ID: 1172411593

View in Genome Browser
Species Human (GRCh38)
Location 20:34727882-34727904
Sequence TAAAAAGACAAAAATTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360690
Summary {0: 8, 1: 2802, 2: 141649, 3: 127502, 4: 88729}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172411593_1172411600 9 Left 1172411593 20:34727882-34727904 CCCTGCTAATTTTTGTCTTTTTA 0: 8
1: 2802
2: 141649
3: 127502
4: 88729
Right 1172411600 20:34727914-34727936 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328
1172411593_1172411599 4 Left 1172411593 20:34727882-34727904 CCCTGCTAATTTTTGTCTTTTTA 0: 8
1: 2802
2: 141649
3: 127502
4: 88729
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
1172411593_1172411598 -10 Left 1172411593 20:34727882-34727904 CCCTGCTAATTTTTGTCTTTTTA 0: 8
1: 2802
2: 141649
3: 127502
4: 88729
Right 1172411598 20:34727895-34727917 TGTCTTTTTAGTAGAGATGGGGG 0: 10
1: 1837
2: 3926
3: 4585
4: 5227
1172411593_1172411601 13 Left 1172411593 20:34727882-34727904 CCCTGCTAATTTTTGTCTTTTTA 0: 8
1: 2802
2: 141649
3: 127502
4: 88729
Right 1172411601 20:34727918-34727940 TTTCACCACACTGGCCAGGATGG 0: 8
1: 345
2: 4922
3: 43803
4: 162480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172411593 Original CRISPR TAAAAAGACAAAAATTAGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr