ID: 1172411592

View in Genome Browser
Species Human (GRCh38)
Location 20:34727877-34727899
Sequence AGACAAAAATTAGCAGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303853
Summary {0: 4, 1: 701, 2: 29415, 3: 115655, 4: 158078}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172411592_1172411598 -5 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411598 20:34727895-34727917 TGTCTTTTTAGTAGAGATGGGGG 0: 10
1: 1837
2: 3926
3: 4585
4: 5227
1172411592_1172411595 -8 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411595 20:34727892-34727914 TTTTGTCTTTTTAGTAGAGATGG 0: 650
1: 203548
2: 144285
3: 71660
4: 58285
1172411592_1172411601 18 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411601 20:34727918-34727940 TTTCACCACACTGGCCAGGATGG 0: 8
1: 345
2: 4922
3: 43803
4: 162480
1172411592_1172411600 14 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411600 20:34727914-34727936 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328
1172411592_1172411596 -7 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411596 20:34727893-34727915 TTTGTCTTTTTAGTAGAGATGGG 0: 349
1: 91391
2: 247294
3: 162065
4: 91733
1172411592_1172411597 -6 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411597 20:34727894-34727916 TTGTCTTTTTAGTAGAGATGGGG 0: 330
1: 86252
2: 177172
3: 179561
4: 120265
1172411592_1172411599 9 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172411592 Original CRISPR AGACAAAAATTAGCAGGGCG TGG (reversed) Intronic
Too many off-targets to display for this crispr