGGGCGTGGTGGCACATGG - Intronic
953985737 3:47441178-47441200 TGGCCGGGCGTGGTGGCTCACGG - Intronic
954071112 3:48143458-48143480 TAGCTGGGCGTGGTGGCCCATGG + Intergenic
954292950 3:49659318-49659340 TATCATGGCCTGGTCTCACATGG - Intronic
954312898 3:49784139-49784161 TAGCTGGGCGTGGTGGTGCATGG - Intronic
954347529 3:50012886-50012908 TAGCCAGGCGTGGTGGCGCATGG - Intronic
954561035 3:51556720-51556742 TAGCCGGGCATGGTGGCGCATGG - Intronic
954988159 3:54814009-54814031 TAGCTGGGAATGGTGGCACATGG - Intronic
955066015 3:55534281-55534303 TAGCCAGGCGTGGTGGCATATGG + Intronic
955295641 3:57732630-57732652 TGGCTGGGTGTGGTGGCACATGG + Intergenic
955315407 3:57934735-57934757 TAGCCAGACGTGGTGGCACATGG + Intergenic
955331356 3:58050173-58050195 TAGCTGGGTGTGGTGGCACGTGG - Intronic
955369387 3:58338193-58338215 TAGCTGGGCGTGGTGGCACATGG + Intronic
955559323 3:60171849-60171871 TAGCTGGGCAGGGTGGCACATGG - Intronic
955638221 3:61053510-61053532 TAGCCGGGTGTGGTGGCGCATGG + Intronic
955686358 3:61552902-61552924 TAGCTGGACGTGGTGGCTCATGG - Intergenic
955767845 3:62363383-62363405 TAGCTGAGCATGGTGGCACATGG + Intergenic
955790214 3:62581533-62581555 TAGCTGGGCGTGGTGGTACATGG + Intronic
955886202 3:63601124-63601146 TAGCCGGGCTTGGTGGCACATGG + Intronic
956134137 3:66082256-66082278 TAGCAGGGCGTAGTGGCGGACGG + Intergenic
956672764 3:71706672-71706694 TAGCTGGGTGTGGTAGCACATGG + Intronic
957031756 3:75250267-75250289 TAGCAGCGTGTGGTGGCACGTGG - Intergenic
957047486 3:75387318-75387340 GAGCTGGGCGTGGTGGCACACGG + Intergenic
957170250 3:76729781-76729803 TAGCCAGGCGTGGTGGCACGTGG - Intronic
957327203 3:78711629-78711651 TAGCTGGGCGTGGTGGCATGCGG - Intronic
957587320 3:82148758-82148780 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
957686968 3:83514676-83514698 TGGCAGGGGCTGGGGTCACAAGG + Intergenic
957823640 3:85411971-85411993 TAGCTGGGCATGGTGGCATATGG - Intronic
958853174 3:99353367-99353389 TAGCCGGGCATGGTGGCACATGG - Intergenic
958925678 3:100154688-100154710 CAGCTGGGCGTGGTGGCTCATGG + Intronic
958976142 3:100669752-100669774 TGGCCGGGCGTGGTGGCTCACGG + Intronic
959341168 3:105133891-105133913 TAGCTGGGCATGGTGGCGCATGG - Intergenic
960107882 3:113817682-113817704 TAGCTGGGCATGGTGGCACATGG + Intergenic
960145300 3:114194426-114194448 TAGCCGGGCATGGTGGTACACGG - Intronic
960599684 3:119443769-119443791 TAGCCAGGCATGGTGGCACACGG + Intronic
961237609 3:125381093-125381115 TAGCTGGGCATGGTGGCACATGG + Intergenic
961263573 3:125622076-125622098 TAGCTGGGTGTGGTGGCACCCGG + Intergenic
961299502 3:125913608-125913630 TAGCTGGGCGTGGTGACGCGTGG + Intergenic
961418326 3:126778898-126778920 GAGCCAGGCGTGGTGGCACATGG - Intronic
961490736 3:127255331-127255353 TAGCTGGGTGTGGTGGCACATGG + Intergenic
961767239 3:129220819-129220841 TAGCCGGGCGTGGTGGCAGTCGG + Intergenic
961879559 3:130051433-130051455 TAGCTGGGCCTGGTGGCACACGG + Intergenic
961979607 3:131063168-131063190 TAGCTGGGCGTGGTGGCATGTGG - Intronic
962126227 3:132621831-132621853 TAGCTGAGTGTGGTGGCACATGG + Intronic
962225749 3:133606044-133606066 TAGCTGGGCATGGTGGCACATGG + Intronic
963213219 3:142717107-142717129 TAGCTGGGCGTGGTGGTGCACGG + Intergenic
963499554 3:146108324-146108346 TATCTGGGCATGGTGGCACATGG - Intronic
963780049 3:149478289-149478311 TAGCTGGGCATGGTGGCACATGG - Intronic
964025497 3:152069011-152069033 TAGCTGGGCGTGGTGGCATGCGG - Intergenic
965581759 3:170276077-170276099 TAGCTGGGTGTGGTGGCACAGGG - Intronic
965727577 3:171735278-171735300 TAGCTGGACGTGGTGGCACGTGG - Intronic
965942215 3:174198991-174199013 TAGCCTGGCGTGGTGGCACATGG - Intronic
966526057 3:180920655-180920677 TAGCCGGGCGTGGTGGTGCATGG - Intronic
967128607 3:186449724-186449746 TAGCCGGCCGTGGTGGCACCAGG - Intergenic
967273731 3:187752774-187752796 TAGCCGGGCGTGGTGGTGCAGGG - Intergenic
967576221 3:191096678-191096700 TAGCTGGGCATGGTGGCACATGG + Intergenic
967961635 3:194930007-194930029 TATCTGGGTGTGGTGGCACACGG - Intergenic
968116264 3:196092454-196092476 TAGCTGGGCGTGGTGGCGCATGG - Intergenic
968324095 3:197797181-197797203 TAGCTGGGCGTGGTGGTGCATGG + Intronic
968474736 4:798535-798557 TAGCTGGGCATGGTGGCACATGG - Intronic
968681774 4:1925946-1925968 TAGCCAGGCGTGGTGGCACATGG - Intronic
968693829 4:2010516-2010538 TAGCCGGGCTTGGTGGCGCATGG + Intronic
968843674 4:3027183-3027205 TAGCTGGGTGTGATGGCACATGG - Intronic
968991768 4:3918335-3918357 TAGCTGGGCGTGGTGGCACACGG + Intergenic
969021976 4:4145039-4145061 TATCCGGGCGTGGTGGCAGATGG - Intergenic
969273586 4:6119396-6119418 TAGCTGGGCGTGGTTGCGCATGG + Intronic
969668189 4:8574277-8574299 TAGCCAGGCGTGGTGGTACACGG + Intronic
969731887 4:8962354-8962376 TAGCTGGGCGTGGTGGCAGGTGG + Intergenic
969791482 4:9496460-9496482 TAGCCGGGCGTGGTGGCAGGTGG + Intergenic
969823574 4:9739152-9739174 TAGCTGGGCGTGGTGGCACACGG - Intergenic
970413678 4:15835656-15835678 TAGCCGGGCATGGTGGCCCATGG - Intronic
970786159 4:19798618-19798640 TAGCCAGGCATGGTGGCACATGG - Intergenic
970894576 4:21087320-21087342 TAGCCAGGTGTGGTGGCACATGG - Intronic
971176111 4:24284151-24284173 TAGCTGGGCGTGGTGGGGCAGGG + Intergenic
971317581 4:25580416-25580438 TAGCTGGGCGTGGTGGTGCAAGG - Intergenic
971610489 4:28719350-28719372 TAGCTGGGCATGGTGGCAGACGG - Intergenic
971690560 4:29829028-29829050 TAGCTGGGTGTGGTGGCACATGG + Intergenic
972053707 4:34773544-34773566 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
972126216 4:35769771-35769793 TAGCCAGGCGTGCTGGCACATGG - Intergenic
972284179 4:37632315-37632337 TAGCCAGGCATGGTGGCACATGG - Intronic
972401398 4:38707124-38707146 TAGCTGGGCATGGTGGCACGTGG - Intergenic
972567695 4:40284047-40284069 CAGCCGGGCGTGGTGGCTCATGG - Intergenic
972590147 4:40478159-40478181 TATCCGGGCGTGGTGGCGCATGG - Intronic
972591324 4:40490627-40490649 TAGCCGGGCGTGGTGGCGCCTGG + Intronic
973600424 4:52537313-52537335 TAGCCTGGGGTGGGGTCACATGG - Intergenic
973890198 4:55360832-55360854 TAGCTGGGCGTGGTGGCACATGG - Intronic
975630615 4:76398384-76398406 TGGCCGGGCGTGGTGGCTCATGG + Intronic
976091698 4:81464936-81464958 TAGCCGGGCATGGTGGCACATGG + Intronic
976228870 4:82819905-82819927 TAGCTGGGCATGGTGGCACACGG - Intronic
976657184 4:87501257-87501279 TACCAGGGCGTGGTGACCCCAGG - Intronic
976700245 4:87962070-87962092 TAGCTGGGCAAGGTGGCACATGG + Intergenic
977543755 4:98350557-98350579 TGGCCGGGCGTGGTGGCTCACGG + Intronic
977619364 4:99119220-99119242 TAGCTGGGGGTGGTGGCACACGG + Intergenic
977700881 4:100021498-100021520 TAGCTGCGCATGGTGGCACATGG - Intergenic
978309510 4:107370767-107370789 TAGCTGGGCATCGTGGCACATGG + Intergenic
978392173 4:108238759-108238781 TGGCAGGGCGCGGTGGCTCATGG - Intergenic
978460150 4:108942587-108942609 TAGCTGGGCGTGGTGGCACATGG - Intronic
978818061 4:112931580-112931602 TAGCCAGGCATGGTGGCACATGG - Intronic
979051555 4:115940646-115940668 TAGCCTGGCGTGGTGGCATATGG - Intergenic
979381271 4:120009571-120009593 TAGCTGGTCAGGGTGTCACAAGG - Intergenic
979590742 4:122477468-122477490 TAGCTGGGCGTGGTGGCAGGTGG - Intergenic
980117815 4:128696508-128696530 TAGCTGGGAGTGGTGACACTTGG + Intergenic
980236783 4:130117911-130117933 AAGCAGGGCATGGTGGCTCAAGG - Intergenic
980695354 4:136348433-136348455 TAGCCAGGCGTGCTGGCACATGG - Intergenic
980853483 4:138411674-138411696 TAGCCGGGCGTGGTGGCATGCGG - Intergenic
980931684 4:139188395-139188417 TAGCCGGGCGTGGTGGCAGGCGG - Intergenic
980934892 4:139217084-139217106 TAGCCAGGCGTGGTGGCACATGG + Intergenic
981052089 4:140319235-140319257 TAGCCAGGCGTGGTGGCGCATGG - Intronic
981419562 4:144533690-144533712 TAGCGGGGCGTGGTGGCACATGG + Intergenic
981472822 4:145156535-145156557 TAGCTGGGCGTAGTGGCACATGG + Intronic
982059117 4:151585323-151585345 TAGCTGGGTGTGGTGGCACAAGG - Intronic
982197539 4:152931789-152931811 TAGCTGGGCGTGGTGGCATGTGG + Intergenic
982518354 4:156381211-156381233 TAGCTGGGCATGGTGGCGCATGG + Intergenic
982698519 4:158631945-158631967 TAGCTGGGCATGGTGGCATATGG + Intronic
982808332 4:159794260-159794282 TGGCCGGGCGTGGTGGCTCAGGG - Intergenic
983113362 4:163781203-163781225 TAGCCAGGCGTGGTGGCAGATGG + Intronic
983201412 4:164864158-164864180 TAGCAAGGCTTGGTGGCACACGG + Intergenic
983520262 4:168701235-168701257 TACCAGAGCGTGGCTTCACAAGG + Intronic
983693713 4:170503282-170503304 TAGCCAGGCATGGTGGCACATGG - Intergenic
983919540 4:173331187-173331209 TAGCTGGGCTTGGTGGCACATGG + Intergenic
984272781 4:177568130-177568152 CAGCCGGGCGTGGTGGCTCACGG + Intergenic
985257785 4:188086656-188086678 TAGCCGGGCGTGGAGGCACATGG + Intergenic
985707154 5:1408180-1408202 TAGCCGGGTGTGGTGGCACAAGG - Intronic
986660129 5:10052051-10052073 AAGCAGGGAGTAGTGTCCCAAGG + Intergenic
987391619 5:17381531-17381553 TAGCCAGGTGTGGTGGCACATGG + Intergenic
987536682 5:19198654-19198676 TAGCTGGGCATAGTGGCACATGG - Intergenic
987624240 5:20376869-20376891 TAGCCGGGCGTGGTGGCAGGTGG + Intronic
988215033 5:28261008-28261030 TAGCCAGGCGTGGTGGCACATGG - Intergenic
988474660 5:31573097-31573119 TAGCCAGGTGTGGTGGCACACGG + Intergenic
988518184 5:31922959-31922981 GAGCTGGGCGTGGTGGCTCAGGG - Intronic
988972385 5:36482544-36482566 TATCAGAGAGTGGTCTCACAGGG - Intergenic
989052326 5:37333945-37333967 TAGCTGGGCGTGGTGACATATGG - Intronic
989056129 5:37367927-37367949 TAGCTGGGTGTGGTGGCTCATGG - Intronic
989669861 5:43903693-43903715 TAGCTGGACGTGGTGGCACACGG - Intergenic
989802881 5:45565676-45565698 TAGCTGGGTGTGGTGTCACACGG + Intronic
990386914 5:55273939-55273961 TAGCTGGGCGTGGTGGCATGCGG + Intronic
990408063 5:55511977-55511999 TAGCTGGGCGTGGTGGCAGGTGG + Intronic
990469150 5:56097719-56097741 TAGCTGGGCGTGGTGGCGCTCGG - Intergenic
990577743 5:57139483-57139505 TAGCCAGGCGTGGTGGCGCATGG - Intergenic
990685937 5:58301077-58301099 TAGCTGGGCGTGGTGGCACATGG - Intergenic
990977861 5:61574883-61574905 TAGCTGGGCATGGTGGCGCATGG + Intergenic
991298444 5:65104585-65104607 TAACAGGGACTGGTCTCACAGGG + Intergenic
991316932 5:65319569-65319591 TAGCTGGGTGTGGTAGCACAAGG + Intronic
991514904 5:67424638-67424660 TAGCAAGGTGTGGTGGCTCATGG + Intergenic
991701638 5:69321980-69322002 TAGCCGGGCATGGTGGCGCATGG - Intronic
991774893 5:70075172-70075194 TGGCTGGGCGTGGTGGCATATGG - Intronic
991854186 5:70950597-70950619 TGGCTGGGCGTGGTGGCATATGG - Intronic
991990491 5:72334001-72334023 TAGCTGGGTGTGGTGGCACAAGG - Intronic
992165463 5:74046063-74046085 AAGCTGGGCGTGGTGGCTCATGG - Intergenic
992167714 5:74071337-74071359 AAGCCAGGCGTGGTGTCACATGG - Intergenic
992262728 5:74987169-74987191 TAGCCAGGTGTGGTGGCACATGG - Intergenic
992311488 5:75505139-75505161 TAGCCGGGCGTGATGGCACGTGG + Intronic
992398720 5:76391564-76391586 TAGCTGGGCATGGTGGCACGTGG + Intergenic
992688024 5:79216960-79216982 TAGCCAGGCATGGTGGCACATGG - Intronic
992692149 5:79251375-79251397 TAGCTGGGCATGGTGGCGCATGG - Intronic
992719238 5:79543516-79543538 TAGCCGGGTGTGGTGGCACGTGG - Intergenic
993684349 5:90919846-90919868 TAGCTGGGCATGGTGGCACATGG + Intronic
993868418 5:93221534-93221556 TAGCTGGGCATGGTGGCGCATGG + Intergenic
994194555 5:96907735-96907757 TAGCTGGGCATGGTGGCACATGG + Intronic
994372034 5:98978377-98978399 TAGCTGGGCATGGTGGCACATGG - Intergenic
994380499 5:99064904-99064926 TAGCTGGGCATGGTGGCACTTGG + Intergenic
994383298 5:99097370-99097392 TATCAGGGCATGGTGGCACATGG + Intergenic
994770896 5:103980702-103980724 TAGCTGGGCGTGGTGGCGCGCGG + Intergenic
995198420 5:109399063-109399085 TAGCCGGGTTTGGTGGCACATGG + Intronic
995501937 5:112816645-112816667 TAGCCAGGCATGGTGGCACATGG + Intronic
995512716 5:112924259-112924281 TAGCCGGACATGGTGGCACACGG - Intergenic
995719132 5:115111362-115111384 TAGCTGGGCGTGGTGGTACATGG + Intergenic
995773477 5:115698978-115699000 TAGCTGGGCATGGTGGCACATGG + Intergenic
996116420 5:119625073-119625095 TAGCTGGGGGTGGTAGCACATGG - Intronic
996718391 5:126606339-126606361 TAGCTGGGCGTTGTAGCACATGG - Intronic
996793183 5:127315493-127315515 TTGCCGGGCGTGGTGGCCCATGG + Intronic
996812378 5:127531766-127531788 TAGCTGGGCGTGGTGGCACACGG - Intronic
997961188 5:138323075-138323097 TAGCCAGGCGTGGTGGCACCTGG - Intronic
997982327 5:138476199-138476221 TAGCCGGGCGTGGTGGCACGCGG - Intergenic
998020929 5:138769677-138769699 TAGCTGGGCGTGGTGGCGCAGGG - Intronic
998116291 5:139540197-139540219 TAGCCCGGCGTGGTGGCTCATGG - Intronic
998124139 5:139604732-139604754 TAGCTGGGAGTGGTGGCTCATGG + Intronic
998782817 5:145677298-145677320 TAGCTGGGCGTGGTGGCACACGG - Intronic
999168876 5:149575906-149575928 TAGCTGGGCGTGTTGGCACCTGG + Intronic
999418683 5:151421734-151421756 TAGCTGGGCATGGTGGCACATGG - Intergenic
999569903 5:152908348-152908370 TGGCAGGGCATGGTGGCTCACGG + Intergenic
999796827 5:154996661-154996683 TAGCTGGGCGTGGTGGCATGTGG + Intergenic
1000243524 5:159430109-159430131 TAGCTGGGCATGGTGGCTCATGG + Intergenic
1000941857 5:167371505-167371527 TAGCCGGGTGTGGTGGCGCATGG - Intronic
1001352661 5:170984479-170984501 TAGCTGGGCATGGTGACACACGG + Intronic
1001520802 5:172391119-172391141 AAGCCGGGCGTGGTGGCTCACGG - Intronic
1001551918 5:172608973-172608995 TAGGAGGGGGTGATGTCATAGGG + Intergenic
1002143579 5:177160912-177160934 TAGCTGGGCGTGGTGGCTCATGG - Intronic
1002143754 5:177162150-177162172 TAGTTGGGCGTGGTGGCTCATGG + Intronic
1002361961 5:178679320-178679342 TAGCTGGGCGTGGTGGTACATGG - Intergenic
1002510785 5:179715386-179715408 TAGCTGGGCATGGTGGCACGGGG + Intronic
1002956998 6:1875877-1875899 TAGCCAGGCATGGTGGCACATGG + Intronic
1003205223 6:4003122-4003144 TTGCTGGGTGTGGTGGCACAAGG + Intergenic
1003596386 6:7477847-7477869 TAGCTGGGCATGGTGGCGCACGG + Intergenic
1003656546 6:8016178-8016200 TAGCTGGGCGTGGTGGCACATGG + Intronic
1003935511 6:10971310-10971332 TAGCCGGGTGTGGTGGCACGAGG + Intronic
1004272188 6:14205445-14205467 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
1004366118 6:15014123-15014145 TGGCCGGGCGTGGTGGCTCACGG - Intergenic
1004392741 6:15223086-15223108 TAGCCGGGCGTGGTGGTGCATGG - Intergenic
1004394637 6:15236964-15236986 TAGCCGGGCATGGTAGCACATGG + Intergenic
1004432334 6:15556325-15556347 TAGCTGGGCTTGGTGGCGCATGG - Intronic
1004674029 6:17824051-17824073 TAGCCAGGCATGGTGGCACATGG - Intronic
1004725262 6:18305606-18305628 TAGCCGGGCGTGGTGGCACACGG - Intergenic
1004829607 6:19463025-19463047 TAGCTGGGTGTGGTGGTACATGG + Intergenic
1004974528 6:20950268-20950290 TAGCCGGGCGTGGTGGCACATGG - Intronic
1005289696 6:24367114-24367136 TAGCCAGGCATGGTGTCTCATGG - Intergenic
1005385703 6:25281967-25281989 TAGCTGGGCGTGGGGGCACGTGG + Intronic
1005457895 6:26038964-26038986 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1005614001 6:27555636-27555658 TAGCGGGGCGTGGTGGCGCATGG - Intergenic
1005666894 6:28066800-28066822 TAGCCTGGCGTGGTGGCGCATGG - Intergenic
1005685538 6:28250211-28250233 TAGCCGGGCGTGGTGGCACATGG - Intronic
1005736551 6:28753281-28753303 TGGCCGGGCGTGGTGGCTCATGG + Intergenic
1005981089 6:30837154-30837176 TAGCCAGGCATGGTGCCACATGG - Intergenic
1006190232 6:32203049-32203071 TAGCTGGGCGTGGTGGTGCATGG - Intronic
1006638577 6:35476966-35476988 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1006669603 6:35721599-35721621 TAGCCGGGCGTGGTAGCGCATGG - Intronic
1006771801 6:36559958-36559980 TAGCCAGGTGTGGTGGCACACGG - Intergenic
1006803438 6:36773918-36773940 TAGCCGGGCGTGGTGGTGCATGG + Intronic
1006821540 6:36900345-36900367 TAGCCAGGTGTGGTGGCACATGG - Intronic
1006849036 6:37084080-37084102 TAGCTGGGCATGGTGGCTCACGG + Intergenic
1007005828 6:38361401-38361423 TAGCTAGGAGTGGTGGCACATGG + Intronic
1007354707 6:41305665-41305687 TAGCTGGGCGTGGTGGTACATGG - Intergenic
1007433200 6:41788288-41788310 TAGCAGGGCGTGGTGGCGGGCGG - Intronic
1007507615 6:42348397-42348419 TAGCTGGGCATGGTGGCGCATGG - Intronic
1007579718 6:42950387-42950409 TAGCCGGGCGTGGTGGCACGCGG - Intergenic
1007770379 6:44187186-44187208 TAGCCAGGCGTGGTGGCACACGG + Intergenic
1007849963 6:44793407-44793429 TGGCCGGGCGTGGAGTCACATGG - Intergenic
1008093761 6:47317667-47317689 TATCAGGTCTTGGTGACACATGG - Intergenic
1008102431 6:47406306-47406328 TAGCCAGGTGTGGTGGCACATGG + Intergenic
1008341561 6:50370602-50370624 TATCAGGGCGTGGTGGCACACGG + Intergenic
1008913604 6:56762994-56763016 TAGCTGGGTGTGGTGGCACATGG - Intronic
1008964319 6:57298914-57298936 TGGCAGGGCTTGGTGACAGATGG - Intergenic
1009417034 6:63427188-63427210 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1009771890 6:68154039-68154061 TAGCTGGGCATGGTGGCGCATGG - Intergenic
1009923806 6:70096232-70096254 TAGCTGGGCATGGTGGCATATGG - Intronic
1010426892 6:75738008-75738030 TAGCTGGGCGTGGTGATGCATGG + Intergenic
1011363508 6:86553599-86553621 TAGCTGGGCATGGTGGCACATGG - Intergenic
1011399713 6:86946968-86946990 TAGCCATGCGTGGTGGCACATGG + Intronic
1011689377 6:89852340-89852362 TAGCCAGGTGTGGTGGCACATGG - Intronic
1012139912 6:95613200-95613222 TAGCTGGGCATGGTGGCAGAAGG + Intergenic
1012440802 6:99260584-99260606 TAGCTGGGCATGGTGGCACATGG + Intergenic
1012724135 6:102786744-102786766 TAGCCGGGCATGGTGGCCCATGG - Intergenic
1012952479 6:105533438-105533460 TAGCAGAGGATGGTGACACAGGG + Intergenic
1013117295 6:107113288-107113310 TAGCAAGGCATGGTGGCACATGG + Intronic
1013574747 6:111470832-111470854 TAGCCGGGTGTGGTGGCACGTGG + Intronic
1013973411 6:116047525-116047547 TAGCTAGGCATGGTGGCACATGG - Intronic
1014108144 6:117590424-117590446 TAGCTGGGCGTGGTGGTATATGG + Intronic
1014263921 6:119252644-119252666 TAGCTGGGCGTGGTGGTACATGG + Intronic
1014427281 6:121323792-121323814 TAGCTGGGCGTGGTGGCATGTGG + Intronic
1015347965 6:132181325-132181347 TAGTTGGGCGTGGTGGCACATGG + Intergenic
1015598339 6:134887828-134887850 TAGCCGGGCGTGGTGGCACACGG + Intergenic
1015762419 6:136678869-136678891 TACCTGGGTGTGGTGGCACATGG - Intronic
1015933943 6:138389742-138389764 GGGCAGGGCGTGGTGGCTCACGG + Intergenic
1016814420 6:148290458-148290480 TAGCCGGGCGTGGTGGCAGGCGG + Intronic
1016965193 6:149712342-149712364 TAACCGGGTGTGGTGGCACATGG - Intronic
1017698065 6:157039021-157039043 TAGCCAGGCATGGTGGCACATGG - Intronic
1018651370 6:165994273-165994295 TAGCTGGGCATGGTGGCACATGG - Intergenic
1018733572 6:166670964-166670986 TAGCTGAGCGTGGTGGCACGAGG - Intronic
1018991522 6:168677350-168677372 CAGCAGGGGAGGGTGTCACAAGG + Intergenic
1019164646 6:170089993-170090015 GAGCACTGGGTGGTGTCACAAGG - Intergenic
1019320463 7:413062-413084 TAGCTGGGCGTGGTGGCGCATGG + Intergenic
1019678663 7:2331557-2331579 TAGCCGGGCGTGGTGGCAGGCGG + Intronic
1019945424 7:4324944-4324966 TAGCCAGGCGTGGTGGCATATGG + Intergenic
1019960941 7:4458955-4458977 TAGCCGGGTGTGGTGGTACATGG + Intergenic
1019973994 7:4565090-4565112 TAGCTGGGCATGGTGGCGCATGG + Intergenic
1020164602 7:5798008-5798030 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
1020250557 7:6464880-6464902 TAGCCGGGTGTGGTGGCACATGG - Intronic
1020314578 7:6896120-6896142 TAGCTGGGCTTGGTGGCACAAGG + Intergenic
1021269263 7:18565140-18565162 TAGCTGGGTGTGGTGGCGCATGG - Intronic
1021989994 7:26131910-26131932 TAGCTGGGGCTGGTGGCACATGG + Intergenic
1022686899 7:32605582-32605604 TAGCCAGGCATGGTGGCACATGG + Intergenic
1022760980 7:33350835-33350857 TAGCTGGGCGTGGTGACACCTGG - Intronic
1022825577 7:34009183-34009205 AAGCTGGGCTTGGTGGCACATGG - Intronic
1022991005 7:35707222-35707244 TAGCCAGGCGTGGTGGCTCATGG - Intergenic
1023015389 7:35964397-35964419 TAGCTGGGTGTGGTGGCACCCGG - Intergenic
1023229853 7:38015373-38015395 TAGCTGGGCATGGTGGCACATGG + Intronic
1023724241 7:43125610-43125632 TAGCCGGGCATGGTGTCACATGG + Intronic
1023732181 7:43202889-43202911 TAGCAGGGGTGGGGGTCACAAGG - Intronic
1023738704 7:43258194-43258216 TAGCCGGGTGTGGTGGCACATGG + Intronic
1023789735 7:43744075-43744097 TAGCTGGGCGTGGTGGCACTTGG - Intergenic
1023808443 7:43891925-43891947 TAGCTGGGCATGGTGGCACATGG - Intronic
1023811129 7:43912994-43913016 TAGCTGGGCATGGTGGCGCATGG - Intronic
1023906953 7:44529886-44529908 TAGCTGGGAGTGGTGGCACACGG + Intronic
1023918794 7:44610750-44610772 TAGCCGGGCGTGGTGGCACGCGG - Intronic
1023934966 7:44733362-44733384 TAGCTGGACGTGGTGGCACATGG - Intergenic
1024065552 7:45730297-45730319 TAGCTGGGCGTGGTGGCACCCGG + Intergenic
1024077428 7:45829047-45829069 TAGCTGGGCATGGTGGTACATGG - Intergenic
1024616862 7:51122831-51122853 TAGCAGGGCATGGTGGCGCATGG + Intronic
1024807778 7:53166446-53166468 TAGCCGGGCATGGTGGCACGCGG - Intergenic
1025069430 7:55886197-55886219 TAGCAGGGCGCAGTGGCTCAGGG + Intergenic
1025079426 7:55968899-55968921 TAGCAGGGTGTGGTGGTGCAGGG + Intronic
1025276770 7:57588960-57588982 TAGCTGGGCGTGGTGGCAGATGG - Intergenic
1025562714 7:62389414-62389436 TAGCCAGGCATGGTGGCACACGG + Intergenic
1025641024 7:63369513-63369535 TAGCCAGGCATGGTGGCACATGG - Intergenic
1025980055 7:66398026-66398048 TAGCTGGGTGTGGTGTTACATGG - Intronic
1026043474 7:66888102-66888124 TAGCCAGGTGTGGTGTTACATGG + Intergenic
1026048715 7:66926472-66926494 TAGCTGGGCGTGGTGGCACATGG + Intronic
1026221065 7:68398144-68398166 TAGCTGGGTGTGGTGGTACATGG - Intergenic
1026336259 7:69396666-69396688 TGGCAGGGCGAGGTGGCTCACGG - Intergenic
1026337768 7:69409602-69409624 TAGCTGGGCCTGGTGGCACATGG - Intergenic
1026586198 7:71658048-71658070 TAGCCAGGTGTGGTGGCACATGG - Intronic
1026796988 7:73372437-73372459 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1027012919 7:74762009-74762031 TAGCCGGGCGTGGTGGCAGGTGG - Intergenic
1027057567 7:75060574-75060596 TAGCTGGGTGTGGTGGCACACGG - Intronic
1027175508 7:75900494-75900516 TAGCCGGGCATGGTGGCACGCGG + Intronic
1027306039 7:76898460-76898482 TAGCTGGGCATGGTGGCACATGG + Intergenic
1027329238 7:77074055-77074077 TAGCTGGGTGTGGTGGCACGCGG - Intergenic
1027934825 7:84589131-84589153 GTGCAGGGCGTGGTGTGGCATGG + Intergenic
1027985102 7:85277581-85277603 TAGCTGGGTGTGGTGGCACACGG - Intergenic
1028298898 7:89171578-89171600 TAGCCAGGTGTGGTGGCACAAGG - Intronic
1028560973 7:92175500-92175522 TAGCTGGGCATGGTGGCGCACGG + Intronic
1028568584 7:92260532-92260554 TAGCTGGGCGTGGTGGTACATGG + Intronic
1028917592 7:96276475-96276497 TAGCTGGGCATGGTGGCGCACGG + Intronic
1029084556 7:98001056-98001078 TAGCTGGGCATGGTGGCTCATGG - Intergenic
1029120566 7:98265167-98265189 TGGCCGGGCGTGGTGGCTCATGG - Intronic
1029248638 7:99220443-99220465 AAGCATGGCCAGGTGTCACATGG + Intergenic
1029427847 7:100508004-100508026 TATCTGGGCGTGGTGGCACATGG + Intergenic
1029484654 7:100832364-100832386 TAGCTGGGCGTGGTGGCATGTGG + Intronic
1029786527 7:102797315-102797337 TAGCTGGGTGTGGTGGCACGCGG + Intronic
1029837682 7:103330595-103330617 TAGCCGGGCGTAGTGGCACATGG - Intronic
1030307107 7:108029970-108029992 TAGCTGGGCGTGGTGGCACGTGG + Intronic
1030525861 7:110654224-110654246 TAGCTGGGCGAGGTGGCGCACGG + Intergenic
1030531532 7:110717194-110717216 AAGCCGGGCGTGGTGGCACATGG + Intronic
1030571152 7:111226297-111226319 TAGCTGGGCATGGTGGCACATGG - Intronic
1031404576 7:121369125-121369147 TAGCCGGGCGTGGTGGCACATGG - Intronic
1031616913 7:123892355-123892377 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1031653722 7:124325021-124325043 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1031878771 7:127172560-127172582 TAGCCAGGTGTGGTGGCACATGG + Intronic
1032059307 7:128710797-128710819 TAGCTGGGCGTGGTGGCACATGG - Intronic
1032399778 7:131616658-131616680 TAGCTGAGCATGGTGGCACATGG + Intergenic
1033070857 7:138200888-138200910 TAGCAGGGCATGGTGGTGCAAGG + Intergenic
1033154960 7:138948846-138948868 TAGCCAGGCATGGTGGCACATGG - Intronic
1033346197 7:140527187-140527209 GAGCAGGGCGTGGGGGCACCAGG - Intronic
1033762230 7:144447981-144448003 TTGCTGGGCGTGGTGGCACATGG + Intergenic
1033919462 7:146371669-146371691 CAGCTGGGCGTGGTGGCTCATGG + Intronic
1034130967 7:148717200-148717222 TAGCCGGGCGTGGTGGCAGGTGG - Intronic
1034619070 7:152443351-152443373 TAGCCGGGCATGGTGGCACATGG + Intergenic
1034880642 7:154759855-154759877 CAGCTGGGCGTGGTGGCTCATGG + Intronic
1035040907 7:155926484-155926506 TAGCTGGGCATGGTGCCTCATGG - Intergenic
1035190112 7:157159719-157159741 CAGCCGAGCGTGGTGGCACATGG + Intronic
1035751030 8:1996410-1996432 CAGCCGGGCTTGGTGGCACAGGG - Intronic
1037278098 8:17203374-17203396 TAGCCGGGCATGGTGGCACATGG - Intronic
1037762868 8:21753460-21753482 TAGCTGGGCGTGGTGACATGTGG + Intronic
1037847303 8:22294931-22294953 TAACTGGGCGTGGTGGCGCAGGG + Intronic
1037866830 8:22450978-22451000 TAGCCGGGCGTGGTGGCGCGTGG - Intronic
1038108065 8:24459599-24459621 TAGCCAGGCATGGTGGCACATGG - Intronic
1038978038 8:32723538-32723560 TAGCCGGGTGTGGTGGCGCATGG + Intronic
1039039326 8:33392428-33392450 TAGCCAGGCATGGTGGCACATGG + Intronic
1039098303 8:33911521-33911543 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1039197289 8:35046997-35047019 TAGCCAGGCGTGATGTCACGGGG - Intergenic
1039548431 8:38426337-38426359 TATCAGAGCCTGGTGGCACAGGG + Intronic
1040022627 8:42754452-42754474 TAGTAGGGCATGGTGGCACATGG - Intronic
1040419762 8:47227657-47227679 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
1040445999 8:47494132-47494154 TAGCCAGGCATGGTGGCACATGG - Intronic
1040453023 8:47567363-47567385 TAGCCGGGCGTGGTGGCGCATGG - Intronic
1040455413 8:47593030-47593052 TAGCTGGGCGTGGTGGGGCATGG - Intronic
1040467705 8:47710612-47710634 TAGCCAGGCGTGGAGGCACATGG - Intronic
1041308479 8:56489146-56489168 GTGAAGGGCGAGGTGTCACATGG - Intergenic
1041763470 8:61392712-61392734 TAGCTGGGCTTGGTGCCACACGG + Intronic
1041870794 8:62632646-62632668 TAGCCAGGCATGGTGGCACACGG - Intronic
1042239583 8:66649364-66649386 TAGCTGGGCATGGTGGCACATGG + Intronic
1042306185 8:67335893-67335915 TAGCCGGGCGTGGTGGCAGTGGG - Intronic
1042629423 8:70800629-70800651 TAGCTGGGCGTGGTGACAGTTGG - Intergenic
1043141660 8:76597695-76597717 TAGCTGGGCGTGGTGGCGGAGGG + Intergenic
1043414265 8:80032005-80032027 TAGCTGGGCGTGATGACACATGG + Intronic
1044979719 8:97704460-97704482 TAGCCAGGCATGGTGGCACATGG + Intronic
1045036150 8:98178022-98178044 TAGCAGGGGCTGGGGTCACGGGG + Intergenic
1045516712 8:102866079-102866101 TAGCTGGGCATGGTGGCACATGG + Intronic
1045659988 8:104427422-104427444 TAGCCGGGCATGGTGGCACGTGG - Intronic
1045695728 8:104806802-104806824 TAGCTGGGCATGGTGGCACACGG + Intronic
1046939264 8:119915110-119915132 TAGCTGGGCGTGGTGGCACATGG - Intronic
1047120259 8:121895058-121895080 TAGCTGGGTGTGGTGGCACGCGG + Intergenic
1047207081 8:122811232-122811254 TAGCTGGGCGTAGTGGCACATGG + Intronic
1047334628 8:123923789-123923811 TAGCTGGGCATGGTGGCACGTGG + Intronic
1047342844 8:123999515-123999537 TAGCCAGGTGTGGTGGCACATGG + Intronic
1047461214 8:125067158-125067180 TAGCTGGGCATGGTGGCACACGG - Intronic
1047486724 8:125337747-125337769 TAGCCGGGCGTGGTGGCACATGG + Intronic
1047560895 8:125987453-125987475 TAGCTGGGCATGGTGGCACATGG - Intergenic
1047728246 8:127703455-127703477 TAGCCGGGCATGGTAGCACATGG - Intergenic
1048198713 8:132353666-132353688 TAGCTGGGCGTGGTGGCGCACGG + Intronic
1048341929 8:133546851-133546873 TAGCCAGGTGTGGTGGCACATGG + Intronic
1048464167 8:134650271-134650293 TAGCTGGGTGTGGTGGCACGTGG - Intronic
1049114725 8:140676228-140676250 TAGCTGGGCGTGGTGGTACGTGG + Intronic
1049691658 8:143963786-143963808 TAGCCAGGTGTGGTGGCACATGG - Intronic
1050197696 9:3105855-3105877 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1050349307 9:4724631-4724653 TAGCTGGGTGTGGTGGCTCATGG + Intronic
1050366634 9:4879152-4879174 GGGCGGGGCGTGGTGTGACATGG + Intronic
1050424684 9:5501103-5501125 TAGCTGGGTGTGGTGGCGCATGG + Intergenic
1050532453 9:6602496-6602518 TAGCTGGGCGTGGTGTCAGGAGG - Intronic
1050547358 9:6720198-6720220 TAGCTGGGCGTGGTGGCAAACGG - Intergenic
1050587773 9:7130902-7130924 TAGCCAGGCATGGTGGCACAGGG - Intergenic
1050786054 9:9403143-9403165 TAGCTGGGTGTGGTGGCACAAGG + Intronic
1050860834 9:10428171-10428193 TAGCTGGGTGTGGTGGCTCATGG + Intronic
1051247251 9:15124278-15124300 CAGCTGGGCGTGGTGGCACGCGG - Intergenic
1051275830 9:15397189-15397211 TAGCCGGACTTGGTGGCACATGG + Intergenic
1051406820 9:16746507-16746529 TAGCCGGGCGTGGTGGCACATGG - Intronic
1052142833 9:25008497-25008519 TAGCTGGGCATGGTGGCGCATGG + Intergenic
1052258212 9:26484218-26484240 TGGCCGGGCGTGGTGGCGCATGG - Intergenic
1052711961 9:32068026-32068048 TAGCTGGGCATGGTGTCACATGG + Intergenic
1053074905 9:35124590-35124612 TAGCTGGGCTTAGTGGCACAGGG - Intergenic
1053378358 9:37627617-37627639 TAGCTGGGCATGGTGTGGCATGG - Intronic
1054117802 9:61182112-61182134 TAGCTGGGCGTGGTGGCAGGAGG - Intergenic
1054589953 9:67000454-67000476 TAGCTGGGCGTGGTGGCAGGAGG + Intergenic
1055027096 9:71733988-71734010 TAGCCAGGCATGGTGGCACAAGG - Intronic
1056348918 9:85727880-85727902 TAGCTGGGCATGGTGGCATATGG + Intronic
1056592718 9:87976393-87976415 TAGCCGGGCATGGTGGCACTCGG + Intergenic
1056793773 9:89642413-89642435 TAGCCAGGCATGGTGGCACATGG + Intergenic
1056891547 9:90498740-90498762 TAGCTGGGCATGGTGGCGCATGG - Intergenic
1057406775 9:94778881-94778903 TAGCTGGGCGTGGTGGTACACGG + Intronic
1057609006 9:96524081-96524103 TAGCCGGCTGTGGTGGCACATGG - Intronic
1057737083 9:97672980-97673002 TAGCCAGGCGTGGTGGTACATGG + Exonic
1058133687 9:101283115-101283137 TAGCTGGGTGTGGTGGCTCACGG - Intronic
1058495738 9:105557510-105557532 TAGCAGGGCGGGGTGTGGCGGGG - Intergenic
1058691265 9:107522593-107522615 TAGCTGGGCGTGGTGTTACATGG - Intergenic
1059185680 9:112268548-112268570 TAGCGGGGCATGGTGGCACATGG + Intronic
1059231477 9:112725292-112725314 TAGCCGGGCGTGGTGGTGCATGG + Intergenic
1059504879 9:114789458-114789480 TAGCCGGGCGTGGTAGCGCATGG - Exonic
1060105710 9:120871890-120871912 TAGCTAGGCGTGGTGGCACGTGG + Intronic
1060391423 9:123280716-123280738 TAGCTGGGCGTGGTGGCATGTGG - Intergenic
1060506877 9:124204483-124204505 TAGCTGGGTGTGGTGGCGCATGG - Intergenic
1060916979 9:127397565-127397587 GAGGAGGGCGTGGGGTCCCAGGG - Intronic
1060953803 9:127623246-127623268 TAGCTGGGCATGGTGGCACGTGG + Intronic
1061086563 9:128402733-128402755 TAGTTGGGCGTGATGGCACATGG - Intergenic
1061187361 9:129062696-129062718 TAGCCGGGCGTGGTGGTACGTGG + Intronic
1061343348 9:130001741-130001763 TAGCCGGGCATGGTGGCTCACGG + Intronic
1061497882 9:130986073-130986095 TAGCTGGGTGTGGTGGCACATGG - Intergenic
1061500753 9:131000537-131000559 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1061693989 9:132357086-132357108 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1062211136 9:135364773-135364795 TAGATGGGCGTGGTGGCACACGG + Intergenic
1203679356 Un_KI270756v1:50396-50418 TAGCATGGAATGGTGTCACATGG - Intergenic
1185639879 X:1583799-1583821 TAGCTGGGCGTGGTGGCACGTGG - Intergenic
1185727112 X:2430877-2430899 TAGCCAGGCATGGTGGCACACGG + Intronic
1185942322 X:4335429-4335451 TAGCAGGGCGTGGTGGTGTATGG + Intergenic
1186080775 X:5929319-5929341 TAGCCGGGCATGGTGGCACATGG + Intronic
1186420686 X:9423382-9423404 TAGCTGAGTGTGGTGGCACATGG - Intergenic
1186421610 X:9431467-9431489 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
1186425038 X:9457376-9457398 TAGCCAGGCGTGGTGGCACGTGG + Intergenic
1186869453 X:13756097-13756119 TAGCTGGGTGTGGTGGCACATGG - Intronic
1187504985 X:19872104-19872126 TAGCCGGGCATGGTGACGCATGG + Intronic
1187873071 X:23780336-23780358 TAGCTGGGCGTGGTGGCAGGTGG + Intergenic
1187995971 X:24926975-24926997 TAGCTGGGTGTGGTGGCGCATGG - Intronic
1188441759 X:30220493-30220515 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1188583464 X:31744007-31744029 TAACTGGGCATGGTGGCACATGG - Intronic
1188691127 X:33130695-33130717 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1189771054 X:44427764-44427786 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1189814649 X:44812202-44812224 TAGCAGGTCATGGTGGCACACGG - Intergenic
1189825092 X:44910330-44910352 TAGCCGGGCATGGTGTCATACGG - Intronic
1190045188 X:47105697-47105719 TAGCCGGGTGTGGTGACACATGG + Intergenic
1190066337 X:47244242-47244264 TAGCTGGGCGTGGTGGCGCGCGG - Intronic
1190186302 X:48237523-48237545 TAGTCGGGTGTGGTGGCACATGG + Intronic
1190289985 X:48986093-48986115 TAGCTGGGCATGGTGGCACACGG + Intronic
1190455002 X:50618531-50618553 TAGCTAGGCATGGTGGCACACGG - Intronic
1190790038 X:53690425-53690447 TAGCCGGGTGTGGTGGCACATGG - Intergenic
1191043669 X:56113065-56113087 TAGCTGGGCATGGTGGTACATGG + Intergenic
1192454066 X:71262975-71262997 TAGCTGGGCATAGTGGCACATGG - Intergenic
1192475565 X:71438817-71438839 TAGCCAGGCGTGGTGGCACGTGG + Intronic
1192632401 X:72787706-72787728 GAGCAGGGCTTGGTGTCAAGGGG - Intronic
1192649308 X:72933095-72933117 GAGCAGGGCTTGGTGTCAAGGGG + Intronic
1192744947 X:73929615-73929637 TAGCCGGGAGTGGTGGCACATGG - Intergenic
1193563017 X:83042930-83042952 TAGCTGGGCATGGTGGCACGTGG + Intergenic
1193632506 X:83907744-83907766 TAGCCGGGCGTGGTGGCAGGCGG - Intergenic
1195045903 X:101054409-101054431 AAGCCGGGCGTGGTGGCTCACGG - Intergenic
1195172443 X:102282096-102282118 TGGCCGGGCGTGGTGGCTCACGG - Intergenic
1195186421 X:102404999-102405021 TGGCCGGGCGTGGTGGCTCACGG + Intronic
1195323562 X:103740323-103740345 TAGCCGGACGTGGTGGCGCATGG + Intergenic
1195801351 X:108715405-108715427 TGGCAGGGCATGGTGGCACATGG - Intergenic
1196072212 X:111538720-111538742 TAGCCAGGCGTGGTGGCACAAGG + Intergenic
1196209717 X:112982142-112982164 TAGCTGGGCATGGTGGCACATGG + Intergenic
1196429443 X:115607105-115607127 TAGCCAGGCATGGTGTCCCACGG + Intronic
1196741833 X:119032016-119032038 GAGCAGGGCCTGGTTTCTCACGG + Intergenic
1196920297 X:120578568-120578590 TAGCCGGGTGTGTTGGCACATGG - Intergenic
1197217086 X:123876557-123876579 TAGCAGGGCATGGTGGCATGTGG + Intronic
1197981938 X:132226549-132226571 TAGCTGGGCATGGTGGCACATGG - Intergenic
1198461316 X:136865511-136865533 TAGCTGGGTGTGGTGTCAGGAGG - Intronic
1198557972 X:137816221-137816243 TAGCCAGGCGTGGTGGTACATGG - Intergenic
1198756284 X:139985922-139985944 TATCCGGGCATGGTGGCACATGG + Intergenic
1199142803 X:144332540-144332562 TAGCCGGGCATGGTGGCACGTGG + Intergenic
1200007162 X:153094742-153094764 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
1200008106 X:153101224-153101246 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
1200316176 X:155135510-155135532 TAGCTGGGTGTGGTGGCACATGG + Intronic
1200789878 Y:7290018-7290040 TAGCCGGGCATGGTGGCACATGG + Intergenic
1200908647 Y:8511895-8511917 TAGCTGGGCTTGGTGGCCCATGG - Intergenic
1200953763 Y:8925485-8925507 TAGCTGGGTGTGGTGGCCCATGG - Intergenic
1201023546 Y:9682802-9682824 TAGCCGGGCTTGGTGTCCCATGG - Intergenic
1201321791 Y:12707261-12707283 TAGCTGGGCATGGTGGCGCATGG - Intronic
1202196194 Y:22300360-22300382 TAGCTGGGCTTGGTGGCCCATGG + Intergenic