ID: 1172411594

View in Genome Browser
Species Human (GRCh38)
Location 20:34727883-34727905
Sequence CTAAAAAGACAAAAATTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251646
Summary {0: 296, 1: 88338, 2: 74359, 3: 46507, 4: 42146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172411594_1172411601 12 Left 1172411594 20:34727883-34727905 CCTGCTAATTTTTGTCTTTTTAG 0: 296
1: 88338
2: 74359
3: 46507
4: 42146
Right 1172411601 20:34727918-34727940 TTTCACCACACTGGCCAGGATGG 0: 8
1: 345
2: 4922
3: 43803
4: 162480
1172411594_1172411600 8 Left 1172411594 20:34727883-34727905 CCTGCTAATTTTTGTCTTTTTAG 0: 296
1: 88338
2: 74359
3: 46507
4: 42146
Right 1172411600 20:34727914-34727936 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328
1172411594_1172411599 3 Left 1172411594 20:34727883-34727905 CCTGCTAATTTTTGTCTTTTTAG 0: 296
1: 88338
2: 74359
3: 46507
4: 42146
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172411594 Original CRISPR CTAAAAAGACAAAAATTAGC AGG (reversed) Intronic
Too many off-targets to display for this crispr